ID: 1116835173

View in Genome Browser
Species Human (GRCh38)
Location 14:49763316-49763338
Sequence AGGTGGAACAGAATGGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116835162_1116835173 22 Left 1116835162 14:49763271-49763293 CCTGGACTATCAACTTCACCCCA No data
Right 1116835173 14:49763316-49763338 AGGTGGAACAGAATGGCTAGAGG No data
1116835164_1116835173 3 Left 1116835164 14:49763290-49763312 CCCAGTTCTCAGTTTTTCCCCCA No data
Right 1116835173 14:49763316-49763338 AGGTGGAACAGAATGGCTAGAGG No data
1116835160_1116835173 24 Left 1116835160 14:49763269-49763291 CCCCTGGACTATCAACTTCACCC No data
Right 1116835173 14:49763316-49763338 AGGTGGAACAGAATGGCTAGAGG No data
1116835163_1116835173 4 Left 1116835163 14:49763289-49763311 CCCCAGTTCTCAGTTTTTCCCCC No data
Right 1116835173 14:49763316-49763338 AGGTGGAACAGAATGGCTAGAGG No data
1116835161_1116835173 23 Left 1116835161 14:49763270-49763292 CCCTGGACTATCAACTTCACCCC No data
Right 1116835173 14:49763316-49763338 AGGTGGAACAGAATGGCTAGAGG No data
1116835165_1116835173 2 Left 1116835165 14:49763291-49763313 CCAGTTCTCAGTTTTTCCCCCAC No data
Right 1116835173 14:49763316-49763338 AGGTGGAACAGAATGGCTAGAGG No data
1116835159_1116835173 30 Left 1116835159 14:49763263-49763285 CCTGTGCCCCTGGACTATCAACT No data
Right 1116835173 14:49763316-49763338 AGGTGGAACAGAATGGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116835173 Original CRISPR AGGTGGAACAGAATGGCTAG AGG Intergenic
No off target data available for this crispr