ID: 1116817918

View in Genome Browser
Species Human (GRCh38)
Location 14:49599935-49599957
Sequence CGGGGCCGGGGCGGGGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2908
Summary {0: 3, 1: 4, 2: 59, 3: 473, 4: 2369}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116817904_1116817918 2 Left 1116817904 14:49599910-49599932 CCTCCAGGCGGGCTGAGGCTGAG 0: 1
1: 1
2: 4
3: 40
4: 272
Right 1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369
1116817903_1116817918 3 Left 1116817903 14:49599909-49599931 CCCTCCAGGCGGGCTGAGGCTGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369
1116817905_1116817918 -1 Left 1116817905 14:49599913-49599935 CCAGGCGGGCTGAGGCTGAGCCC 0: 1
1: 2
2: 4
3: 34
4: 322
Right 1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG 0: 3
1: 4
2: 59
3: 473
4: 2369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116817918 Original CRISPR CGGGGCCGGGGCGGGGGCTC CGG Intronic
Too many off-targets to display for this crispr