ID: 1116826070

View in Genome Browser
Species Human (GRCh38)
Location 14:49674912-49674934
Sequence GCTTGTGCATTTTCATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116826067_1116826070 24 Left 1116826067 14:49674865-49674887 CCATAATTTCTTATAGTGTCAAA 0: 1
1: 0
2: 2
3: 22
4: 330
Right 1116826070 14:49674912-49674934 GCTTGTGCATTTTCATCTCAAGG 0: 1
1: 0
2: 1
3: 17
4: 216
1116826065_1116826070 29 Left 1116826065 14:49674860-49674882 CCAGCCCATAATTTCTTATAGTG 0: 1
1: 0
2: 1
3: 31
4: 270
Right 1116826070 14:49674912-49674934 GCTTGTGCATTTTCATCTCAAGG 0: 1
1: 0
2: 1
3: 17
4: 216
1116826064_1116826070 30 Left 1116826064 14:49674859-49674881 CCCAGCCCATAATTTCTTATAGT 0: 1
1: 0
2: 3
3: 58
4: 445
Right 1116826070 14:49674912-49674934 GCTTGTGCATTTTCATCTCAAGG 0: 1
1: 0
2: 1
3: 17
4: 216
1116826066_1116826070 25 Left 1116826066 14:49674864-49674886 CCCATAATTTCTTATAGTGTCAA 0: 1
1: 0
2: 1
3: 39
4: 333
Right 1116826070 14:49674912-49674934 GCTTGTGCATTTTCATCTCAAGG 0: 1
1: 0
2: 1
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116826070 Original CRISPR GCTTGTGCATTTTCATCTCA AGG Intronic
905242640 1:36590725-36590747 GCTTTTGCATTTTATCCTCATGG + Intergenic
905265112 1:36747410-36747432 GCTTCTGCATTTTTATCTTAAGG - Intergenic
907812740 1:57888242-57888264 GAATGTGCATTTTTATCTGATGG - Intronic
908171900 1:61513172-61513194 TCTTGAGCATTTTCAGCTCAGGG - Intergenic
911952076 1:104186046-104186068 GCTTGTGCATCTTCACAGCATGG - Intergenic
915267081 1:154726631-154726653 ACTTGGGCTTTTTCACCTCAAGG + Intronic
916190461 1:162172730-162172752 GTTTGTTTGTTTTCATCTCAAGG + Intronic
916667657 1:166981080-166981102 GCTTGAGCAGTTTCTTTTCATGG - Intronic
917488132 1:175473944-175473966 GCTTGTGCACTGACAGCTCAAGG - Intronic
917488540 1:175477575-175477597 GCTTGTCCATTTTCATTAGATGG - Intronic
918560058 1:185854833-185854855 GCTTGTGTAATTTCCTCTCTTGG - Intronic
919053446 1:192539640-192539662 GCTTGTGTATTTGCTTCTTAGGG + Intergenic
919300181 1:195752431-195752453 ACATGTGAATTTTCATGTCAAGG + Intergenic
919509948 1:198449339-198449361 GGTTGTGAAATTTCCTCTCAAGG + Intergenic
919810243 1:201404869-201404891 GCTTGTGCCTGTTCATCAGAAGG - Exonic
920517741 1:206599134-206599156 GCATCTGCATTTTTGTCTCATGG - Intronic
1064065887 10:12181285-12181307 GTATCTGCATTTTCATATCAGGG + Intronic
1066216558 10:33294137-33294159 GCATGTGCAGTTTTATGTCATGG + Intronic
1066543299 10:36473127-36473149 CATTGTGCACTTTCACCTCATGG + Intergenic
1069869228 10:71523095-71523117 GCTTCCACCTTTTCATCTCAGGG - Intronic
1070447949 10:76526348-76526370 GCATGTGCATTTTAGCCTCATGG + Intronic
1070454453 10:76597855-76597877 GTTTATGCATTTTACTCTCATGG + Intergenic
1073498246 10:103913348-103913370 CCCTGTGAATTTTCATCTCACGG + Intronic
1075419462 10:122290050-122290072 GCTTGTGCATTTTTAAATCTGGG - Intronic
1075540031 10:123304671-123304693 GCAGGTGCATTTTAATCACAAGG + Intergenic
1075763780 10:124876975-124876997 GCAAGAGCATTTACATCTCAGGG - Intergenic
1076232139 10:128829568-128829590 TCTTATGCATTTTCTTATCAAGG - Intergenic
1080851037 11:36070454-36070476 CCTTGTGGATATTTATCTCATGG + Intronic
1081653455 11:44840996-44841018 ACTTGAGCATTTTCATCCCTTGG + Intronic
1081786982 11:45754564-45754586 GCTTTTCCATTTTCCTCTCCAGG - Intergenic
1082587531 11:54960552-54960574 GGATGTGCACATTCATCTCACGG + Intergenic
1085383741 11:76143469-76143491 GCTTGTGGCTTTTCACCGCACGG + Intergenic
1086856130 11:91868186-91868208 GCTTTTGCAATTTAATCTCTAGG - Intergenic
1087783603 11:102328918-102328940 GACTCTGCATTTTCATCTCCTGG - Exonic
1088453807 11:110012444-110012466 GCTTGAGCATCTTCATAACATGG + Intergenic
1088519006 11:110674382-110674404 GATTGTGGATTTTCAGATCAGGG - Intronic
1091595527 12:1876239-1876261 CCTTCTGCATTTTCATCTTAGGG + Intronic
1092732007 12:11543938-11543960 GCTTGTGAATTTTATTCACAGGG - Intergenic
1094860241 12:34457290-34457312 TCATGTGCACATTCATCTCATGG - Intergenic
1094968293 12:36205919-36205941 TCTTGTGTGTGTTCATCTCACGG + Intergenic
1095549118 12:43412316-43412338 GCTTGAGCATTTTTATTTAAAGG + Intronic
1098231364 12:68374971-68374993 GCTTGTGAATCTTTGTCTCAGGG + Intergenic
1100496962 12:95134514-95134536 ATGTGTGCATTTTCACCTCAGGG - Intronic
1101808073 12:108082371-108082393 GCATGTGCATTTACACTTCAGGG - Intergenic
1102712486 12:114940262-114940284 GCTTGAGCATTTTCATAACATGG + Intergenic
1103708238 12:122891907-122891929 GCATGGGCATTTTCATGCCATGG + Intronic
1104260116 12:127174524-127174546 GCTCATGCACCTTCATCTCATGG + Intergenic
1104744547 12:131202755-131202777 GCCTGTGCATTTTCAGGTGAGGG + Intergenic
1104789836 12:131474452-131474474 GCCTGTGCATTTTCAGGTGAGGG - Intergenic
1108121637 13:47194262-47194284 ACTTGTTCATTTTCATATCATGG + Intergenic
1109158628 13:58944355-58944377 GCTTCTTCATTTTCATGTTAAGG - Intergenic
1109436524 13:62310877-62310899 CTTTGTGGATTTTAATCTCATGG - Intergenic
1110910955 13:80962476-80962498 TCAAGTGCATTTTTATCTCAAGG + Intergenic
1112186764 13:97135246-97135268 GCTTTTGCCTTTTCTTTTCATGG + Intergenic
1113238758 13:108313399-108313421 GCTTGTTCCTCCTCATCTCATGG - Intergenic
1113983024 13:114292248-114292270 ACATGTTCATTTTCAGCTCAAGG + Intronic
1115314251 14:32009539-32009561 GCTGCTGCATTTTCACCTGATGG - Intronic
1116826070 14:49674912-49674934 GCTTGTGCATTTTCATCTCAAGG + Intronic
1117133363 14:52707523-52707545 TCTTTTTCATTTTCACCTCAAGG - Intronic
1117599702 14:57362710-57362732 AGTTGTTCATTTTCTTCTCAGGG + Intergenic
1118602125 14:67478193-67478215 GCCTGGGCATATTCTTCTCATGG + Intronic
1120825678 14:88952815-88952837 GTTAGTTCATTTTCCTCTCAAGG - Intergenic
1127975428 15:63993604-63993626 TCTTGGGCATTTTCAAGTCATGG - Intronic
1128570419 15:68729628-68729650 GCTTGTTCTTTCTCATGTCATGG - Intergenic
1131316610 15:91344246-91344268 GTTTGTGCATTTTCATCCTCAGG + Intergenic
1131707843 15:95017849-95017871 ACTTTGGCATTTTCATCTGATGG + Intergenic
1132285492 15:100659188-100659210 GCCTGTGCTTTTTTATCTCAAGG - Intergenic
1133076994 16:3287699-3287721 ACTTGTGGGTTTTAATCTCATGG + Intronic
1133385663 16:5368271-5368293 GCGACTGCATTTTCATCTCTAGG + Intergenic
1134032406 16:11003127-11003149 CCTTGTGCTTGTTCATCTCAAGG - Exonic
1136859790 16:33691485-33691507 TCTTGTGCTGCTTCATCTCATGG + Intergenic
1141003483 16:80330322-80330344 GCTTGTGCATTTTCTCCATAAGG - Intergenic
1203121296 16_KI270728v1_random:1539664-1539686 TCTTGTGCTGCTTCATCTCATGG + Intergenic
1142526903 17:549301-549323 GCTTGTTTATTTCCATCACATGG + Intronic
1143299709 17:5900380-5900402 GCCTGTGGATTCTAATCTCAAGG + Intronic
1147845792 17:43403083-43403105 GATTCTGCATTTTGAACTCAGGG + Intergenic
1149251075 17:54770027-54770049 GTTTGTGCATTTTCCTCCCTGGG + Intergenic
1150588151 17:66537050-66537072 CCTTGTGAATTTTACTCTCAGGG + Intronic
1153109915 18:1573819-1573841 GGTTGCTCATTTTCTTCTCAGGG - Intergenic
1153178586 18:2406759-2406781 GCTTGTTTATTTTCACTTCAGGG + Intergenic
1153456450 18:5287799-5287821 GCTTCTGCCTTTGCATCTCCAGG + Intergenic
1153560484 18:6367628-6367650 GCTTGTGCATGTTCCTCAGAAGG + Exonic
1154439541 18:14375625-14375647 GCATGTGCATTTCTTTCTCAAGG - Intergenic
1157045491 18:44098475-44098497 GCTTGTTCTTTTTCATCTGTGGG + Intergenic
1158881357 18:61782390-61782412 GCTTATACATTTTCTTCCCAGGG - Intergenic
1159098634 18:63935294-63935316 AATTGTGCTTTTCCATCTCATGG - Exonic
1159565785 18:70046972-70046994 GCTTGTGCATTTTGGGCACAAGG - Intronic
1160164434 18:76497063-76497085 CCTTGTCCATTTTCAACACATGG - Exonic
1160415484 18:78706893-78706915 GTGTGTGCAATTTTATCTCAGGG + Intergenic
1165968192 19:39602582-39602604 GGCTGTGCCTTTTCAACTCACGG - Exonic
1165981562 19:39728647-39728669 GGCTGTGCCTTTTCAACTCATGG + Intergenic
1167234226 19:48303919-48303941 GCTGCTGCCTTTGCATCTCAAGG - Intronic
925344294 2:3159618-3159640 TCGTGTGCAATTTTATCTCATGG - Intergenic
925801523 2:7606838-7606860 CCTTGTGCATTTTCATCAAGTGG - Intergenic
928072028 2:28226769-28226791 GCTGGGGCAATTTCACCTCAGGG - Intronic
929000253 2:37341326-37341348 ACGTCTGCGTTTTCATCTCATGG - Intergenic
929087293 2:38181230-38181252 GCTTGGGAATGCTCATCTCAGGG - Intergenic
931334481 2:61325392-61325414 ACTTGTGTATTTTCAACTCTGGG - Exonic
933070260 2:77848385-77848407 ATTCATGCATTTTCATCTCAAGG + Intergenic
933236720 2:79872534-79872556 GTTTATCCATTTTCATCTCTGGG + Intronic
933611703 2:84443399-84443421 TCTTGTGCTTTTTCCCCTCAGGG - Exonic
934907558 2:98218656-98218678 GCCTGTGCATATGCATTTCAAGG + Intronic
936408369 2:112229526-112229548 GCTAGGGCATGTTCTTCTCATGG - Intronic
937053723 2:118913654-118913676 TGTTGTTCATTTTCTTCTCAAGG + Intergenic
937706328 2:124924879-124924901 TCTTGTGCACTTTCAGCTGATGG - Intergenic
940918065 2:159279892-159279914 GCATGTGCATTTTCTCCTAATGG - Exonic
940944060 2:159596144-159596166 TCTTGTGCATTTTGGTCTCCTGG + Intronic
941313142 2:163959522-163959544 CCCTGTGCATTTTCACCACATGG - Intergenic
941718403 2:168787498-168787520 GGTTGTACCTTTTCTTCTCAAGG - Intronic
943200866 2:184822107-184822129 GCATGTGTATGTTCATCGCAAGG + Intronic
943683263 2:190789871-190789893 GTATGTGAATCTTCATCTCAGGG + Intergenic
944532559 2:200681549-200681571 GCTGGAGCATTTTCATCCAAGGG + Intergenic
945927266 2:215818568-215818590 GCTTTTCCATTTTCATCTAAGGG - Intergenic
945990603 2:216392637-216392659 GGTTTTGCATTTTCTCCTCACGG + Intergenic
946538258 2:220655983-220656005 GCTTGTCCATTTGCACATCAGGG + Intergenic
946842538 2:223832766-223832788 CTTTGTTCATTTTAATCTCAGGG - Intronic
947486090 2:230550392-230550414 GCTTTGGCATTCTCATCCCATGG - Intergenic
1169554747 20:6737298-6737320 GCTTGTGCAATCTTATCTGAAGG + Intergenic
1169627019 20:7582498-7582520 GCTTCTGCACTCTCATCTAAGGG - Intergenic
1169856478 20:10109136-10109158 GCATGTGATTTCTCATCTCAAGG + Intergenic
1170063988 20:12290778-12290800 GCTCATGAATCTTCATCTCAGGG + Intergenic
1170571213 20:17633930-17633952 GCGGGTGGATCTTCATCTCAAGG - Intronic
1171167729 20:22986788-22986810 TCTAGTGAATTTTCAGCTCAGGG + Intergenic
1175437323 20:58962719-58962741 GCACGTGAATTGTCATCTCAGGG - Intergenic
1176456202 21:6914112-6914134 GCATGTGCATTTCTTTCTCAAGG + Intergenic
1176834375 21:13779161-13779183 GCATGTGCATTTCTTTCTCAAGG + Intergenic
1177389365 21:20446811-20446833 TTTTGTTCACTTTCATCTCATGG - Intergenic
1178037686 21:28603042-28603064 GATGGTGAATTCTCATCTCAAGG + Intergenic
1178284770 21:31316398-31316420 GCTCATGCCTTTTCATCTGAGGG - Intronic
1181697312 22:24600246-24600268 GTCTGTGCATTGTCATCTCAAGG + Intronic
1182995356 22:34807240-34807262 GTTTGTGAATTTTCATCTCCAGG + Intergenic
1185181113 22:49363967-49363989 GCTTGTGAATTTGCAGCTCAGGG + Intergenic
951259385 3:20488748-20488770 GCTTGTGCATTTTAATTTCAGGG + Intergenic
955483244 3:59410629-59410651 GAGTGTGCATGTTCTTCTCAAGG + Intergenic
956378318 3:68639270-68639292 TTTTGTGAATTTTAATCTCATGG + Intergenic
956539275 3:70316623-70316645 CCATGTGTATTTTCATATCAAGG - Intergenic
957503905 3:81095090-81095112 GCTTCTGCCTTTTCTTCCCAAGG + Intergenic
958745334 3:98127307-98127329 GCTTGTGAATTAGCATCACATGG + Intergenic
958751932 3:98202059-98202081 GCTTGTGAATTAGCATCACATGG + Intergenic
959864305 3:111248603-111248625 GCTGGGGCATGTTCTTCTCATGG + Intronic
960392474 3:117095031-117095053 GCTTGTTAATTTTCCTCCCAGGG - Intronic
960849027 3:122032726-122032748 GCTTGAGCATTCTCATGACATGG - Intergenic
961432226 3:126891363-126891385 GCAGGTGCATTTCCACCTCAGGG - Intronic
963004449 3:140712991-140713013 GCTTGTTCATCTTTATTTCAAGG - Intergenic
964310092 3:155383273-155383295 TCTTCTTCATTTTCATGTCAAGG - Intronic
965477833 3:169179259-169179281 GCTTTTGCATTAATATCTCATGG - Intronic
966099151 3:176244859-176244881 GCTGGGGCATGTTCTTCTCATGG - Intergenic
971573853 4:28249296-28249318 GCTATTCCACTTTCATCTCAGGG - Intergenic
974096517 4:57370337-57370359 GTTTCTGCATTTTGATATCATGG + Intergenic
974165948 4:58202100-58202122 GCTTGTCCAATTTCACCACATGG - Intergenic
977189926 4:93986855-93986877 CCTTGTGCTTCTTCATATCACGG - Intergenic
982167388 4:152626904-152626926 GCATGTTCCTTTTCAACTCATGG - Exonic
982240797 4:153297423-153297445 ATTTTTGCATTTTCATTTCATGG - Intronic
985561474 5:588725-588747 CCTTGTTCATTTTTATTTCAAGG - Intergenic
986779484 5:11051127-11051149 GCTAGTGAATTTCCTTCTCAAGG + Intronic
986843169 5:11721742-11721764 TCTTGAGCATGTTCACCTCATGG + Intronic
987428568 5:17802663-17802685 TCTTGTTCCTTTTCATTTCATGG + Intergenic
988305689 5:29491907-29491929 GCATGTGCAGTTTCATTACATGG + Intergenic
988518910 5:31928783-31928805 GCTTCTGAATTTTCTTTTCAAGG - Intronic
989802951 5:45566786-45566808 GCTTGGGCATTTTCCTCATAGGG - Intronic
989837462 5:46009981-46010003 TCATGTGCATGTTCATTTCACGG + Intergenic
993820985 5:92616647-92616669 GCTTGTACATTTTTATCTGAAGG + Intergenic
994894378 5:105683655-105683677 GTTTGTGTATTTTCATCTCCTGG + Intergenic
995634263 5:114167706-114167728 GTTTGTACATTTTCATATCTGGG - Intergenic
995803505 5:116025303-116025325 GAATGGGCATTTTCATCTTATGG + Intronic
999109776 5:149108796-149108818 GCAAGTCCATTTTCATCTCTGGG - Intergenic
999289802 5:150416840-150416862 GCTTGCTCATTTACTTCTCAAGG - Intergenic
1003406127 6:5828540-5828562 GCTTGTACGTTTCCCTCTCAGGG + Intergenic
1003480579 6:6528482-6528504 GCTAGGGCATATTCTTCTCATGG - Intergenic
1004611184 6:17241104-17241126 GCTTGAGCATATTCTTCTTATGG - Intergenic
1005061447 6:21780399-21780421 CCTTGAGCATTTTCATCTCTGGG + Intergenic
1005067112 6:21829272-21829294 GCCAGGGCATTTTCACCTCATGG + Intergenic
1005094279 6:22096087-22096109 TCTTGTGCAATATGATCTCAAGG - Intergenic
1007082666 6:39119211-39119233 GCTGTTGCAAGTTCATCTCATGG - Intergenic
1007098068 6:39226772-39226794 ACTTGTCCATTTTCATTTCTTGG + Intronic
1007383563 6:41505324-41505346 GCGTGTGCATTTTTAACTCTGGG + Intergenic
1008532852 6:52480655-52480677 GTTTGTTCATTGTCACCTCAAGG - Intronic
1010266737 6:73876227-73876249 GCTTGAGTGTGTTCATCTCATGG + Intergenic
1010456782 6:76064819-76064841 GGTTGTGCAGTTCCATCTCCAGG - Intronic
1011968453 6:93190665-93190687 GCTTCTGCATTTTTATCAAAGGG + Intergenic
1013903609 6:115187495-115187517 CCTAGTCCACTTTCATCTCAGGG + Intergenic
1014647754 6:123995371-123995393 GCATGTGCAAGTTTATCTCATGG - Intronic
1015792874 6:136981695-136981717 GCACATGAATTTTCATCTCAGGG - Intergenic
1016300892 6:142630060-142630082 GCTTGCGCATTTTCTTTTCTAGG - Intergenic
1017523065 6:155219133-155219155 TCTAGTTCATTTTCATCTCATGG - Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1023571162 7:41573441-41573463 TCTGGTCCATTTTCATTTCAGGG - Intergenic
1023634800 7:42198743-42198765 GTGTGTGCATATGCATCTCAAGG - Intronic
1024247067 7:47478385-47478407 ACTCATGCATGTTCATCTCAGGG + Intronic
1025599937 7:62984122-62984144 TGATGTGTATTTTCATCTCACGG + Intergenic
1026275566 7:68872754-68872776 GCTTCTGTCATTTCATCTCAGGG - Intergenic
1027475965 7:78631628-78631650 GCTTGTGCAGTTTCTTTACATGG + Intronic
1028514171 7:91658071-91658093 GCTTGTCCTATTTAATCTCAAGG - Intergenic
1028810989 7:95085888-95085910 TCTTGTGTAATTTCATCTAAAGG + Intronic
1029213815 7:98930611-98930633 GTTTGTTCATTTTCCTCTCCAGG + Exonic
1029460187 7:100689771-100689793 GCTGGTGGCTTTTCATGTCATGG - Intergenic
1030656557 7:112174311-112174333 GCTTGAGCTTTTTTCTCTCAAGG + Intronic
1031747915 7:125527679-125527701 GCTTGTGAATCTTCTTTTCATGG - Intergenic
1034020608 7:147637769-147637791 GATTGTGTATTTTCATCCAAAGG + Intronic
1038896119 8:31784334-31784356 GCTTCTGCATTCCCATTTCATGG + Intronic
1041119103 8:54568626-54568648 GCTTGTGCTCTTTTATCTTAAGG + Intergenic
1041876849 8:62698224-62698246 ACTTGAACATTTTCTTCTCATGG - Intronic
1042403380 8:68375469-68375491 GCTTGTGCATGTCCATTTAATGG - Intronic
1042931069 8:74014527-74014549 GCTTGGGCATGTTAAGCTCAAGG + Intronic
1043209890 8:77499127-77499149 TCTTGTTCATGTTCATCCCAGGG + Intergenic
1043754832 8:83990097-83990119 GCTTGTGCAGTTTCAGCTGAGGG + Intergenic
1044460515 8:92439154-92439176 GTTTCTTCATTTTCATCACAGGG + Intergenic
1045291013 8:100832927-100832949 GGTTGAGCACTTTGATCTCAAGG + Intergenic
1047403739 8:124567925-124567947 GCTCTTGGATATTCATCTCATGG + Intronic
1051675989 9:19558697-19558719 TGTTGTGCATATTCTTCTCATGG - Intronic
1053688660 9:40568398-40568420 TCTTGTGCTGCTTCATCTCATGG + Intergenic
1054275373 9:63062659-63062681 TCTTGTGCTGCTTCATCTCATGG - Intergenic
1054299900 9:63369309-63369331 TCTTGTGCTGCTTCATCTCATGG + Intergenic
1054399458 9:64702272-64702294 TCTTGTGCTGCTTCATCTCATGG + Intergenic
1054433039 9:65186537-65186559 TCTTGTGCTGCTTCATCTCATGG + Intergenic
1054497344 9:65835138-65835160 TCTTGTGCTGCTTCATCTCATGG - Intergenic
1055072948 9:72186137-72186159 GCTACTGCTTTTTCATCCCAAGG - Intronic
1055105510 9:72507754-72507776 TACTGTTCATTTTCATCTCAAGG - Intergenic
1055485127 9:76749041-76749063 GGTTGCTCATTTTCTTCTCAGGG - Intronic
1056265338 9:84891191-84891213 GCTTGTGCTTCTTCACGTCATGG + Intronic
1056990625 9:91406734-91406756 TCTTTTGCCTTTTCATTTCAAGG - Intergenic
1058737882 9:107911344-107911366 TCTTGGGAATTGTCATCTCAGGG + Intergenic
1059146679 9:111905857-111905879 GCTTCTGTATTTTTATCTCTAGG + Intronic
1060357776 9:122926192-122926214 GCTGGTACAGTTTTATCTCAAGG + Intronic
1185487388 X:493227-493249 GCATGTGCATTTGCATGTGAGGG - Intergenic
1185525172 X:772794-772816 TCTTGAGCTTTTTCATCTTATGG - Intergenic
1187104530 X:16227464-16227486 GCATGTGCCTTTTTTTCTCAAGG - Intergenic
1187941930 X:24391124-24391146 GCTTGTGAATCCTCATCTGAAGG - Intergenic
1187949770 X:24460408-24460430 GCTAGAGCTTTGTCATCTCAAGG + Intergenic
1188120092 X:26294377-26294399 GATTCTGCATTTTTATCTCCTGG + Intergenic
1190251406 X:48729428-48729450 GCTTGTGAGTATTCATCCCAGGG - Intergenic
1193758638 X:85439280-85439302 TCTTGTGGATGGTCATCTCAGGG + Intergenic
1197146469 X:123177878-123177900 GCTGCTGCATGTTCTTCTCATGG + Intergenic
1197834328 X:130678518-130678540 CCAAGTCCATTTTCATCTCACGG + Intronic
1198683815 X:139206856-139206878 GCATGTGCAGGTTCATCACATGG - Intronic