ID: 1116835801

View in Genome Browser
Species Human (GRCh38)
Location 14:49768218-49768240
Sequence GAGCCGGGCGGCGGCGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1701
Summary {0: 1, 1: 0, 2: 28, 3: 300, 4: 1372}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116835801_1116835815 15 Left 1116835801 14:49768218-49768240 CCCGCGCCGCCGCCGCCCGGCTC 0: 1
1: 0
2: 28
3: 300
4: 1372
Right 1116835815 14:49768256-49768278 TGTCTGCAGGCGTGCCCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 123
1116835801_1116835816 18 Left 1116835801 14:49768218-49768240 CCCGCGCCGCCGCCGCCCGGCTC 0: 1
1: 0
2: 28
3: 300
4: 1372
Right 1116835816 14:49768259-49768281 CTGCAGGCGTGCCCCGGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 118
1116835801_1116835814 12 Left 1116835801 14:49768218-49768240 CCCGCGCCGCCGCCGCCCGGCTC 0: 1
1: 0
2: 28
3: 300
4: 1372
Right 1116835814 14:49768253-49768275 CTCTGTCTGCAGGCGTGCCCCGG 0: 1
1: 0
2: 1
3: 10
4: 189
1116835801_1116835817 21 Left 1116835801 14:49768218-49768240 CCCGCGCCGCCGCCGCCCGGCTC 0: 1
1: 0
2: 28
3: 300
4: 1372
Right 1116835817 14:49768262-49768284 CAGGCGTGCCCCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 24
4: 250
1116835801_1116835810 2 Left 1116835801 14:49768218-49768240 CCCGCGCCGCCGCCGCCCGGCTC 0: 1
1: 0
2: 28
3: 300
4: 1372
Right 1116835810 14:49768243-49768265 CTCGCGGCCCCTCTGTCTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116835801 Original CRISPR GAGCCGGGCGGCGGCGGCGC GGG (reversed) Exonic