ID: 1116825604

View in Genome Browser
Species Human (GRCh38)
Location 14:49670527-49670549
Sequence TCCTATCTATAGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116825604_1116825610 15 Left 1116825604 14:49670527-49670549 CCTTCCCCCTTCTATAGATAGGA 0: 1
1: 0
2: 0
3: 24
4: 197
Right 1116825610 14:49670565-49670587 AATGAAAGTACTCCATCCTTTGG 0: 1
1: 0
2: 1
3: 15
4: 159
1116825604_1116825611 26 Left 1116825604 14:49670527-49670549 CCTTCCCCCTTCTATAGATAGGA 0: 1
1: 0
2: 0
3: 24
4: 197
Right 1116825611 14:49670576-49670598 TCCATCCTTTGGCCAGTGATTGG 0: 1
1: 0
2: 2
3: 19
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116825604 Original CRISPR TCCTATCTATAGAAGGGGGA AGG (reversed) Intronic
902283816 1:15393456-15393478 TGCTATCTGTAAAAGGGTGAGGG + Intronic
902754871 1:18542365-18542387 TCCCATCCCTAGGAGGGGGATGG + Intergenic
903177178 1:21588082-21588104 TCCTATCTGTAAAATGGGGCCGG - Intergenic
904318934 1:29684035-29684057 CCCCATCTATAAAATGGGGATGG + Intergenic
905582060 1:39089826-39089848 CCTTATCTATAAAAGGGAGATGG + Intronic
905820361 1:40985360-40985382 TACTATGTATAGAAGTGAGAAGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908637143 1:66179952-66179974 TCCTTTCTATAGAATAGGGATGG - Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
911044872 1:93620048-93620070 TCCCTTCTTTCGAAGGGGGAAGG - Intronic
911048775 1:93651803-93651825 TCCCTTTTATAAAAGGGGGAGGG - Intronic
913057237 1:115174005-115174027 TTCTATCTGTAGGAGAGGGATGG + Intergenic
913127388 1:115805426-115805448 TCCTGTCTTGAGAAGAGGGAGGG + Intergenic
916389305 1:164313636-164313658 TCCTGTCTATAAAATGGGGCTGG - Intergenic
916717277 1:167456015-167456037 TGCTATCTGAGGAAGGGGGAGGG - Intronic
917105284 1:171485664-171485686 TCTGATCGAAAGAAGGGGGAGGG - Exonic
919259115 1:195167025-195167047 TCCTCTCTCTAGATGGGAGATGG - Intergenic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920599321 1:207306946-207306968 TCCTATCCAGAGAAGAGGCAAGG + Intergenic
920878670 1:209860183-209860205 TGCTATCTGTAAAATGGGGATGG + Intergenic
924783497 1:247172947-247172969 TCTTATCTATAGAAGAGGCTGGG - Intergenic
1064672183 10:17726892-17726914 TCATTTCTATAAAAGGTGGATGG + Intergenic
1065265867 10:23974880-23974902 GCCTATCTATGGGGGGGGGAAGG - Intronic
1065729434 10:28697301-28697323 TCCTACCTATGGAACTGGGAAGG + Intergenic
1068522787 10:58095521-58095543 TCCTATCCATCTAGGGGGGAGGG + Intergenic
1070569513 10:77630584-77630606 TCCCAGCTCTTGAAGGGGGAAGG - Intronic
1071731899 10:88256506-88256528 TCCTGTCTGAAGAAGGCGGATGG - Intergenic
1077333057 11:1991760-1991782 TCCTCTCTAGAGATGGGGGTGGG - Intergenic
1079135934 11:17775971-17775993 TGCTATCCATGGAGGGGGGAGGG + Intronic
1079982067 11:27161728-27161750 TATTATCTATAAAAGGGAGATGG - Intergenic
1082101609 11:48177429-48177451 TCCTAAATATAGAAGGGGAGGGG + Intergenic
1084027734 11:66463058-66463080 TCCTGTCTATAGAAGTTTGAGGG - Intronic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1086001277 11:81988444-81988466 TCATATCTCTGGAAAGGGGAAGG - Intergenic
1086875167 11:92086984-92087006 TCCTCTCAATAGAAGAGGGTGGG - Intergenic
1087281898 11:96220181-96220203 TGCTGTCTAGAGAAGGGGGTGGG + Intronic
1087429402 11:98033374-98033396 TCCTATCTACAGTAAGGGAATGG - Intergenic
1088408384 11:109505973-109505995 GCTTACCTATAGAAGGGTGAGGG + Intergenic
1089070130 11:115693332-115693354 TCCTACCCATGGAAAGGGGAGGG + Intergenic
1202816040 11_KI270721v1_random:46938-46960 TCCTCTCTAGAGATGGGGGTGGG - Intergenic
1092558753 12:9586817-9586839 TCCTTTCTGTAGAAGGGTAAGGG - Intergenic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094273422 12:28642254-28642276 TCCTACCTATAGATTGGGAAAGG + Intergenic
1098279888 12:68851857-68851879 TCATGACTTTAGAAGGGGGAAGG - Exonic
1098457008 12:70685851-70685873 TCCTATCTGAAAAATGGGGAAGG - Intronic
1100820889 12:98428544-98428566 TCTTATCTCTAAAACGGGGATGG - Intergenic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1104067186 12:125315773-125315795 TGCTATCTTTAGATGGGGAATGG - Intronic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1108594727 13:51939659-51939681 TCTTAGCTATAGAAGCAGGAGGG + Intronic
1109031362 13:57193876-57193898 TCCTATCTTTAGAAGGTCGCTGG - Intergenic
1114600857 14:23954338-23954360 TCCCATCTAGGTAAGGGGGAGGG - Intronic
1114605082 14:23989485-23989507 TCCCATCTAGGTAAGGGGGAGGG - Intronic
1114610539 14:24037050-24037072 TCCCATCTAGGTAAGGGGGAGGG - Intergenic
1116619990 14:47189209-47189231 TTCTATATATGGATGGGGGAGGG - Intronic
1116761672 14:49022593-49022615 TCCCCTCTATATAGGGGGGATGG + Intergenic
1116825604 14:49670527-49670549 TCCTATCTATAGAAGGGGGAAGG - Intronic
1118313254 14:64708203-64708225 TCCTATCTGTAGGATGGGGGTGG - Intronic
1120912521 14:89680473-89680495 TCCTATCTACCCAAGGGAGAAGG - Intergenic
1121126458 14:91410107-91410129 TCCTGTATATAGATGAGGGAGGG - Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1122040513 14:98984542-98984564 TCCATTTTATAGATGGGGGAAGG + Intergenic
1122835492 14:104428697-104428719 TCCTCTCTATAAAATGGGAAGGG + Intergenic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1127961133 15:63891806-63891828 TGCTAGCTAAAGAAGGGGCAAGG - Intergenic
1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130193896 15:81761268-81761290 TATTATCTGTAGAACGGGGATGG - Intergenic
1131901605 15:97094056-97094078 TCCTATCTAAAAAAAGGGCAGGG + Intergenic
1131973270 15:97914267-97914289 TCCTATCTGTAGCAGAGGTAGGG - Intergenic
1134351662 16:13443427-13443449 TGTTATCTATAAAATGGGGATGG + Intergenic
1137006278 16:35276663-35276685 TCCTTTGTTTAGAAAGGGGAGGG + Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1138139107 16:54551623-54551645 ACAAATCTATAGAAGGGAGAAGG - Intergenic
1138762152 16:59557831-59557853 TCCTTTCTGTAGGAGGGGGTGGG + Intergenic
1138835629 16:60431105-60431127 TCCTATCTGTAAAATGAGGAAGG - Intergenic
1140232456 16:73128870-73128892 TCTCATCTATATAACGGGGATGG + Intronic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1141202671 16:81909985-81910007 TTATATATATAAAAGGGGGATGG + Intronic
1141894720 16:86951999-86952021 TCCTTTGTAGAGATGGGGGAGGG - Intergenic
1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG + Intergenic
1144950449 17:18990881-18990903 TCCTGTCTATAAAATGGGAAAGG - Intronic
1149267335 17:54941292-54941314 TTCTATATTTAAAAGGGGGAGGG + Intronic
1150126389 17:62638033-62638055 TCCTATTTTTAGTAGTGGGAGGG + Intronic
1150133272 17:62680556-62680578 TCCGGTCGAGAGAAGGGGGACGG + Intronic
1151809578 17:76430162-76430184 TCCAATTTCTAGAAGGTGGAAGG - Intronic
1154097053 18:11427977-11427999 TACTATCTATAGAAACTGGAAGG + Intergenic
1156311225 18:35923945-35923967 TCCTATCTATCTAAGGGGTCTGG - Intergenic
1157380256 18:47208073-47208095 TCTTATCTATAAAATGTGGATGG - Intergenic
1157637187 18:49170174-49170196 ATCTATTTATAAAAGGGGGAGGG - Intronic
1160848537 19:1178075-1178097 TCCCACCTATAAAATGGGGAGGG + Intronic
1162198823 19:9006731-9006753 TCTCATCTATAAAACGGGGATGG + Intergenic
1164300416 19:23957085-23957107 TCCAATCTACTCAAGGGGGATGG + Intergenic
1166887031 19:45967975-45967997 TGTTATTTATGGAAGGGGGAAGG - Intronic
925701262 2:6640703-6640725 TCCTTTCTATAGAAGCTTGAAGG - Intergenic
927259052 2:21068466-21068488 ACCTAGCTACAGAAGGAGGATGG - Intergenic
929301339 2:40306814-40306836 TCCTATCCAGGGAATGGGGAAGG + Intronic
930495079 2:52131202-52131224 TCCTATGAAGAGAAGGAGGAAGG - Intergenic
931281282 2:60794140-60794162 TCCCATCTATGGATGGGGAATGG - Exonic
936480586 2:112881280-112881302 CCCTCTCTATAGATGGGGAAGGG + Intergenic
936787358 2:116110111-116110133 TCCTATCTCTTGAAGGGAGAGGG + Intergenic
936834682 2:116694299-116694321 TCTTATCTATGAAAGGGGAAGGG + Intergenic
938071319 2:128310000-128310022 TCCCATCTCTAAAAGGGGGGTGG - Intronic
940302004 2:152185109-152185131 TCCTAAATATAGAAGGGGAGGGG + Intergenic
942888508 2:180958693-180958715 TCCTATTTTTAAAAGGAGGAAGG + Intergenic
943700207 2:190981023-190981045 TCCTCTCTTTAGAGGAGGGAGGG - Intronic
1172884121 20:38219984-38220006 TCCCTTCTAGGGAAGGGGGAGGG - Intronic
1172996607 20:39075001-39075023 ACATATCAATAGAAGAGGGATGG + Intergenic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1174663617 20:52236909-52236931 TTCTATCTATAAAACAGGGATGG - Intergenic
1175659818 20:60803151-60803173 TCCTATATATAAAATGGGCATGG + Intergenic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1178263730 21:31123620-31123642 TCCTACCTATTGAAGAGGGATGG - Intronic
1179009715 21:37546851-37546873 TCCTATCTATAAAACGGGAATGG - Intergenic
1181762825 22:25069639-25069661 TCCTCTCTGTAAAATGGGGATGG + Intronic
1183147533 22:36008342-36008364 TCCAAGCAAAAGAAGGGGGAGGG + Intronic
949426779 3:3926138-3926160 ACACATCTATAGAATGGGGAAGG - Intronic
950711034 3:14812968-14812990 TCCCATCTATAAAATGGGGATGG - Intergenic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951600803 3:24372701-24372723 TCCTGTCTGTAAAATGGGGATGG - Intronic
952073651 3:29670204-29670226 TCAGATTTATAGATGGGGGAAGG - Intronic
954089475 3:48273008-48273030 TCCTAACTATAGAAGGGGAGGGG - Intronic
954344449 3:49985011-49985033 TTCTATCTAAAGAAGGGTGAGGG - Intronic
954980315 3:54739891-54739913 TACTTTTTATAGAATGGGGAAGG - Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955240534 3:57174131-57174153 TCCTCTCCATTGCAGGGGGAAGG + Intergenic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959783932 3:110270321-110270343 TCCTATCCATAAAATGGGTATGG + Intergenic
960965928 3:123104689-123104711 TCCTTACTATAGAAGTGGTAAGG + Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
964611800 3:158623226-158623248 TCCTAAATATAGAAGGGGAGGGG + Intergenic
965529799 3:169760067-169760089 TGCTTTCTCTAGAAGGGTGAGGG - Intergenic
967925005 3:194639119-194639141 TCCTTTCTGTAAAAGGAGGAAGG + Intergenic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
974026028 4:56733909-56733931 TCCCATCTACAGAAGGGTGATGG - Intergenic
976849568 4:89529671-89529693 TCCTACCAGAAGAAGGGGGAAGG - Intergenic
977304371 4:95304324-95304346 TTCTTTCCATAGAAGGGTGATGG - Intronic
977749484 4:100591823-100591845 TGCTATATAGAGAATGGGGAAGG - Intronic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
978669796 4:111232969-111232991 TCCTAACTCTAGCAGGGAGAGGG - Intergenic
979737922 4:124111621-124111643 TCCTATATGAGGAAGGGGGAAGG - Intergenic
990743238 5:58933580-58933602 TACTAAGTATAGAATGGGGAGGG + Intergenic
991962211 5:72056483-72056505 TGCTATCTATGGAAGTTGGATGG + Intergenic
991972179 5:72151783-72151805 TACTATCTAAAGAACAGGGAGGG - Intronic
992285013 5:75226069-75226091 TCCTACCTATGGAAACGGGAAGG + Intronic
993875290 5:93299655-93299677 ACCTTTCAATACAAGGGGGAGGG + Intergenic
997419575 5:133755387-133755409 TCCTGTCTATAGCAGGTGGAGGG - Intergenic
998636604 5:143961964-143961986 TCCTGTCTATAGTACCGGGATGG + Intergenic
999043222 5:148439173-148439195 TCATAACTAGAGATGGGGGAGGG + Intronic
1000023711 5:157340869-157340891 TCCCATCTATAGAAAGGAGACGG + Intronic
1000278864 5:159764750-159764772 TCCTATCAATCAAATGGGGATGG - Intergenic
1002001837 5:176200435-176200457 TCCCCTGTGTAGAAGGGGGAAGG - Intergenic
1002252501 5:177938543-177938565 TCCCCTGTGTAGAAGGGGGAAGG + Intergenic
1002696221 5:181092909-181092931 TCCTAATTACAGTAGGGGGAGGG + Intergenic
1004872780 6:19923890-19923912 TCCCATCTATAGAAAGGGTGTGG - Intergenic
1005005283 6:21281742-21281764 AGCTATCTGTAAAAGGGGGAGGG - Intergenic
1007053443 6:38857022-38857044 ACTTATCTATAGAAGAGAGAGGG - Intronic
1008811540 6:55506897-55506919 TCCTATCAATAGAATTGTGAAGG + Intronic
1009757650 6:67960125-67960147 TCATAAATATAGAAGTGGGAAGG + Intergenic
1010152095 6:72744881-72744903 TCCTATAGTTAGAATGGGGAAGG + Intronic
1010515713 6:76770681-76770703 TCTTATCTGTAGAAGAGGAAAGG - Intergenic
1011534904 6:88366294-88366316 TCCAATCAATAGCAGGGTGAGGG + Intergenic
1012735894 6:102942523-102942545 TCCTATTTATGGCAGAGGGAAGG - Intergenic
1014397289 6:120940808-120940830 TCCTTTCTTTTGAAGAGGGAAGG + Intergenic
1015378296 6:132535537-132535559 TCCTATTTTTAGAAGGGTGGAGG - Intergenic
1016113366 6:140253757-140253779 TCCTTTCAATAGATGGGGGAAGG - Intergenic
1016321228 6:142848251-142848273 TCTTATCTATGGATGTGGGATGG + Intronic
1016912098 6:149209200-149209222 TCCTGGACATAGAAGGGGGAAGG + Intergenic
1018071869 6:160171800-160171822 TCATATTTATAAAATGGGGAGGG + Intronic
1018919260 6:168160074-168160096 CCCTATCTATAAAATGAGGAGGG + Intergenic
1020180146 7:5916003-5916025 TTCTATCTATAGTAGAGGCAGGG - Intronic
1020302787 7:6808879-6808901 TTCTATCTATAGTAGAGGCAGGG + Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1024464675 7:49699846-49699868 TCTTATCTATAGAATTGTGAAGG + Intergenic
1028742681 7:94293866-94293888 TACTAATTATAGAAGGGGTATGG - Intergenic
1029031581 7:97473534-97473556 TGCTTTCTATGGAAGGGGGAAGG - Intergenic
1035730123 8:1848327-1848349 TCCTTTCTATAGACGAGGGATGG + Intronic
1038014537 8:23502834-23502856 GCCTATCTGTAGGTGGGGGATGG - Intergenic
1039329156 8:36517601-36517623 TCCTAGATATTGAAGGGAGAAGG + Intergenic
1039899666 8:41742297-41742319 TCCTGTCAAGAGAAGGGGAACGG + Intronic
1040459442 8:47633392-47633414 TCTTCTTTATAGGAGGGGGATGG + Intronic
1041866542 8:62581526-62581548 GTCTATCTATAGAAGAGAGAAGG - Intronic
1043136033 8:76526314-76526336 TCCAACATATGGAAGGGGGAAGG + Intergenic
1044781682 8:95750082-95750104 TCCTTTCCATACAAGGTGGATGG - Intergenic
1046511021 8:115203032-115203054 AGCTATTTATAGAAGGGTGAGGG - Intergenic
1046565341 8:115892389-115892411 TCCCATTTATAAAATGGGGATGG - Intergenic
1047301927 8:123620935-123620957 TCCCATCTGTAGAATGGGAATGG + Intergenic
1048799528 8:138183101-138183123 TCCTACATATACAAGGGGGGTGG + Intronic
1049653096 8:143784831-143784853 TACTATGTCTAGAAGGTGGAAGG + Intergenic
1053138331 9:35665498-35665520 TCCTATCTGGAGAATTGGGACGG + Intronic
1053464304 9:38293992-38294014 TCCCATCTATAAAACAGGGATGG - Intergenic
1055613420 9:78046065-78046087 TCCAATCTAAAGAGAGGGGAGGG + Intergenic
1056290674 9:85140771-85140793 TTCTATTTATAGAAGGTGGATGG - Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057298657 9:93863859-93863881 CCCTTTCTATAGAATGGGGAGGG - Intergenic
1057379785 9:94557075-94557097 TACTATCAATAAAAGGGGCAGGG - Intergenic
1058211430 9:102174397-102174419 TCCTATTCAAAGAAAGGGGAGGG - Intergenic
1058723579 9:107781202-107781224 TCCTACTTATAGCAAGGGGAGGG - Intergenic
1059414599 9:114155344-114155366 CCCCATCTATACAAGGAGGAGGG + Intergenic
1059694344 9:116716497-116716519 TCCCATCTGTAGAATGGGAATGG + Intronic
1060571240 9:124642365-124642387 TATTATCTATAAAATGGGGATGG + Intronic
1060583595 9:124772047-124772069 CCCTATCTGTAAAAGGGGGTTGG + Intergenic
1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG + Intronic
1186808498 X:13163520-13163542 TCCTATATATAGAAGGAAGTGGG - Intergenic
1189033902 X:37476957-37476979 CCCTATCTATACAAGGGGAAGGG - Intronic
1189286561 X:39855877-39855899 TGCTATATATAGAAGCTGGAGGG + Intergenic
1189750160 X:44212538-44212560 TCCCATCTAGAGTAGGGGGAGGG + Intronic
1190527508 X:51342816-51342838 GCCTATTTAGAGAAGAGGGAGGG - Intergenic
1195767770 X:108314777-108314799 TCCTATCTGTAAAATGAGGATGG + Intronic
1197243575 X:124145752-124145774 TCCTAAATATAGAAGGGGAGGGG - Intronic
1198030253 X:132747642-132747664 TCCCATTTGTACAAGGGGGAGGG + Intronic
1199058133 X:143321472-143321494 TCTTATCTATCAAAGGAGGAGGG + Intergenic
1199540545 X:148953444-148953466 TCCTATCTATAAAATGGGAACGG + Intronic
1200683203 Y:6237175-6237197 ACCTGTCTGTAGAAGGGGTAAGG - Intergenic
1200785635 Y:7258026-7258048 TCCTAAATATAGAAGGGGAGGGG + Intergenic
1200832257 Y:7698365-7698387 ACCTGTCTATAGAAGAGGTAAGG + Intergenic
1200960970 Y:8995830-8995852 ACCTGTCTATAGAAGGGGTAAGG - Intergenic
1201049430 Y:9917211-9917233 ACCTGTCTGTAGAAGGGGTAAGG + Intergenic
1202114635 Y:21459333-21459355 ACCTCTCTATAGAAGGGGTAAGG - Intergenic