ID: 1116834486

View in Genome Browser
Species Human (GRCh38)
Location 14:49757183-49757205
Sequence GTTGTTGTTGAGACGCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116834485_1116834486 25 Left 1116834485 14:49757135-49757157 CCATTGATGTGCTCATGTGATTG No data
Right 1116834486 14:49757183-49757205 GTTGTTGTTGAGACGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116834486 Original CRISPR GTTGTTGTTGAGACGCAGTC TGG Intergenic