ID: 1116836299

View in Genome Browser
Species Human (GRCh38)
Location 14:49771625-49771647
Sequence ATCTGCCTAGAGAAGAACTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116836299 Original CRISPR ATCTGCCTAGAGAAGAACTA TGG Exonic
904712843 1:32443957-32443979 ATCTGCTTGGAGATGAACAAGGG + Intergenic
908801201 1:67882389-67882411 ATCAGCCTAGAGAGGAAGTAGGG - Intergenic
911357391 1:96839049-96839071 ATTGGCCTTGAGAAGAAGTAGGG + Intergenic
911818692 1:102387975-102387997 ATCTGCCTGGAGATGAGATAAGG + Intergenic
913120601 1:115737165-115737187 AATTGCCTAAAGAAGAACTGGGG + Intronic
916378858 1:164186819-164186841 CTATGCAGAGAGAAGAACTAGGG - Intergenic
919899025 1:202030072-202030094 ATCTGCCTACAGAATATCTCAGG - Intergenic
920452270 1:206068492-206068514 ATCAGCATAGAGCAGAAATAAGG + Intronic
921107951 1:212001869-212001891 ATATGGCTAGAGAAGATTTAGGG - Intronic
921522221 1:216169909-216169931 ATCTGTCTTGAAAAGAACTGGGG + Intronic
921676837 1:217985757-217985779 ATATGCCTTGACAAGCACTAAGG + Intergenic
1066713356 10:38260650-38260672 ATCTGCCTGGAGACTAAATAAGG - Intergenic
1070438253 10:76414825-76414847 ACCAGCCTAGATAAGAACCAGGG + Intronic
1071736139 10:88303194-88303216 AGCTGCTTAGAGAAGAGGTAGGG + Intronic
1076034927 10:127191621-127191643 TCCTTCCTAGAGAAGAACAAGGG + Intronic
1078016491 11:7619397-7619419 ATGTGGCTAGAGCATAACTAGGG + Intronic
1081260253 11:40950781-40950803 ATGTGTCTAGAGAAAAACTCTGG - Intronic
1085075240 11:73585216-73585238 ATCTTTCTAGAGTAGAAGTATGG - Intronic
1085097999 11:73776194-73776216 ATTTGCCTAGAGACCAACTGGGG - Intergenic
1085532697 11:77201371-77201393 ATCTTCCCACAGAAGAACTGAGG - Intronic
1085955688 11:81391317-81391339 TTCTGCCTAGAGAAAAAATCTGG - Intergenic
1090248429 11:125234464-125234486 ATGTGCATAGAGAAGAATGATGG - Intronic
1092218709 12:6699276-6699298 ATCTTCCCAGAGAACAACAAGGG + Intronic
1094553706 12:31476843-31476865 TTCTGCCTAGAGAAGCAATTTGG - Intronic
1096052226 12:48620499-48620521 ATCTGCCTGCAGATTAACTATGG - Intergenic
1099205904 12:79726278-79726300 ATCTTCCCAGAGCAAAACTAAGG + Intergenic
1099907253 12:88786146-88786168 ATCTACCTAAAGAAGAACATTGG + Intergenic
1100595804 12:96071030-96071052 ATCTGCCAAGAGAGGAACAAAGG - Intergenic
1103102250 12:118188281-118188303 ATCTGACAAAAGAAGAAATACGG - Intronic
1106175715 13:27329508-27329530 ATCTTCAGAGGGAAGAACTAAGG - Intergenic
1107104685 13:36630535-36630557 ATCAGCCCAAAGAAGAACTGGGG + Intergenic
1107207055 13:37804429-37804451 ATCTGAAATGAGAAGAACTATGG + Intronic
1110329101 13:74250950-74250972 GGCTCCCTTGAGAAGAACTAGGG - Intergenic
1111417658 13:87970055-87970077 ATAAGCCTAGGGAAAAACTAAGG + Intergenic
1111649217 13:91068210-91068232 ATCTCCCTAGAGGAGATCTAGGG - Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1114924381 14:27376620-27376642 AACTGCCTAGATAAGCAGTAAGG + Intergenic
1115052413 14:29079309-29079331 ATCTGCCAAGAGAAAAGATAGGG - Intergenic
1115109548 14:29805001-29805023 ATTTCCCTAGAGCAGAATTATGG + Intronic
1116594917 14:46828872-46828894 GTCTGCCTAGTGAAGTCCTAGGG - Intergenic
1116836299 14:49771625-49771647 ATCTGCCTAGAGAAGAACTATGG + Exonic
1118357989 14:65031243-65031265 ATGTGCCCCGAGAAGAATTAGGG + Intronic
1119571557 14:75678430-75678452 ATCTGCATAGATTAGATCTATGG - Intronic
1119583974 14:75814555-75814577 TCCTGCCTAGAGAAGACCTAAGG - Intronic
1121821650 14:96973030-96973052 ATCTGACTAGAGATGAATTGGGG + Intergenic
1124865381 15:33485631-33485653 AGCTGCCTAGAGAAGAATAATGG + Intronic
1127465463 15:59240267-59240289 AGCTGGCTATACAAGAACTAGGG - Intronic
1131586509 15:93701304-93701326 ATATGTATAAAGAAGAACTATGG + Intergenic
1140515446 16:75537937-75537959 ATCTACCTGGGGAAGAACTAGGG + Exonic
1141748704 16:85943898-85943920 TTCTGCCTAAAGAAGAGCCATGG - Intergenic
1143709570 17:8725085-8725107 ATCTCCCAAGAGAAGAAGTTTGG + Intergenic
1146293220 17:31627891-31627913 ATATGCCTAGGGATGAACTTGGG - Intergenic
1149353462 17:55815402-55815424 ATCTGCCTAAAGAATTTCTATGG + Intronic
1150891221 17:69152476-69152498 ATCTGCCTAAAGATAAAGTAAGG + Exonic
1151554629 17:74840456-74840478 ATATGCCTAGAGAAGGAACAAGG + Intergenic
1157128607 18:44981699-44981721 ATCGGCATAGAGAAGAATAAGGG + Intronic
1158257091 18:55563531-55563553 GTTTGCTTAGAGAAGAAATAAGG + Intronic
1159175285 18:64825874-64825896 ATATGCCTAGAGAAGAATAGGGG + Intergenic
1159239815 18:65727888-65727910 ATGTGCCTGGAGAGGAACCATGG + Intergenic
1162210560 19:9088244-9088266 TTCTGCCTACAGAAGTACTGAGG - Intergenic
1167935382 19:52902112-52902134 ATCTGCTCAGAGATGAACAAGGG + Intergenic
926130704 2:10302133-10302155 ACCTGCCTCGAGAGGAACCAGGG - Intergenic
931718126 2:65045658-65045680 ATCTGCTTGGAGATGAACAAGGG + Intergenic
932296238 2:70625647-70625669 ATCTGATTAGAGAATACCTAAGG - Intronic
932933893 2:76078652-76078674 ATTGTCCTAGAGGAGAACTAAGG + Intergenic
933934884 2:87194847-87194869 ATTAGCCTAGAGCAGAACTAAGG + Intergenic
936358258 2:111771051-111771073 ATTAGCCTAGAGCAGAACTAAGG - Intronic
937134153 2:119537900-119537922 ATTTGCCTAAAGAAGAATGAGGG + Intergenic
939227936 2:139387159-139387181 CTCTGCCTAGTGAAGCACGATGG + Intergenic
941028231 2:160482601-160482623 ATTTGCTAATAGAAGAACTATGG + Intronic
942239046 2:173942065-173942087 ATATACATAGAGAAGAACTTGGG - Intronic
942411440 2:175713268-175713290 ATCTGGCAAGAAAAGAAATAAGG + Intergenic
948454715 2:238099645-238099667 ACTTCCCTAAAGAAGAACTATGG + Intergenic
948731996 2:239971064-239971086 AACTGCCTAGAGCAGTAGTAGGG - Intronic
1169931735 20:10840322-10840344 ATCTACCAAGACAGGAACTATGG - Intergenic
1172885539 20:38228401-38228423 CTCTGCCTGGAGAAGAACCACGG - Intronic
1173452672 20:43178986-43179008 TACTGCCTAGACAAGAACAATGG + Intronic
1173529082 20:43754728-43754750 ATGAGCCCAGAGAAGAACCAGGG - Intergenic
1173605535 20:44328340-44328362 ACCTTCCTGTAGAAGAACTACGG - Intergenic
1180390733 22:12279949-12279971 AGCTGCCTCGAGAAGAACAGAGG + Intergenic
1180409009 22:12584808-12584830 AGCTGCCTTGAGAAGAACAGAGG - Intergenic
1184377497 22:44123980-44124002 AAATGCCAAGAGCAGAACTAAGG + Intronic
1184582836 22:45428975-45428997 ATCTGCCATGAGACGAACCAGGG + Intronic
950601602 3:14040307-14040329 ATCTGCTTAGGGATGAACAAGGG + Intronic
952090354 3:29877838-29877860 ATATGCCTAGAGCAAAACTGAGG - Intronic
954115560 3:48465230-48465252 ATATGCTTGGAGAAGAACTGAGG - Intronic
954509051 3:51105997-51106019 AGCTGCTTAGAGAAGTAGTAGGG + Intronic
954906296 3:54066112-54066134 ATCTCCCTTGGGAAGAGCTATGG - Intergenic
955953577 3:64266246-64266268 ATCTGCCTTCAGAAGAAGAACGG + Intronic
956415442 3:69022868-69022890 ATATGGCTAGAGAAGAAGAATGG - Exonic
956466122 3:69522329-69522351 TTCTGGATAGAGAAGATCTAGGG - Intronic
957337370 3:78848825-78848847 AGCTGCCTTGAGAAGAAAGAGGG + Intronic
957678812 3:83404749-83404771 ATCTACAGAGAGAAGCACTATGG + Intergenic
958635195 3:96735290-96735312 AACTGCCTTGAAAAGAACTTCGG + Intergenic
958743159 3:98099258-98099280 ATCTGCCTAGAGTTGGACAAAGG + Intergenic
959433547 3:106284784-106284806 ATCTGCTTAGAGAAGTGGTAGGG + Intergenic
959803086 3:110518857-110518879 ATCTACCTATACAAGAACCATGG - Intergenic
963884822 3:150570200-150570222 ATTTGACTAGAGAAGAATAATGG + Intronic
964336218 3:155657435-155657457 AGCTGCCTAGAGAAGAGCTCCGG + Intronic
970632127 4:17959233-17959255 AGCAGACTAGAGAGGAACTATGG - Intronic
972217124 4:36909842-36909864 ATCTGCTCAGAGATGAACAAGGG - Intergenic
972836526 4:42877281-42877303 AGCTGCCTAGAGATGACTTATGG + Intergenic
973948112 4:55981325-55981347 ATCTGACTTAAGAAGAATTATGG + Exonic
974107517 4:57486967-57486989 ATCTGCCTTGAAAAGAAGTTTGG - Intergenic
974603846 4:64123081-64123103 ATCTGCTTAGAGAAGTGGTAGGG - Intergenic
975648264 4:76566747-76566769 ATCTGACTTGAGATGAACTGTGG + Intronic
976116529 4:81734005-81734027 ATCTGCCAAGATATAAACTATGG - Intronic
977106916 4:92897775-92897797 ATCTGCTTACAAAAGAATTAGGG - Intronic
980438676 4:132813963-132813985 ATCTGCCTGGGGATGAACAATGG + Intergenic
982346117 4:154362077-154362099 ACCTGCCTATATAAGAACTTAGG + Intronic
983426593 4:167591772-167591794 ATATACCTAGAGAAGAATTGCGG - Intergenic
983737360 4:171078674-171078696 ATCTGCCATGAGAAAAACTCAGG + Intergenic
984589217 4:181598260-181598282 AGCTGCTTAGAGAAATACTATGG - Intergenic
985873679 5:2578791-2578813 ATTTGCCTACAGGAAAACTAAGG + Intergenic
986034379 5:3924171-3924193 ATCTGCATAGAGATGAACCTGGG + Intergenic
986034390 5:3924241-3924263 ATCTGCATAGAGATGAACCTGGG + Intergenic
986034409 5:3924381-3924403 ATCTGCATAGAGATGAACCCGGG + Intergenic
986034455 5:3924661-3924683 ATCTGCCTAGAGATAAACCTGGG + Intergenic
986051426 5:4094085-4094107 TTCTGCCTACAGAAGAAATGCGG - Intergenic
987049641 5:14138741-14138763 ATGTGCCTAGGAAAGAACCAGGG - Intergenic
987702575 5:21420350-21420372 ATTTGCCTAGTTAAGAACAATGG + Intergenic
988200787 5:28066298-28066320 AGCTGCTTAGAGAAGTGCTAGGG + Intergenic
989299509 5:39873263-39873285 TACTGCCTAGATAAGAACCATGG + Intergenic
991006385 5:61832334-61832356 TCCTCCCTGGAGAAGAACTAGGG - Intergenic
991129022 5:63100019-63100041 ATCTACCTTGAGAAAAACTGCGG - Intergenic
991776645 5:70091697-70091719 GTCTGCCTAGAGGAGCACAATGG - Intergenic
991855932 5:70967144-70967166 GTCTGCCTAGAGGAGCACAATGG - Intergenic
991869947 5:71099917-71099939 GTCTGCCTAGAGGAGCACAATGG - Intergenic
993569530 5:89519945-89519967 ATCTACATAGAGGAGAACCAAGG + Intergenic
995058425 5:107787970-107787992 ATCTTCCTAGAGAATACCTAAGG + Intergenic
997716565 5:136047253-136047275 ATCTGCCCAGAGAAGCAGCAAGG - Exonic
999948227 5:156620570-156620592 AACTTCCTAGAGGAGAAATAGGG + Intronic
1002839810 6:896118-896140 ATCTGTTTAGAGAGGAAGTAAGG - Intergenic
1003134182 6:3420533-3420555 ATCTCCAAAGAGAAAAACTAAGG + Intronic
1005184449 6:23149367-23149389 ATATGGGTAGAGAAAAACTATGG - Intergenic
1007260400 6:40559387-40559409 TTCTGCCTAGAGTGGATCTAAGG + Intronic
1010049273 6:71483943-71483965 ATATGTCAAGAGAAGAACTTTGG - Intergenic
1010480314 6:76344177-76344199 ATATACCTATAGAAAAACTATGG + Intergenic
1013572733 6:111445975-111445997 ATAAGCCTAGAAAAGAACAATGG + Intronic
1018714386 6:166520766-166520788 ATCTTCTTAGGGAATAACTAAGG + Intronic
1021361143 7:19713689-19713711 CTCTGCCTAGAAAAGTGCTAAGG + Intergenic
1021902490 7:25300230-25300252 ATTTGCCTAAAGAATAGCTATGG - Intergenic
1023284912 7:38608857-38608879 ATATTCCTACAGAAGAATTAGGG + Intronic
1024457210 7:49622363-49622385 ATTTGCCTAGAGGAGTCCTATGG + Intergenic
1027505779 7:79016115-79016137 AGCTGCTTAGAGAAGTAGTATGG + Intronic
1031760421 7:125706839-125706861 ATCTGACTGGAGCAGACCTATGG + Intergenic
1032694918 7:134326931-134326953 AGCAGCCTAGAGAAGAAATCTGG - Intergenic
1033790393 7:144786184-144786206 ATTTGCCAAAGGAAGAACTAAGG + Intronic
1033832437 7:145270172-145270194 GGCTGTCTAGAGAAGAACAACGG - Intergenic
1035860566 8:3023588-3023610 ATGTCCCTAGAGAAAAACTCAGG - Intronic
1040137792 8:43875523-43875545 ATATCCCTAGATAAAAACTAGGG - Intergenic
1041577925 8:59421212-59421234 ATCTGCCTAGAGAAGTGGTAGGG - Intergenic
1045595497 8:103650413-103650435 ATCTGCCTAAAGAAGCAATCAGG + Intronic
1046615455 8:116472446-116472468 ATTTGCTGAGAGAAGAACTGAGG - Intergenic
1046779160 8:118196598-118196620 ATGTGCCTAGAGAAGGAAAAGGG - Intronic
1048119569 8:131564075-131564097 AGCTGCTTAGAGAAGGGCTAGGG - Intergenic
1049128022 8:140810195-140810217 AGCTGCTTAGAGAAGTGCTAGGG + Intronic
1050143410 9:2540015-2540037 ATATTCCTAGAGAAAAACTGGGG + Intergenic
1053422411 9:37987883-37987905 AGCTGCCTAGAGTAGAGCCAGGG + Intronic
1058622595 9:106899158-106899180 ATTTCCCTAGAGAAGAAGTTAGG + Intronic
1060105537 9:120870484-120870506 ATCTGCCTAGGGAAGACATCAGG - Exonic
1060340190 9:122768280-122768302 ATCTGCTTAAAGAAGCACTCTGG - Intergenic
1062244535 9:135558195-135558217 ATCTCCCCAGAGAAGATCTATGG - Intergenic
1062398099 9:136360630-136360652 ACGTTCCTAGAGAAGACCTATGG - Intronic
1188492992 X:30755789-30755811 ATCTGCTTAGAGAAGTAGTAGGG + Intergenic
1189578316 X:42379374-42379396 ATGTGGCTTGAGCAGAACTAGGG - Intergenic
1191094630 X:56661387-56661409 ATCTGCCTGGTGAAGAGTTATGG + Intergenic
1191677497 X:63807119-63807141 ATTTGCCTAGAGAATTTCTATGG - Intergenic
1191886901 X:65898097-65898119 ATCTGCAAGCAGAAGAACTAGGG - Intergenic
1194323625 X:92481784-92481806 AGCTGCTTAGAGAAGTAGTAAGG - Intronic
1195567950 X:106363862-106363884 AGCTGCTTAGAGAAGTAGTAGGG - Intergenic
1195669974 X:107461425-107461447 AACTGCCAAGAGATGAACTGTGG - Intergenic
1196582308 X:117392486-117392508 ATCTGCCTAGTGAGGAGATATGG - Intergenic
1196582338 X:117392648-117392670 ATCTGCCTAGTGAGGAGATATGG - Intergenic
1197378793 X:125713514-125713536 ATCTGCTTAGAGAAGTAGTGGGG + Intergenic
1197559628 X:128001743-128001765 ATCTGGCTAGAGAAGAACTCTGG - Intergenic
1198296329 X:135291339-135291361 AGTTGCCTAGAGAATAACTGGGG + Intronic
1199270172 X:145873410-145873432 AGCTGCTTAGAGAAGAGGTAGGG - Intergenic
1199827818 X:151516842-151516864 ATCTGCCAGCAAAAGAACTATGG + Intergenic
1200631727 Y:5594946-5594968 AGCTGCTTAGAGAAGTAGTAAGG - Intronic
1200844158 Y:7814324-7814346 CCCTGCCTAGAGAAGACATAGGG - Intergenic