ID: 1116826357

View in Genome Browser
Species Human (GRCh38)
Location 14:49677054-49677076
Sequence GGCTGAACCCACTCTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116826357_1116826361 -4 Left 1116826357 14:49677054-49677076 CCTGGGGGAGAGTGGGTTCAGCC 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1116826361 14:49677073-49677095 AGCCATGTGGACCTAGTGGAGGG 0: 1
1: 1
2: 2
3: 13
4: 164
1116826357_1116826362 -3 Left 1116826357 14:49677054-49677076 CCTGGGGGAGAGTGGGTTCAGCC 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1116826362 14:49677074-49677096 GCCATGTGGACCTAGTGGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 118
1116826357_1116826360 -5 Left 1116826357 14:49677054-49677076 CCTGGGGGAGAGTGGGTTCAGCC 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1116826360 14:49677072-49677094 CAGCCATGTGGACCTAGTGGAGG 0: 1
1: 0
2: 1
3: 8
4: 163
1116826357_1116826359 -8 Left 1116826357 14:49677054-49677076 CCTGGGGGAGAGTGGGTTCAGCC 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1116826359 14:49677069-49677091 GTTCAGCCATGTGGACCTAGTGG 0: 1
1: 1
2: 0
3: 6
4: 79
1116826357_1116826366 8 Left 1116826357 14:49677054-49677076 CCTGGGGGAGAGTGGGTTCAGCC 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1116826366 14:49677085-49677107 CTAGTGGAGGGGTTACAGGATGG 0: 1
1: 0
2: 1
3: 12
4: 295
1116826357_1116826364 4 Left 1116826357 14:49677054-49677076 CCTGGGGGAGAGTGGGTTCAGCC 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1116826364 14:49677081-49677103 GGACCTAGTGGAGGGGTTACAGG 0: 1
1: 0
2: 1
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116826357 Original CRISPR GGCTGAACCCACTCTCCCCC AGG (reversed) Intronic
900159943 1:1218751-1218773 GGCTGGACCCAGCCTCACCCAGG + Exonic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
900590290 1:3456481-3456503 GCCAGAACCCCCACTCCCCCCGG + Intronic
901261637 1:7875823-7875845 GGATGAACCCACTTTGCCCATGG + Intergenic
901513326 1:9729385-9729407 GGTTGAAATCCCTCTCCCCCAGG - Exonic
901868800 1:12125541-12125563 GGTTGAACCCAGTCCCCTCCCGG - Intronic
902618082 1:17634780-17634802 GGCTGCAGCCACCCTGCCCCAGG - Intronic
904496240 1:30888415-30888437 GGCTGACCCCAGCCTCCTCCAGG + Intronic
906684184 1:47752385-47752407 GGCTGAGCCAACTCTCCCAGCGG - Intergenic
910517221 1:88075299-88075321 TGCTGATTCCACACTCCCCCAGG - Intergenic
911460327 1:98181392-98181414 GGCTGATTCAACTCTCCCCTGGG - Intergenic
911647639 1:100352892-100352914 AGCTGAAGTCACTCGCCCCCGGG - Exonic
912455028 1:109791483-109791505 GGCTCAGCCCTCTCTCCTCCTGG - Intergenic
912568554 1:110606216-110606238 GGATGAACTTACTCTCCCTCCGG + Intronic
913363174 1:118004813-118004835 GGCTGCACCCACTGTCCAACTGG + Intronic
914717781 1:150266328-150266350 GGCTGAACCCAGGCTGCTCCTGG + Intronic
915806968 1:158864441-158864463 GGCTGTACCCACTGTCCAACCGG - Intergenic
916503629 1:165408187-165408209 GGCTGAACACACACATCCCCTGG + Intronic
918085172 1:181238979-181239001 GGCTGAACAGATGCTCCCCCAGG + Intergenic
918205433 1:182304308-182304330 GGGTGTACCCTCACTCCCCCAGG - Intergenic
920005759 1:202832668-202832690 TGCTGGACCCACCTTCCCCCAGG - Intergenic
924127398 1:240869396-240869418 GGCAAAACCCACTCTTTCCCAGG + Intronic
1065701029 10:28425613-28425635 GGCTGTATCCACCCTTCCCCTGG + Intergenic
1065875676 10:29995476-29995498 GGCTTAACTGACTCTCCCTCAGG - Intergenic
1067239733 10:44480428-44480450 GGCTGCACCCACTGTCCAACCGG - Intergenic
1069610957 10:69772254-69772276 GGCTGTGCCCCCTCTTCCCCTGG + Intergenic
1069916318 10:71789338-71789360 GGGTGGACCCACTCCCCTCCGGG - Intronic
1070671986 10:78384330-78384352 AGCTGCACCCTCTCTCCCCAGGG + Intergenic
1071498751 10:86188957-86188979 GGCTGAAGCCCCACTCCGCCAGG + Intronic
1072370230 10:94758427-94758449 GGCTGCACCCACTGTCCAACTGG + Intronic
1073187402 10:101624899-101624921 GGCTTAACCCACAATCCCCTAGG - Intronic
1074430016 10:113386475-113386497 GGCTGAACCCAGTCACCCCAGGG - Intergenic
1076107538 10:127835263-127835285 GCCTGTTCCCACTCTCCCCATGG - Intergenic
1077034558 11:488409-488431 GCCTGCACCCACTGCCCCCCGGG - Intronic
1078445741 11:11403766-11403788 TGCTGTGCCAACTCTCCCCCTGG + Intronic
1084747616 11:71183321-71183343 GGTGAAACTCACTCTCCCCCGGG + Intronic
1085497581 11:76985177-76985199 GGCTGGACCCTCTATCTCCCAGG + Intronic
1085531916 11:77197035-77197057 GGCTGCACTCACAGTCCCCCAGG + Intronic
1090231687 11:125111552-125111574 ACCTGGATCCACTCTCCCCCAGG + Exonic
1091769281 12:3140803-3140825 TCCTGAACCCACTCTTCCCCTGG - Intronic
1091999462 12:5020431-5020453 GGCTGGAGCCACTCTACCCGCGG + Intergenic
1095849730 12:46789141-46789163 GGGAGACCCCATTCTCCCCCTGG + Intronic
1102977682 12:117218287-117218309 GGCTGAAGCCAGTGTCCCCGAGG + Intronic
1102997470 12:117361282-117361304 GGTTGCACCCACTCGCCTCCTGG + Intronic
1103902652 12:124311437-124311459 GGCTGAAACCACACTCGGCCTGG - Intronic
1104596902 12:130126205-130126227 GGCTGCACCCACCCGCCTCCGGG + Intergenic
1104895769 12:132162969-132162991 GGCTGATCCCACTCTCCATGAGG - Intergenic
1110233184 13:73187941-73187963 GGCAGAATCCCTTCTCCCCCAGG - Intergenic
1113819747 13:113204576-113204598 GGCTGCACCCAGTGTCCCACGGG + Intronic
1114408518 14:22478788-22478810 GGCTCCACCCACTCTCCCAGGGG - Intergenic
1115524394 14:34265342-34265364 GGCTTAAGCGACTCTCACCCCGG - Intronic
1115850182 14:37584460-37584482 GGCGGAACCCCCTCCCCACCGGG - Intergenic
1115957113 14:38793900-38793922 TGCTGGACCCACTCACACCCAGG + Intergenic
1116826357 14:49677054-49677076 GGCTGAACCCACTCTCCCCCAGG - Intronic
1121173075 14:91870521-91870543 GGCTTTGCCCACTCTCCACCTGG + Intronic
1122414204 14:101541042-101541064 GGCTGACCCCACCCTGCTCCTGG + Intergenic
1122669615 14:103360343-103360365 GCCTGCACCCACTGTCTCCCAGG + Intergenic
1123217396 14:106823947-106823969 GGCTGTACCAAGTCTCCCCCAGG + Intergenic
1126706804 15:51413826-51413848 GCCTGGACCACCTCTCCCCCAGG + Intergenic
1128564999 15:68695274-68695296 GCCTGAGCCCACCCTCCTCCGGG - Intronic
1129168543 15:73793755-73793777 GGCTGAATCCTGTCTCTCCCTGG + Intergenic
1129687329 15:77694351-77694373 GGCTGATCCCACTCCCTCTCTGG - Intronic
1130317997 15:82812738-82812760 GGCTGGAACCACTGTCTCCCAGG + Intronic
1132515037 16:362293-362315 GGCTGCACCCGCTCTCCCCTGGG + Intergenic
1133141757 16:3750099-3750121 GGCTGAACTCAAACTCACCCCGG + Intronic
1137672671 16:50288344-50288366 GGCTGCCCTCACTCACCCCCTGG - Exonic
1138733994 16:59229786-59229808 GGCTGCACCCACTGTCCGACAGG - Intergenic
1139110658 16:63886648-63886670 GGCTGAGCCCACCCTTCCTCAGG + Intergenic
1141845355 16:86604649-86604671 GGGTGACCCCACTCTTCCCCAGG + Intergenic
1142155878 16:88532726-88532748 GGCGGGACCCACACACCCCCCGG - Intronic
1147119608 17:38328259-38328281 CCCTGGACCCACACTCCCCCAGG + Exonic
1148216365 17:45835929-45835951 ACCTGACCCCACTCTCACCCCGG + Intergenic
1150247736 17:63688935-63688957 GGACGAACCCACCCTCCCCATGG - Intronic
1151555778 17:74846054-74846076 GGCAGTACCCACCGTCCCCCAGG + Exonic
1151821213 17:76497932-76497954 GGCTGAAACCACTTTCCTGCAGG + Intronic
1152251850 17:79216541-79216563 GGCTGAGCCCAGTCTCCTGCAGG + Intronic
1152420394 17:80189731-80189753 GGCTGACCTCTCTCTGCCCCAGG + Exonic
1153544767 18:6194292-6194314 GAATGAGCCCACTCTCCCACAGG + Intronic
1157195780 18:45619227-45619249 AGCTGAGCCCAGTCTCCCCAGGG + Intronic
1157306641 18:46522163-46522185 GGCTGAAGCCCCTCTTCCCTCGG + Exonic
1160851564 19:1195321-1195343 CGCTGACCCCACGTTCCCCCCGG - Intronic
1160851988 19:1197135-1197157 CGCTGACCCCACGTTCCCCCCGG - Intronic
1161325597 19:3662186-3662208 GGATGAAGCCACCCTCCCTCGGG + Intronic
1162534020 19:11252771-11252793 GGCTGAACCCACTCATCCTTGGG + Exonic
1163669755 19:18620607-18620629 GGCTGGACCCACCCTGCCCTTGG - Exonic
1163686685 19:18715828-18715850 GGCTGAACCCACCCTGCTCAGGG + Intronic
1164156976 19:22602956-22602978 AGCTGAACACCCTCTCCTCCAGG + Intergenic
1166117412 19:40664143-40664165 AGCAGCACCCACTCTCCCCTTGG - Intergenic
1166683233 19:44780952-44780974 AGCTGCACGCACTCTTCCCCGGG + Exonic
1166751126 19:45164443-45164465 GGCAGGACCCACACTCCCCAGGG - Intronic
1167440827 19:49507820-49507842 GACTACACCCTCTCTCCCCCTGG - Intronic
1167966748 19:53154017-53154039 TTCAGAACCCACTCTCCTCCTGG + Intronic
1168260016 19:55188037-55188059 GGCTGAGCTCAGTCTCCCTCCGG - Intronic
926171841 2:10557672-10557694 GGCCGAACCCAGTCGCCGCCTGG - Intergenic
928911890 2:36430222-36430244 GGCTGAACCCCATCTTGCCCTGG + Intronic
932480095 2:72033845-72033867 GGCTGAACCCAGGCTCTCCTCGG + Intergenic
936151423 2:110024212-110024234 GGCTGCCCCCACTCTGCCCCGGG - Intergenic
936193252 2:110347157-110347179 GGCTGCCCCCACTCTGCCCCGGG + Intergenic
937460534 2:122081813-122081835 GCCTGAACCCACTGTCCCCCTGG - Intergenic
937754045 2:125515091-125515113 GGGTGCGCCCACTCACCCCCTGG + Intergenic
943359677 2:186902140-186902162 GGCTGCACCCACTGTCCAACTGG + Intergenic
1168753308 20:298498-298520 GCCTGACCCCGCCCTCCCCCTGG - Exonic
1168788910 20:562922-562944 AGCTGAGCCCACTGTTCCCCGGG - Intergenic
1173852885 20:46229908-46229930 GGCTGAGCTCTCTCTCTCCCTGG + Intronic
1174128315 20:48325009-48325031 GGCTGAGCCAGCTCTACCCCAGG - Intergenic
1174173309 20:48630091-48630113 GGCTGTGCCCACCCTCCTCCCGG + Intronic
1175527888 20:59648139-59648161 GCCTGAAGCCAAACTCCCCCTGG - Intronic
1175980313 20:62735409-62735431 GGAGGCACCCACTCTCTCCCCGG - Intronic
1178254836 21:31043040-31043062 GGCTGAAGACACACTCCCCTTGG - Intergenic
1179146170 21:38769736-38769758 GGCTGAATCCAGCCTGCCCCTGG + Intergenic
1179187654 21:39097105-39097127 GGCTGCACCCACCTTCCCCGTGG + Intergenic
1179469647 21:41602087-41602109 GGCTGGCCCCACACTGCCCCAGG + Intergenic
1180074167 21:45454363-45454385 GGTTGCAGCCACCCTCCCCCAGG - Intronic
1182093828 22:27613298-27613320 GGCTGCACCCCCTCTGCCCCAGG - Intergenic
1182267144 22:29125933-29125955 TTCTGAACACACTCTGCCCCTGG - Intronic
1183855943 22:40635223-40635245 GGCTGTACCACCTCACCCCCGGG + Intronic
1183903402 22:41022376-41022398 ATCTGGACCCACTCGCCCCCCGG - Intergenic
1184361643 22:44022642-44022664 AGCTGAACCCACTTCTCCCCAGG + Intronic
1184422693 22:44391149-44391171 GGCTGGACGCCCTCTCTCCCTGG + Intergenic
1184503024 22:44885390-44885412 GGCTGAGGCCAGCCTCCCCCAGG + Intronic
1185241462 22:49749676-49749698 GGCTGACCCCTGCCTCCCCCGGG - Intergenic
949391971 3:3572403-3572425 GTCTGGACCCCCTCTCCCACAGG - Intergenic
952241400 3:31533588-31533610 GGCTGCACCCACACTCCCGGCGG - Intronic
953385628 3:42504273-42504295 CTCTGAATCCACTCTGCCCCTGG - Intronic
953407413 3:42666311-42666333 GGGCGAACCTTCTCTCCCCCAGG - Intergenic
953667978 3:44939817-44939839 GGCTGTACTCACTCTCCCTGCGG - Intronic
953787873 3:45924210-45924232 TGCTGGGCCCACTCTCCTCCAGG + Intronic
961535541 3:127568416-127568438 GACTGGACCCACACTCCCCAGGG - Intergenic
962624419 3:137211147-137211169 GGCTGCACCCACTGTCCAACTGG - Intergenic
962731161 3:138284863-138284885 GGATGAACCCTCTAGCCCCCTGG + Intronic
963922475 3:150919076-150919098 CCCTGACCCCACTCTACCCCAGG + Intronic
964294433 3:155217761-155217783 GGCTGGTCCCGCTCTCACCCTGG + Intergenic
968540724 4:1167050-1167072 TGCTGAGCCCACTCTCCCGAGGG - Exonic
969052729 4:4384944-4384966 GGCAGAGGCCACTCTCCCACAGG + Intronic
976373375 4:84315951-84315973 GGATGAACACACTCTGCCTCAGG + Intergenic
977288701 4:95139928-95139950 GGCTGCACCCACTGTCCGACAGG + Intronic
984503762 4:180591136-180591158 GGCTGAACCCTCGCACCACCTGG - Intergenic
995489885 5:112679498-112679520 GGCTGCACCCACTGTCCAACTGG + Intergenic
1000245970 5:159448844-159448866 GGCTGGCCCCACTCTCACCTGGG - Intergenic
1000562844 5:162812068-162812090 AGATGAAACCACTCTCTCCCTGG + Intergenic
1001329567 5:170752660-170752682 GCCTGGACCCTCTCTCCACCTGG + Intergenic
1001415902 5:171544769-171544791 GGCTGACCCCCCTCTTCCCATGG + Intergenic
1002291507 5:178204023-178204045 GACTGAACCCGCCATCCCCCTGG - Intergenic
1003496513 6:6668272-6668294 GGCTGCACCCACTGTCCAACCGG - Intergenic
1004013450 6:11711065-11711087 GCCTGAACACCCTCTTCCCCAGG - Intergenic
1004691963 6:17999863-17999885 GGCTGAATCCACTCTCTGCCTGG - Intergenic
1006725465 6:36196712-36196734 GGCTGATCCCTCCCTCCCCTCGG + Intergenic
1007429217 6:41767084-41767106 GGGTGAACCTGCTCTCCCCTGGG - Intergenic
1007429843 6:41770532-41770554 CTCTGAACCCACCCTCCCCAGGG - Exonic
1010123364 6:72405502-72405524 TCCTGAAGCCATTCTCCCCCTGG + Intergenic
1010171870 6:72984710-72984732 GGCTGCACCCACTGTCCAACTGG + Intronic
1010521204 6:76839705-76839727 GGCAGAATCCAGTCTCCCCTGGG - Intergenic
1013911652 6:115282672-115282694 GGATGAAGCCACCCTCCCTCTGG + Intergenic
1015480203 6:133700379-133700401 GTCTGAGGCCACTCTCTCCCTGG + Intergenic
1017002548 6:150006105-150006127 AGCTGAGCCCACTCTACCCCCGG + Intergenic
1018036482 6:159886949-159886971 GGCAGACCCCGATCTCCCCCCGG + Intergenic
1019054649 6:169214255-169214277 GGCTCAACCAACTCGCCCTCAGG - Intergenic
1019383180 7:738972-738994 GCCTGAGCACACTCTGCCCCAGG - Intronic
1019455932 7:1127707-1127729 GGCTGATCCCACCGTCACCCGGG + Intronic
1019455948 7:1127799-1127821 GGCTGATCCCACCGTCACCCGGG + Intronic
1019726774 7:2607159-2607181 GGCTGAAGCCGATCTCCTCCTGG - Exonic
1020091722 7:5345682-5345704 GGCCCAGCCCACTCTCCTCCAGG + Exonic
1021755176 7:23844668-23844690 GGCTGCACCCACTGTCCAACTGG - Intergenic
1021775142 7:24046814-24046836 GGCAGAATTCACTCTCCCTCAGG - Intergenic
1022674006 7:32481392-32481414 AGCAGAACCCACACTCCCTCAGG + Intergenic
1023075956 7:36483014-36483036 GGGTGACCCCACCCACCCCCTGG - Intergenic
1024050393 7:45617488-45617510 GGCTGACCCCACTTTCCCCTTGG + Intronic
1029681172 7:102111817-102111839 GGCTGACCCAACTCTCCCCCTGG - Intronic
1031365922 7:120900865-120900887 GGCTGCACCCACTGTCCAACCGG - Intergenic
1032764308 7:134976110-134976132 GGCTGCACCCACTGTCCAACAGG - Intergenic
1033582573 7:142750757-142750779 GGCTGAAGCCAAGCTCTCCCAGG - Intronic
1033584130 7:142761677-142761699 GGCTGAAGCCAAGCTCTCCCAGG - Intronic
1033585597 7:142772251-142772273 GGCTGAATCCAAGCTCTCCCAGG - Intergenic
1040610706 8:48978563-48978585 GGCCGGACTCACTCTCCGCCTGG + Intergenic
1041882441 8:62767167-62767189 AGCTGACCCCACTATCCTCCAGG + Intronic
1046900740 8:119521118-119521140 GGCTGCACCCACTGTCCGACAGG - Intergenic
1047954473 8:129962932-129962954 AGCTGCACCCAATCTCCCTCAGG + Intronic
1049748086 8:144271402-144271424 GGCTGACCCCACGCTCCCGGGGG - Intronic
1049839753 8:144763384-144763406 GGCTTAAGCCACTCTCTACCTGG - Intergenic
1052882674 9:33613789-33613811 GGCTGAAGCCAAGCTCTCCCAGG + Intergenic
1052901313 9:33796845-33796867 GGCTGAAGCCAAGCTCTCCCAGG - Intronic
1053670778 9:40359166-40359188 GGCTGAGCCCCCTCTCCCAGGGG - Intergenic
1054381898 9:64499228-64499250 GGCTGAGCCCCCTCTCCCAGGGG - Intergenic
1054513836 9:66017135-66017157 GGCTGAGCCCCCTCTCCCAGGGG + Intergenic
1058074672 9:100638293-100638315 GGCTGCACCCACTGTCCAACTGG + Intergenic
1060053924 9:120397098-120397120 TGCTGAAGCCACTCCCTCCCAGG + Intronic
1060803028 9:126556776-126556798 GCCTGGAGCCCCTCTCCCCCTGG + Intergenic
1061952362 9:133943616-133943638 GGCTGAGTGCCCTCTCCCCCAGG + Intronic
1062326841 9:136016585-136016607 GGCTGAAGCCAGTCTGACCCAGG - Intronic
1186477749 X:9871455-9871477 GTCGAAACCCAGTCTCCCCCAGG + Intronic
1190263769 X:48815690-48815712 GTCTGAAGACAGTCTCCCCCAGG - Intronic
1191012483 X:55774914-55774936 GGCTGCACCCACTGTCCTACCGG + Intergenic
1192247115 X:69382677-69382699 GCTTGAGCCCACTCTACCCCTGG + Intergenic
1201913561 Y:19158170-19158192 GGCTGCACCCACTGTCCAACTGG - Intergenic