ID: 1116838780

View in Genome Browser
Species Human (GRCh38)
Location 14:49797908-49797930
Sequence GTGAAAACCCACAAAGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 1, 2: 45, 3: 108, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116838780_1116838785 22 Left 1116838780 14:49797908-49797930 CCCATGTCTTTGTGGGTTTTCAC 0: 1
1: 1
2: 45
3: 108
4: 380
Right 1116838785 14:49797953-49797975 CATCCCAAAATGCGCATGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 79
1116838780_1116838788 30 Left 1116838780 14:49797908-49797930 CCCATGTCTTTGTGGGTTTTCAC 0: 1
1: 1
2: 45
3: 108
4: 380
Right 1116838788 14:49797961-49797983 AATGCGCATGTCAGGTTAACTGG 0: 1
1: 0
2: 0
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116838780 Original CRISPR GTGAAAACCCACAAAGACAT GGG (reversed) Intronic
901949277 1:12728556-12728578 GAGAAAACCCACGCAGACATGGG - Intronic
902673039 1:17988217-17988239 GTGAAATCCCACAAACACCATGG + Intergenic
904389993 1:30177854-30177876 GTGAAAACCTACAAAGCTAAAGG + Intergenic
904693585 1:32313731-32313753 GAGAAAACCTACACAGACATGGG - Intronic
905502208 1:38448776-38448798 GTGAACACAAAGAAAGACATTGG + Intergenic
908071003 1:60460159-60460181 GGGAAAACACTCCAAGACATTGG + Intergenic
909253139 1:73383552-73383574 AAGAAAACCCACGCAGACATAGG - Intergenic
909301422 1:74017599-74017621 GAGAAAATCCACAAATCCATGGG + Intergenic
909500983 1:76335546-76335568 GAGAAAACCCACACAGACATGGG + Intronic
909975014 1:82035779-82035801 GGGAAAACCCACCTAGATATTGG - Intergenic
910697947 1:90041610-90041632 GAGAAAACCAACACAGACATGGG - Intergenic
910761276 1:90734178-90734200 CTTCAAATCCACAAAGACATTGG - Intergenic
910903718 1:92150791-92150813 GAGAAAACCCATGCAGACATGGG + Intergenic
911005743 1:93220822-93220844 ATGAGAACACACGAAGACATGGG - Intronic
912264030 1:108137349-108137371 GGGAAAAAGCACAAAGACCTGGG + Intronic
912430572 1:109626464-109626486 GGGGGAACCCACTAAGACATAGG - Intronic
912781418 1:112552183-112552205 GGGGAAACCCACAAAGGCATGGG + Intronic
913086325 1:115440524-115440546 GTAACAACCCACATAGACATAGG - Intergenic
913553434 1:119939124-119939146 GAGAAAACCCACACAGACATGGG + Intronic
915224053 1:154399003-154399025 AAGAAAACCCACACAGATATGGG + Intergenic
916629155 1:166593246-166593268 CTGAAATCCCACAAAGAGCTGGG + Intergenic
917309919 1:173668434-173668456 GTTAAAACCAAGAAAGCCATAGG + Intronic
917402799 1:174669562-174669584 GAGAAAACGCTCAAGGACATTGG - Intronic
917863330 1:179169694-179169716 GTGAAAATGGATAAAGACATAGG - Intronic
917944989 1:179960292-179960314 GAGAAAAGCCACACAGACATGGG + Intronic
918740363 1:188123051-188123073 GTGAGAACACACACAGACACAGG + Intergenic
918799636 1:188955899-188955921 GTGAAAACTTACTAAGACACTGG - Intergenic
918874326 1:190019989-190020011 AAGAAAACCCACACAGACATGGG + Intergenic
918991714 1:191704759-191704781 AAGAAAACCCAAACAGACATAGG - Intergenic
920797624 1:209155773-209155795 ATGAACACCCACAAAGACTGAGG - Intergenic
921513723 1:216064432-216064454 GAGAAAACCCACAAAAACATGGG + Intronic
921617865 1:217292851-217292873 GAGAAAACCCACGTAGACATGGG - Intergenic
921856699 1:219994170-219994192 GAGAAAACTCACACAGACATGGG - Intronic
922254012 1:223875760-223875782 GTGAAACCTCACAGAGAAATGGG + Intergenic
922711683 1:227838756-227838778 GTGAAATACTACAAAGAAATAGG - Intronic
923170413 1:231411414-231411436 GTGAAAACAGACAAACACAATGG + Intronic
923311855 1:232743131-232743153 GTGAAAACGGACTAATACATGGG + Intergenic
923378179 1:233387733-233387755 GAGAAAACCCACGCAGACATGGG - Intergenic
923825003 1:237490394-237490416 GAGAAAACAAACAAAAACATCGG + Intronic
923931870 1:238709736-238709758 AGGAAAACCCAGAATGACATGGG - Intergenic
924000059 1:239541131-239541153 GAGAAAACCCACACAGACATGGG - Intronic
924034497 1:239922577-239922599 GAGAAAACCCACATAAACATGGG - Intergenic
924300083 1:242628222-242628244 GTGAAAACCACAAAAGAAATAGG - Intergenic
924317708 1:242815619-242815641 GTGACACCCCACAAAGATTTAGG - Intergenic
924357029 1:243189805-243189827 GTTAACACTCACAAACACATAGG - Intronic
924837305 1:247663907-247663929 GAGAAAACGCACAAACACAAAGG - Intergenic
1063070780 10:2660804-2660826 GTGCAAACCCAGAAAGCCAGAGG - Intergenic
1063625318 10:7684083-7684105 GTGAAAACAAAAAATGACATTGG + Intergenic
1063640794 10:7828642-7828664 GTGAGAACCAACAATGACTTTGG - Intronic
1063865805 10:10364021-10364043 GAGAAAACCCACATAGATGTGGG - Intergenic
1064113420 10:12557649-12557671 GTGGAAATCAACAAAGACGTTGG - Intronic
1064116847 10:12585446-12585468 GTGAAAACGGACAAATACAGTGG - Intronic
1064448537 10:15419999-15420021 GAGAAGACCCACACAAACATAGG - Intergenic
1064556341 10:16550540-16550562 GTGAAAACAGACAAATACAAGGG + Intergenic
1064746596 10:18484424-18484446 GAGAAAACCAACTAAGAAATGGG + Intronic
1065901849 10:30214968-30214990 GGAAACACCCACAAAGAAATGGG + Intergenic
1066185166 10:33003379-33003401 GAAAGAACCCACACAGACATGGG - Intronic
1067928180 10:50532118-50532140 GAGAAAACCCATGCAGACATGGG - Intronic
1068096062 10:52493003-52493025 GTGAGAACTCAAAGAGACATTGG - Intergenic
1068252358 10:54459010-54459032 GAGAAAACCCACGCAGACATGGG - Intronic
1068683765 10:59847963-59847985 GAGAAAACCCGCATAGACGTGGG - Intronic
1068850071 10:61728113-61728135 TTGAAAGCATACAAAGACATGGG + Intronic
1068894345 10:62182854-62182876 GAGAAAACCCACACAGACATGGG + Intergenic
1069327538 10:67249886-67249908 GAAAAAACCCACACAGACATGGG + Intronic
1069787725 10:70999621-70999643 GTGCACACACACAGAGACATAGG - Intergenic
1070303584 10:75223849-75223871 ATGAAAACCCACAAGGACAGAGG + Intronic
1070578749 10:77702520-77702542 ATGATAAACCACAAATACATTGG - Intergenic
1071199279 10:83200159-83200181 GGTAAAACCCACAAAATCATGGG + Intergenic
1072827858 10:98626609-98626631 GAGAAAACCCAAACAGACAGTGG + Intronic
1073493446 10:103870932-103870954 GGGAAAACCCACAGAGAAAATGG - Intergenic
1073639680 10:105238919-105238941 TTAAAAACACACAAAGACAAAGG + Intronic
1075354875 10:121762527-121762549 GAGAAAATCCACACAGACACAGG - Intronic
1076065281 10:127443474-127443496 GGGAAAACAGACAAAGACAAAGG - Intronic
1077165725 11:1136983-1137005 GTGAAAACACACCACAACATGGG + Intergenic
1077680078 11:4231605-4231627 GAGACAACCCACACAGACATAGG + Intergenic
1077681411 11:4244300-4244322 GAGACAACCCACACAGACATAGG - Intergenic
1077684318 11:4276767-4276789 GAGAAAAACCACAAAGACATGGG + Intergenic
1077685721 11:4290001-4290023 GAGAAAAACCACAAAGACATGGG - Intergenic
1077689486 11:4328182-4328204 GAGACAACCCACACAGACATAGG + Intergenic
1079843932 11:25439913-25439935 ATGAAAAATCACAAATACATAGG + Intergenic
1080814890 11:35745841-35745863 GAGAAAACCCATGCAGACATGGG + Intronic
1081334611 11:41849031-41849053 GTGAAAACAGACTAATACATAGG + Intergenic
1081886449 11:46501243-46501265 GAGAAAACCCACACAGACATGGG - Intronic
1083078268 11:60064297-60064319 GATAAAACCCACAAGAACATGGG + Exonic
1084851333 11:71943582-71943604 GTGAAAGATAACAAAGACATAGG + Intronic
1085213427 11:74804086-74804108 GAAAAAACCCACACAGATATGGG - Intronic
1085558401 11:77447021-77447043 ATTAAAACACATAAAGACATAGG + Intronic
1085710003 11:78820678-78820700 GGGTAAACCCACAGACACATAGG + Intronic
1085749619 11:79150014-79150036 GTGGGAACCCACAAAGAAAAAGG + Intronic
1087832340 11:102832691-102832713 GAGAAAATCCACAAAGACACAGG - Intergenic
1088100541 11:106149833-106149855 GTGAAAAAACCCAAAGACATTGG + Intergenic
1088404547 11:109459131-109459153 GAGAAAACCTACACAGACATGGG - Intergenic
1090367258 11:126217093-126217115 GAGAAAACCCACACAGACATGGG + Intronic
1090893208 11:130946020-130946042 GAGGAAACCCGCGAAGACATGGG - Intergenic
1091364461 11:135006159-135006181 GTGAAAACCCATAAATACCGAGG + Intergenic
1091549290 12:1525806-1525828 GTGAAAACGGACAAATACAGTGG - Intergenic
1091605982 12:1951916-1951938 CTGAAGACCAACACAGACATGGG - Intronic
1092274119 12:7046402-7046424 CTGAAAACTCAGAAAGGCATTGG + Intronic
1092501611 12:9053076-9053098 GAGGAAACCCACACAGACATGGG - Intergenic
1092899882 12:13048721-13048743 GTGAAAACAGACTAATACATTGG - Intronic
1092909208 12:13131482-13131504 GAGAAAATCCACACAGACAAGGG - Intronic
1092920668 12:13228869-13228891 GAGGAAACCCACACAGACATGGG + Intergenic
1092970749 12:13692495-13692517 GAGAAAACCCACACAGATGTGGG - Intronic
1093656086 12:21695379-21695401 GAGAAAACCCATGCAGACATGGG - Intronic
1093824596 12:23668418-23668440 GTGAAAATCCATCAAGATATAGG - Intronic
1093943927 12:25085918-25085940 ATGCAAACCCACAAATACAGAGG + Intronic
1095163729 12:38947129-38947151 GGGAAAACTCTCCAAGACATTGG + Intergenic
1095658316 12:44697443-44697465 GGGAAAATCCACACAGACATGGG + Intronic
1096311227 12:50522557-50522579 GAGAAAACCTACACAGACATGGG + Intronic
1098219253 12:68251416-68251438 GTGAAAAATCACAAAGTGATGGG + Intronic
1098708791 12:73727002-73727024 GAGAAAACCCTCGCAGACATGGG - Intergenic
1099380742 12:81949264-81949286 GAGAAAACCCACACAGATATGGG + Intergenic
1099587580 12:84540359-84540381 GAGAAAACACTCAAGGACATTGG - Intergenic
1099700231 12:86074279-86074301 GTGAAAACGAACTAATACATGGG + Intronic
1099777005 12:87146680-87146702 GGGAAAACCCTTATAGACATTGG - Intergenic
1100370298 12:93963161-93963183 ATGAACACCCAAAAATACATGGG - Intergenic
1100452066 12:94716623-94716645 GAGAAAACCCACGCAGACATGGG + Intergenic
1100498688 12:95151941-95151963 GTGAAAACCTGCAAGGACAAAGG + Intronic
1101789790 12:107916156-107916178 GAGAAAACCCATGAACACATGGG - Intergenic
1102089766 12:110176096-110176118 GAGGAAACACACAGAGACATAGG - Intronic
1102449866 12:113033382-113033404 GTGAAAACAGACAAATACACTGG + Intergenic
1103802190 12:123545605-123545627 GAGAAAACCCACAGAGACAAGGG - Intergenic
1104252167 12:127105383-127105405 CTGAAAATCCACAATGAAATGGG + Intergenic
1105603159 13:21905214-21905236 GAGAAAACCCACACAGACATGGG + Intergenic
1105803686 13:23935914-23935936 GAGAAAACCCAGGCAGACATGGG + Intergenic
1105904839 13:24797572-24797594 GAAAAAACCCACACAGACACGGG - Intronic
1106268319 13:28129790-28129812 GAGAAAACCCACATAAACATGGG + Intergenic
1107569770 13:41644490-41644512 GAGAAAACACACACAGGCATGGG - Intronic
1108134027 13:47335472-47335494 GGGAAAACGTACAAAGAAATAGG - Intergenic
1108293080 13:48981384-48981406 GTGAGAACCCACAGAGATGTTGG + Intronic
1108301323 13:49079579-49079601 TTGAATAACCACAAAGAGATTGG + Intronic
1108347203 13:49558118-49558140 GAGAAAACCCACACAGACATGGG - Intronic
1108402438 13:50060474-50060496 GAGAAAACCCATGCAGACATGGG - Intergenic
1108973789 13:56410726-56410748 GGGAAAACTCTCCAAGACATTGG + Intergenic
1109189839 13:59310768-59310790 GAGAAAACCCATAAAGACATGGG + Intergenic
1109609945 13:64751515-64751537 GTGCAAATCCACAAGGTCATAGG + Intergenic
1109619090 13:64877390-64877412 GAGAACACCCACACAGTCATGGG + Intergenic
1109881623 13:68485943-68485965 GAGAAAACCCATGCAGACATGGG + Intergenic
1110181260 13:72620269-72620291 GTGAAACTCCACACAGACAGTGG - Intergenic
1110603853 13:77408483-77408505 GAGGAAACCCACACAGGCATGGG + Intergenic
1111495491 13:89043897-89043919 GAGAAGACCCACACAAACATGGG - Intergenic
1112147068 13:96711532-96711554 GTGAAGACAGACAAAGACGTGGG - Intronic
1114981181 14:28167396-28167418 GAGAAAATTCACACAGACATGGG - Intergenic
1115581761 14:34766669-34766691 TTTAAAACCCAAAAAAACATAGG + Intronic
1115681439 14:35743101-35743123 GAGAAAACCCACATAGACATGGG + Intronic
1116759725 14:48996877-48996899 GTGAAAATTCACAAAGAAATTGG - Intergenic
1116838780 14:49797908-49797930 GTGAAAACCCACAAAGACATGGG - Intronic
1117934265 14:60884245-60884267 GTAAAAACCCTCAAAAACCTGGG - Intronic
1118403120 14:65397495-65397517 GAGAAAACCCACACTGACATGGG - Intergenic
1118908448 14:70041171-70041193 ATGAAAACCCACATAGACATAGG + Intergenic
1120156756 14:81101796-81101818 GAGAAAACCCACACAGACATGGG + Intronic
1120163217 14:81167675-81167697 GTGAAAATGCATAAAGAGATAGG + Intergenic
1120461553 14:84803740-84803762 GAGAAAACTCACACAGACGTCGG + Intergenic
1121158649 14:91712885-91712907 GAGAAAACCTACGCAGACATGGG + Intronic
1121514930 14:94543317-94543339 GTGAACACCTACAGAGACATGGG + Intergenic
1122039724 14:98976829-98976851 GTGTAAACCCACAGATACACAGG + Intergenic
1126253600 15:46598237-46598259 GAGGAAACCCACAAAGGCATGGG - Intergenic
1127470729 15:59287676-59287698 GAGGAAACCCTCACAGACATGGG - Intronic
1127888679 15:63227804-63227826 GTGAATTCCCACACAGACAAAGG - Intronic
1129223458 15:74149660-74149682 ATGAACACCCCCAAAGAAATTGG - Intergenic
1129994034 15:79989470-79989492 AGGAAAAACCACAAAGACAGTGG - Intergenic
1130038345 15:80381730-80381752 GTGAAAACTCTCCAGGACATTGG + Intronic
1131669598 15:94605806-94605828 ATGAAAACTCAAAAAGACATAGG - Intergenic
1131783900 15:95890666-95890688 GAGAAAACCCACGCAGACCTGGG + Intergenic
1133522924 16:6576364-6576386 GAGAAAACCTACGCAGACATGGG + Intronic
1134569256 16:15277564-15277586 GTGAAAACAGACTAATACATGGG - Intergenic
1134733121 16:16478481-16478503 GTGAAAACAGACTAATACATGGG + Intergenic
1135601698 16:23789204-23789226 GTGGAAATCCACAAAGAAGTGGG + Intergenic
1136354883 16:29737921-29737943 GTGTAAAGCCACAGAGCCATGGG + Intergenic
1139150680 16:64378591-64378613 GTGAGATCCTCCAAAGACATAGG - Intergenic
1139243925 16:65422164-65422186 AAGAAAACCAACAAGGACATTGG + Intergenic
1141291324 16:82720606-82720628 GGGAAAACCCACACAAACATGGG + Intronic
1143839120 17:9717572-9717594 GAGAAAACCCACGCAGACATGGG - Intronic
1144380018 17:14685601-14685623 GTGAAAAGCCACATTGACATAGG - Intergenic
1146122075 17:30204541-30204563 GTGAAATCCCACTCAGTCATTGG + Intronic
1148707954 17:49652445-49652467 TTCAAACCACACAAAGACATTGG - Intronic
1148881288 17:50729665-50729687 GAGAAAACCCATACAGACATGGG + Intronic
1149229877 17:54520394-54520416 GAGAAAACCCACACAGACGTGGG + Intergenic
1149955378 17:61043549-61043571 CTGAAAACCCACACAGACATGGG - Intronic
1150120220 17:62594900-62594922 GAGAAAACCCACACAGATAGGGG + Intronic
1150167572 17:62958562-62958584 ATGAAAACCCACACAGCTATTGG + Intergenic
1150591229 17:66564598-66564620 ACTAAAACCCACAAAGTCATGGG - Intronic
1152545910 17:81000051-81000073 GTGGAAAGCCACAAGGACAAAGG + Exonic
1152940271 17:83167518-83167540 GAGAAAACCCACACAGACATGGG - Intergenic
1152978720 18:251623-251645 GAGAAAACCCACACAGACATAGG - Intronic
1153172189 18:2328834-2328856 GTGGAAACTGACAAAGACATCGG - Intergenic
1153406241 18:4743215-4743237 GTAAAAACCCTCCTAGACATTGG + Intergenic
1153729794 18:7999242-7999264 GAGAAAACCCTCACAGACATGGG + Intronic
1154360692 18:13658006-13658028 GTGAAAACCCAGAAGGACCTAGG + Intergenic
1155542671 18:26884361-26884383 GTGAACACCCCCCATGACATGGG - Intergenic
1156056036 18:33004571-33004593 GTGATACCCCACAAGCACATAGG + Intronic
1156131413 18:33979992-33980014 GTGGAAACCACCAAAAACATTGG - Intronic
1158134386 18:54190308-54190330 GAGAAAACCCAAACAGACCTGGG - Intronic
1158554626 18:58465298-58465320 GGGAAAGCCCACACAGATATGGG - Intergenic
1158969714 18:62655267-62655289 GAGAAAACCCACACAGACATGGG - Intergenic
1159545220 18:69832212-69832234 ATGAAAACCCTCAAAGAATTGGG - Intronic
1162249859 19:9433122-9433144 GAGAAAACCCATGCAGACATGGG + Intronic
1163053590 19:14702700-14702722 GTGAGAACAGACTAAGACATGGG - Intronic
1163362290 19:16854602-16854624 GAGAAAATCCACGCAGACATGGG - Intronic
1164103870 19:22085777-22085799 GTCAAAACTCAAAAAGACAAAGG - Intronic
1166681258 19:44768581-44768603 GAGTAAACCCAGAAAGACAGAGG + Intergenic
1166972292 19:46577293-46577315 GTGAAAACAGACAAATACACTGG + Intronic
1168198613 19:54796099-54796121 ATGAAAACCCTCAAAAACTTAGG - Intronic
925412824 2:3649820-3649842 GAGACAACCCACGCAGACATGGG + Intergenic
926434331 2:12823229-12823251 GAGAAAACCCACGCAGACGTGGG + Intergenic
928284897 2:29981532-29981554 CTGATAACCCTAAAAGACATGGG + Intergenic
929156250 2:38791184-38791206 GTGAAAACCAACAATGTCTTTGG + Intergenic
930140436 2:47946188-47946210 GAGAAAACCCACACAGACATGGG + Intergenic
930291935 2:49505432-49505454 GAGAAAACCCACACAGACATGGG - Intergenic
930343000 2:50141371-50141393 GGGAAAACACTCTAAGACATTGG + Intronic
931294231 2:60905920-60905942 GTGAAAACGGACTAATACATAGG - Intronic
931333965 2:61320429-61320451 GAGAAAACCCATGCAGACATGGG + Intronic
931591519 2:63888715-63888737 GAGAAAACCCACACAGATGTGGG + Intronic
931605986 2:64052456-64052478 GTTACAGCCCAGAAAGACATGGG - Intergenic
931618252 2:64183478-64183500 GAGAAAACCCATGCAGACATGGG + Intergenic
931643662 2:64403017-64403039 GTGAAATGCCACAAAGCCACTGG + Intergenic
931810539 2:65850355-65850377 GAGAAAACCCATGCAGACATGGG - Intergenic
931833534 2:66076056-66076078 GTCAAAACCCACTATGACTTTGG - Intergenic
931866440 2:66417204-66417226 GGGAATACCTAGAAAGACATGGG - Intergenic
931912502 2:66916737-66916759 GTGAGAAACCACAACGAAATGGG - Intergenic
932107660 2:68961529-68961551 GAAAAAACCCACACAGGCATGGG - Intergenic
932682944 2:73842279-73842301 GAGAAAACCCACACAGACATGGG - Intronic
933121168 2:78540267-78540289 GGGAAAACCTATAAGGACATTGG + Intergenic
933201200 2:79451065-79451087 GTAAAAACCCACTCAGACATGGG + Intronic
933323571 2:80807932-80807954 GGGAAAACTCATCAAGACATTGG + Intergenic
935084466 2:99831093-99831115 GAGAAAACCCGCACAGACTTGGG + Intronic
935414292 2:102799495-102799517 TTGAAGACCCAAAAAGATATGGG + Intronic
935424432 2:102905122-102905144 GAGAAAACCCACACAGACATGGG + Intergenic
935719909 2:105970817-105970839 GTACTAACCCACAGAGACATGGG + Intergenic
935737375 2:106117062-106117084 GAGAAAACCCACACAGACGTGGG - Intronic
935974748 2:108567197-108567219 GAGAAAACCCAAGCAGACATGGG - Intronic
938585869 2:132690169-132690191 GAGAAAACCCACACAGACATGGG - Intronic
938762756 2:134440381-134440403 GAGAAAACCCATGAAGACACAGG - Intronic
938978551 2:136503837-136503859 GAGAAAACTCACACAGACATGGG - Intergenic
938979799 2:136515459-136515481 GAGAAAACCCATGCAGACATGGG - Intergenic
939335766 2:140826311-140826333 GAGAAAACCCACACAGACATGGG - Intronic
940279748 2:151976937-151976959 GTGAAAAGCAACCAAGACACTGG + Intronic
941463457 2:165797933-165797955 GTGAAGAGCCACAAACACGTGGG + Intergenic
941833889 2:169994820-169994842 GACAAAACCCATAAAGACATGGG - Intronic
941978773 2:171433223-171433245 GTGAAAACCCATGCAGACGTGGG + Intronic
942317947 2:174711696-174711718 GAGAAAACCCACATAGACAAGGG - Intergenic
942894560 2:181036476-181036498 GAGAAAGCCCACACAGACACGGG - Intronic
943138032 2:183940445-183940467 TTGAAAATGCACAAATACATGGG + Intergenic
943139808 2:183968084-183968106 GAGAAAACCCATGCAGACATGGG + Intergenic
943488073 2:188513942-188513964 GAGAAAACCCACGCAGATATGGG - Intronic
943874749 2:193051003-193051025 GAGTAAACACACATAGACATGGG + Intergenic
944004971 2:194893381-194893403 TTGAAAACCCAGAAAAAAATAGG - Intergenic
945782986 2:214200268-214200290 ATCAAAACCCTCAACGACATTGG - Intronic
945891032 2:215431712-215431734 GTGAAAACCAATAAAGAAATGGG - Intronic
946079187 2:217102384-217102406 GTGAAAACAGACTAATACATAGG + Intergenic
946752542 2:222906908-222906930 GTCAAAAACAACACAGACATTGG - Intronic
946872682 2:224098620-224098642 CTGAAAGCCCACAAGGAAATGGG - Intergenic
948211111 2:236193823-236193845 GAGAAAACCCATACAGACAGTGG - Intergenic
948531672 2:238612104-238612126 ATTAAAAACAACAAAGACATAGG + Intergenic
948971405 2:241430393-241430415 GTGATACCCCACAAAGCAATGGG - Intronic
1168946864 20:1768029-1768051 GAGGAAAACCACAAAGACAAGGG + Intergenic
1169490181 20:6064716-6064738 GAGAAAACCCACGTAGACATGGG + Intergenic
1171128974 20:22630791-22630813 GGGAAAAGGCAGAAAGACATGGG - Intergenic
1172310869 20:33917587-33917609 GAGAAAACGAACTAAGACATTGG + Intergenic
1173967958 20:47128046-47128068 GTGACATCCTAGAAAGACATGGG + Intronic
1174750210 20:53104523-53104545 GAAAAAACACACAAAGACTTTGG - Intronic
1175475861 20:59273843-59273865 GTGAAAACCTAGCAACACATCGG - Intergenic
1176518919 21:7810461-7810483 GAGGAAACCCACACAGACATGGG - Intergenic
1177024463 21:15905140-15905162 CTGAAAAACAACAAAGACACAGG + Intergenic
1177679858 21:24352835-24352857 GAGAATATCCACATAGACATGGG + Intergenic
1177910962 21:27031268-27031290 GAGAAAACCCACACAGACATGGG + Intergenic
1178652947 21:34440474-34440496 GAGGAAACCCACACAGACATGGG - Intergenic
1179406964 21:41134419-41134441 GTGAAAACAAACAAAAAAATGGG - Intergenic
1181037254 22:20175714-20175736 GTGAGTACCCAGCAAGACATGGG - Intergenic
1181912241 22:26247919-26247941 GTTAGAACCCACAATGACCTGGG + Intronic
1182192366 22:28475424-28475446 GAGAAAACCCACACCGACATGGG + Intronic
1182493062 22:30686758-30686780 GAGAAAACCCACACAGACCTGGG + Intergenic
1184992311 22:48179002-48179024 GGGAAAGCCCACAGATACATAGG - Intergenic
949203021 3:1403369-1403391 GTGAAAAATCACAATGACAATGG - Exonic
949214154 3:1545232-1545254 GAGAAAACCCACACAGTCATGGG - Intergenic
949441865 3:4090286-4090308 GAGAAAACCCATGCAGACATGGG - Intronic
949730101 3:7100546-7100568 GTGGAATACCACAAAAACATGGG + Intronic
951354237 3:21644509-21644531 GAGAAAACACACGCAGACATGGG + Intronic
952202515 3:31146453-31146475 GTGAAAACAGACTAAGACACAGG - Intergenic
953181052 3:40595701-40595723 GTGAAAACAGACTAATACATTGG + Intergenic
953295848 3:41715600-41715622 GTTAAAAACCACAAATACTTAGG + Intronic
954028945 3:47804091-47804113 GTTAAAACCCACAATGACAGTGG - Intronic
954043416 3:47908129-47908151 GTGAAAAATCTCAAAGACAAGGG + Intronic
955442937 3:58976713-58976735 GAGAAAACCCATGCAGACATGGG - Intronic
956238933 3:67107337-67107359 TAGAAAACTCACACAGACATTGG - Intergenic
958784332 3:98581294-98581316 GTCAAAACTAACAAAGACCTAGG + Intronic
958982735 3:100742654-100742676 GAGAAAACCCACACAGACTTGGG + Intronic
959473756 3:106784868-106784890 ATGAAAACCCAAATAGACAGGGG + Intergenic
960013384 3:112857963-112857985 ATGAAAACCCACAGAAAAATAGG + Intergenic
960044460 3:113183240-113183262 GTGAAAACCCACACAGACATGGG + Intergenic
960892454 3:122463753-122463775 GTGAGATCCCACAAATAAATAGG + Intronic
962162910 3:133018360-133018382 GAGGAAACCTACACAGACATGGG + Intergenic
962629439 3:137260831-137260853 GAGAAAACCCACACAGACATAGG - Intergenic
964204877 3:154162592-154162614 GAGAAAACCCACGCAGACACCGG - Intronic
964807273 3:160624613-160624635 GAGAAAAGCCACTCAGACATGGG + Intergenic
964839606 3:160979452-160979474 GGGAGAACTCACACAGACATGGG + Intronic
966228895 3:177628920-177628942 CTGAAAACCCACCTAAACATTGG - Intergenic
966661751 3:182422179-182422201 GTGAAAAAGCACAATGATATAGG - Intergenic
967154843 3:186682889-186682911 GTGAAAACAGACTAATACATTGG - Intergenic
969047736 4:4349264-4349286 CTGCAGACCCACAGAGACATGGG - Intronic
969257984 4:6015573-6015595 GAGAAAGCCCACACAGACATGGG - Intergenic
969661858 4:8534890-8534912 GTGAAAACAGACAAATACACAGG - Intergenic
970676523 4:18456637-18456659 AAGAAAACCCACACAGACATGGG - Intergenic
970713265 4:18889436-18889458 GAGAAAACACACACAAACATGGG + Intergenic
970926872 4:21462202-21462224 GTGAAAACACACAAATACATGGG - Intronic
971758067 4:30726631-30726653 GAGAAAACCCTCAAAGCAATTGG + Intronic
972249078 4:37280485-37280507 GAGAAAAACCACACAGACATAGG + Intronic
972506205 4:39722663-39722685 GAGAAAACCCACAAAGACGTGGG + Intronic
972915359 4:43870531-43870553 GGGAAATCCCTCAAGGACATTGG - Intergenic
972927449 4:44028575-44028597 GTGAAAACATATCAAGACATTGG + Intergenic
972931955 4:44082887-44082909 TTGAAAACCTACACAGACATAGG - Intergenic
973617310 4:52691762-52691784 GTGAACACCCACACAGAAGTTGG + Intergenic
974693916 4:65339857-65339879 AAGGAAACCCACACAGACATGGG + Intronic
974821360 4:67070594-67070616 GTGAATACACAGAAAGACAGAGG + Intergenic
974867551 4:67598854-67598876 GGGAAAACTCTCCAAGACATTGG - Intronic
975488032 4:74956682-74956704 GCGAAAAGCCAATAAGACATAGG - Intronic
975597640 4:76065402-76065424 GGAGAAACCCACACAGACATGGG + Intronic
975655413 4:76636630-76636652 GGGAAAACCCACACAGACATGGG - Intronic
975918104 4:79348467-79348489 ATGAAAACCCACAAAAAACTGGG - Intergenic
976218297 4:82735214-82735236 GAGAAAACCCATACAGACATGGG - Intronic
976736527 4:88315699-88315721 GAGGAAACCCACACAGACGTGGG - Intergenic
976766819 4:88606512-88606534 GTGAAAACCGACTAATACAACGG - Intronic
979215205 4:118155324-118155346 GAGAAAACCCACATAGACATGGG - Intronic
979244788 4:118489796-118489818 GTTAACACTCACAAACACATAGG + Intergenic
979282874 4:118887062-118887084 GAGAAAACCTATACAGACATGGG - Intronic
980502851 4:133679145-133679167 GAGAAAACCCAGGAGGACATGGG + Intergenic
980561217 4:134478966-134478988 TTGGAAACCCATAAAGACAGGGG - Intergenic
981032299 4:140137374-140137396 GTTAAAACCCACAACCATATGGG - Intronic
981155463 4:141429681-141429703 GAGAAAACCTACACAGACACGGG - Intergenic
981506279 4:145503750-145503772 GAGAAAACCCAAGCAGACATGGG - Intronic
981952436 4:150424731-150424753 GAAAAAGCCCACACAGACATGGG + Intronic
982474774 4:155836610-155836632 TTGAAAACCCTCAAAGACTCAGG - Intronic
983252465 4:165360278-165360300 GAGAAAACCCACGTAGACACAGG + Intergenic
983342897 4:166488424-166488446 GAGAAAACCTACACAGACATGGG - Intergenic
983484686 4:168319378-168319400 CTGAAACCCCACAATGAAATTGG + Intergenic
985181735 4:187272203-187272225 GAGAAAACCCACACAGACGTGGG + Intergenic
985272395 4:188206689-188206711 AAGAAAATCCACACAGACATGGG - Intergenic
985374911 4:189324596-189324618 GTGAAAACCTAACAAGACAAGGG - Intergenic
986199430 5:5568069-5568091 GGGAAACCCCACACAGACCTGGG - Intergenic
986869080 5:12026902-12026924 GTGAAAACAAACTAATACATAGG - Intergenic
987159965 5:15132194-15132216 GTGCAAACACACACAGACACTGG - Intergenic
987273092 5:16333293-16333315 GTGAAAACCCACAAATATAGAGG + Intergenic
987470808 5:18325180-18325202 GTGAAAACGAACTAATACATTGG - Intergenic
987907652 5:24098334-24098356 GAGACAACCCACACAAACATGGG - Intronic
988182328 5:27813038-27813060 CTTATAACCCACAAACACATGGG - Intergenic
988381814 5:30506787-30506809 GTGATAACCCAGAATGTCATAGG - Intergenic
988478820 5:31612158-31612180 GAGAAAAGTCACACAGACATGGG + Intergenic
989234447 5:39129371-39129393 GAGAAAACACTCCAAGACATTGG + Intronic
989250111 5:39303750-39303772 GAGAAAGCCCACACAAACATGGG - Intronic
990234075 5:53747716-53747738 CTGAAAACTCACAAATAAATGGG + Intergenic
990673478 5:58158697-58158719 TTGTCAAGCCACAAAGACATGGG - Intergenic
990911395 5:60856008-60856030 CTGAAAACCCAAAATAACATAGG - Intergenic
991136396 5:63186649-63186671 GTGAAAACAAACTAATACATTGG + Intergenic
991406220 5:66303327-66303349 GAGAAAACCCACACAGACATGGG - Intergenic
992160677 5:73997847-73997869 GAGAAAACCCACACAGACAGCGG + Intergenic
992344069 5:75858284-75858306 ATGAAAACCCTCAAAAAAATGGG - Intergenic
992416819 5:76559753-76559775 GAGAAAACCCACGCAGACCTGGG - Intronic
992851047 5:80807888-80807910 GAGAAAATCCACACAGGCATAGG + Intronic
993073220 5:83191886-83191908 GTGAAGACCAACTAATACATAGG + Intronic
993244887 5:85438114-85438136 GAGAAAACCTACATAGACATGGG + Intergenic
993383388 5:87233770-87233792 GAGAAAACCCACACAGACATGGG - Intergenic
993383923 5:87241061-87241083 GAGAAAATCCACACAGACATGGG + Intergenic
993494651 5:88594103-88594125 GTAAAAACCCACTAAGTCATTGG - Intergenic
993791049 5:92211809-92211831 GTGAAAATCTTCAAAAACATAGG + Intergenic
994136195 5:96289683-96289705 GTGAAAACGAACAAACACACTGG + Intergenic
994406731 5:99354132-99354154 GTGAAAACAGACTAATACATAGG - Intergenic
994599567 5:101885979-101886001 GAGAAAACCCACACAGACATAGG + Intergenic
995120149 5:108527527-108527549 GAGAAAACCCATGTAGACATGGG - Intergenic
995321049 5:110834503-110834525 AAGAAAACCCACGCAGACATGGG - Intergenic
995930121 5:117431461-117431483 GAGAAAACCCACACAGACATGGG - Intergenic
995949021 5:117687032-117687054 GTGAAAACCCATAAGGGCTTAGG - Intergenic
996013669 5:118507754-118507776 GTGAAAACCCTAGAAGACAGAGG + Intergenic
996966960 5:129317866-129317888 GTGAAAACCCTCTAGGACATTGG - Intergenic
997929177 5:138058338-138058360 GGGAAAACCCACACAGACATGGG + Intergenic
998069398 5:139185104-139185126 GAGAAAACCCACACAGACATGGG - Intronic
998578549 5:143344969-143344991 GAGAAAAACTACACAGACATGGG - Intronic
999073910 5:148777062-148777084 GAGAAAACCCAGGCAGACATGGG + Intergenic
999341323 5:150776229-150776251 GAGAAAACCCAGGAAGACATGGG + Intergenic
1001151377 5:169231119-169231141 GAGAAAACCCATACAGATATGGG - Intronic
1001207906 5:169781205-169781227 GAGAAAATCCACATAGAAATGGG + Intronic
1002827043 6:783408-783430 GAGAAAACCCACAGAGTCATGGG - Intergenic
1003886813 6:10529212-10529234 GTGACCATCCACAAAGACTTCGG + Exonic
1004076221 6:12346486-12346508 GAGAAAACCCACACAGATGTGGG - Intergenic
1004184605 6:13411262-13411284 GTGAGGATCCACAAAGACATCGG + Intronic
1004798477 6:19116466-19116488 TTGAAAATTCACAAACACATGGG + Intergenic
1004838539 6:19556472-19556494 GTAAAAACCAACAAAGATAAAGG + Intergenic
1004870613 6:19900445-19900467 GAGAAAACCCACACAGACAGTGG + Intergenic
1004934137 6:20491167-20491189 CTGGAAACTCACAAACACATTGG - Exonic
1005206546 6:23411556-23411578 CTGAAAAGACACAAAGTCATGGG - Intergenic
1005844723 6:29768496-29768518 GGGTAAACCCACAAAGACAGTGG + Intergenic
1005862670 6:29913432-29913454 GGGGAAACCTACAAAGACAGTGG + Intergenic
1005874156 6:29998634-29998656 GGGGAAACCTACAAAGACAGAGG + Intergenic
1006283201 6:33072889-33072911 GTGACCACCCACAAAGACCCAGG + Intronic
1006827623 6:36947780-36947802 GAGAAAACCCACGCAGACGTGGG + Intergenic
1007149258 6:39671844-39671866 AAGACAACCCACAAAGACATGGG - Intronic
1008595920 6:53041694-53041716 GAGAAAACCCACACAGACACAGG - Intronic
1009029228 6:58036602-58036624 GTCAAAACCCAACAAGGCATAGG + Intergenic
1009204767 6:60787998-60788020 GTCAAAACCCAACAAGGCATAGG + Intergenic
1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG + Intronic
1011315862 6:86030504-86030526 ATGAAGCCCCACAAAGACAGAGG + Intergenic
1011958882 6:93060969-93060991 GTGAAAACACACACAAACACAGG + Intergenic
1012111013 6:95233927-95233949 CAGAAAACCCACGCAGACATGGG - Intergenic
1012568890 6:100698229-100698251 TTGAAAATCCTCAAAGACTTAGG + Intronic
1012603299 6:101125857-101125879 GCAAAAAACCAAAAAGACATGGG - Intergenic
1012850388 6:104439736-104439758 GTGAAGGTCCACAAAGACAATGG + Intergenic
1012853089 6:104470197-104470219 GAGAAAACCCACACAGACGTGGG + Intergenic
1013445292 6:110220308-110220330 GTGAAAACAGACTAATACATGGG - Intronic
1013916702 6:115347879-115347901 GGGAAAACACACAGAGACAAAGG - Intergenic
1014234283 6:118937337-118937359 GTGAAAACAGACTAATACATTGG + Intergenic
1015995516 6:138992311-138992333 GAGAAAACCCACACAGACATAGG + Intergenic
1016116891 6:140298227-140298249 GTGAAAAACAACAGAAACATTGG + Intergenic
1016150658 6:140737946-140737968 ATGAAAACAAACAAATACATAGG - Intergenic
1016791796 6:148074225-148074247 GTGAAAATGCACACAGGCATTGG - Intergenic
1017034380 6:150253743-150253765 GGGAACACCCACAGAGACACGGG - Intergenic
1019768571 7:2869341-2869363 GTGAAAACAGACTAATACATAGG - Intergenic
1019790291 7:3007968-3007990 GAGAAAACCCACACAGACGTAGG + Intronic
1020335959 7:7062602-7062624 GTGTACACCTCCAAAGACATTGG - Intergenic
1020380296 7:7537342-7537364 GAGAAAACCCACACAGACATGGG + Intergenic
1020392073 7:7669008-7669030 GAGAAAACCCACACAGACGTAGG + Intronic
1020434474 7:8147902-8147924 GAGAAAACCCATTCAGACATGGG - Intronic
1020528859 7:9302522-9302544 GAGAAAACCCATGAAGACATGGG + Intergenic
1020709273 7:11585865-11585887 GAGAAAACCCATGCAGACATGGG + Intronic
1021136568 7:16971813-16971835 CAGGAAACCCACACAGACATGGG - Intergenic
1021548315 7:21841496-21841518 GAGAAAACCCAGGCAGACATGGG - Intronic
1021816568 7:24452872-24452894 GAGAAAACCCACACAGACATGGG - Intergenic
1023652871 7:42389460-42389482 GGGAAAACCCACTGAGTCATGGG + Intergenic
1025148844 7:56529321-56529343 GTGAAAACCCTCAATAAAATAGG + Intergenic
1026272476 7:68848614-68848636 GTGAAAACAGACTAAGACAATGG + Intergenic
1027334547 7:77134620-77134642 GAGAAAACCCAGGCAGACATAGG - Intronic
1027468765 7:78547749-78547771 GAGAAAACCCACACAGACAAAGG + Intronic
1028547961 7:92025969-92025991 GAAAAACGCCACAAAGACATGGG - Intronic
1029580506 7:101433997-101434019 GGGAAAATCCACAAAGAAAATGG - Intronic
1029781299 7:102736988-102737010 GAGAAAACCCAGGCAGACATAGG + Intergenic
1030164598 7:106541067-106541089 GAGAAAACCCACACAGACATTGG + Intergenic
1030388466 7:108895139-108895161 CTGAAAACCAATAAAGACATGGG + Intergenic
1031190477 7:118543139-118543161 ATGAAAACCCTCAAAAACCTGGG + Intergenic
1031588772 7:123565099-123565121 CTGAAAACCCACAGAGCCAATGG + Intergenic
1032733360 7:134666340-134666362 GTGAACACAGAAAAAGACATGGG + Intronic
1034715551 7:153238198-153238220 GGTCACACCCACAAAGACATAGG + Intergenic
1035082765 7:156231716-156231738 GTGAAAACCACTAAAAACATGGG + Intergenic
1036483725 8:9161128-9161150 GTTAAAACACACAGAGAGATGGG - Intronic
1037312398 8:17570349-17570371 GTAAAAACCAACAAAGGCATTGG + Exonic
1037971871 8:23177692-23177714 GAGAATATCCACAAAGATATAGG - Intergenic
1038274051 8:26105144-26105166 GAGAAAATCCACACAGACAGGGG - Intergenic
1038683913 8:29697796-29697818 GAGAAAACCCAAGCAGACATGGG - Intergenic
1039328649 8:36512711-36512733 AAGAAAACCCACCAAGACATTGG - Intergenic
1039868815 8:41528817-41528839 GTGAAACCCCGCAAAGACGGAGG + Intergenic
1040940062 8:52823624-52823646 ATGAAAACCCATGCAGACATGGG - Intergenic
1041115509 8:54531845-54531867 GTGAAAACAGACTAATACATGGG + Intergenic
1042097400 8:65232560-65232582 GAGAAAACCCACATAGACTTCGG - Intergenic
1042335933 8:67630373-67630395 AAGAAAACCCACACAGACATGGG + Intronic
1042782368 8:72506092-72506114 GAGAAAACCCACACAGACATGGG - Intergenic
1043210433 8:77507477-77507499 GTGAAAACCCAGAAACATTTAGG - Intergenic
1043304156 8:78773286-78773308 GAGAAAACCCACACAGACACGGG + Intronic
1043317716 8:78942005-78942027 AAGAAAACCCACACAGACATGGG - Intergenic
1043421858 8:80106077-80106099 CTAAAAACCCACAAAAAAATAGG - Intronic
1044105891 8:88206395-88206417 GAGAAAACTCACACAAACATGGG - Intronic
1044453099 8:92361110-92361132 TTAAAGACACACAAAGACATGGG + Intergenic
1044616502 8:94148105-94148127 GGGGAAACCCACAACCACATTGG + Intronic
1045120672 8:99030353-99030375 GAGAAAACCCATGCAGACATGGG - Intronic
1045192813 8:99899593-99899615 GAGAAAACCCACGCAGACATGGG - Intergenic
1046220659 8:111209862-111209884 GAGAAAACCCAGGCAGACATGGG - Intergenic
1046672372 8:117070351-117070373 CTGACCACCCACAAAGACACTGG + Intronic
1046679209 8:117150003-117150025 GAGAAAACCCATGCAGACATGGG + Intronic
1047195870 8:122720973-122720995 GAGAAAACCCACATAGACATTGG + Intergenic
1047905070 8:129464289-129464311 GAGAAAACTGACAAATACATAGG + Intergenic
1048165380 8:132057783-132057805 GTGACAACCCTCCAAGACTTTGG + Intronic
1048439019 8:134446046-134446068 TTGCTAACCCTCAAAGACATTGG + Intergenic
1048801671 8:138199571-138199593 GTGAAAACGAACTAATACATAGG - Intronic
1049215094 8:141404138-141404160 GAGAAAACCCACACAGACCTGGG + Intronic
1050269338 9:3925494-3925516 GAGAAAACCCATACAGACATGGG - Intronic
1050378077 9:4993847-4993869 GGAAAAACCCACACAGACGTGGG - Intronic
1050400205 9:5245078-5245100 GAGAAATTCCACAAAGATATAGG + Intergenic
1050715838 9:8524020-8524042 GTGAATAACCACAAAGGCATGGG - Intronic
1050779404 9:9312508-9312530 GAGAAAACCCACGCAGACATGGG - Intronic
1051455540 9:17252844-17252866 GAGAAAACTCTCCAAGACATTGG - Intronic
1052299987 9:26943268-26943290 TTGAAAACCCAGAAAGTCTTTGG - Intronic
1052795471 9:32919693-32919715 ACGAAAACCCACGCAGACATGGG - Intergenic
1053246406 9:36538120-36538142 AAGGAAACCCACACAGACATGGG + Intergenic
1053577570 9:39368631-39368653 GTGACAAGCCACAAGGCCATAGG - Intergenic
1053842075 9:42196583-42196605 GTGACAAGCCACAAGGCCATAGG - Intergenic
1054099145 9:60927348-60927370 GTGACAAGCCACAAGGCCATAGG - Intergenic
1054120544 9:61202972-61202994 GTGACAAGCCACAAGGCCATAGG - Intergenic
1054587206 9:66979584-66979606 GTGACAAGCCACAAGGCCATAGG + Intergenic
1055148527 9:72965620-72965642 GAGAAAGCCCACAAGGACATGGG + Intronic
1056013808 9:82360764-82360786 GAGAAAAACCATATAGACATGGG - Intergenic
1056165811 9:83939922-83939944 GTTAAATTCCACAAAGACAGGGG + Intronic
1056598877 9:88030412-88030434 GAAAAAACCCACACAGACATGGG - Intergenic
1058316682 9:103576364-103576386 GAGAAAACACACAAACACATGGG + Intergenic
1058889616 9:109349945-109349967 GTGAAAAGCCACTGAGACTTGGG - Intergenic
1059599593 9:115762273-115762295 GTGGAATCCCACAAATACCTGGG - Intergenic
1060388477 9:123256831-123256853 GAGAAAACCCACACAGACATGGG + Intronic
1061644977 9:131993802-131993824 GAGAAGACCCACACAGACATGGG - Intronic
1061694166 9:132358599-132358621 GAGGAAACCCACACAGACATGGG - Intergenic
1062683201 9:137795554-137795576 GAGAAAACGCACACAGACACGGG + Intronic
1186367655 X:8912172-8912194 TTGAAAACACACAACGACATTGG + Intergenic
1187887627 X:23904466-23904488 GTGGAAACCCAAGAAGAGATGGG + Intronic
1188745397 X:33835081-33835103 ATAAAAACCCACAAAAAAATTGG - Intergenic
1188770628 X:34148872-34148894 GAGAAAACGCATACAGACATGGG + Intergenic
1188782522 X:34303149-34303171 GCCAAAACCCACACAGACATGGG - Intergenic
1188796476 X:34472300-34472322 GAGAAAACCCATACAGACATGGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190364517 X:49678872-49678894 GAGAAAACCCATACAGACATGGG + Intergenic
1191949545 X:66573376-66573398 GTGAAAACAGAAAAAGACATAGG - Intergenic
1192361334 X:70442348-70442370 GAGAAAACCCACACATACATGGG - Intergenic
1192470423 X:71393951-71393973 CTCAAAATCCACTAAGACATGGG - Intronic
1192970557 X:76224213-76224235 GTGAAAGGCCACATACACATAGG - Intergenic
1193561804 X:83027629-83027651 GGGAAAACTCTCAAGGACATTGG + Intergenic
1193635327 X:83943474-83943496 ATGAACACCCACAAAGAGATTGG - Intergenic
1193735923 X:85156289-85156311 TTGAAAAACAACAACGACATAGG - Intergenic
1194459104 X:94143947-94143969 CGGAAAACCAATAAAGACATAGG - Intergenic
1194559277 X:95400824-95400846 GTAAAAACCTACAAAAACTTGGG + Intergenic
1194664546 X:96663183-96663205 GAGAAAGCCCACACAGACATGGG + Intergenic
1195454684 X:105054249-105054271 GAGAAAACCCACATAGATATGGG + Intronic
1195490615 X:105464954-105464976 GAGAAAACCCACACAGACATGGG + Intronic
1196007827 X:110854230-110854252 CTGAAAAGCCAGAAAGCCATAGG + Intergenic
1196194995 X:112830189-112830211 GTAAAAACCCAAATACACATAGG - Intronic
1197690453 X:129495019-129495041 GAGAAAACTCATACAGACATGGG - Intronic
1197827261 X:130603217-130603239 GAGAAAACCCACACAGACTCTGG - Intergenic
1198133694 X:133725593-133725615 GAGAAGAGCCTCAAAGACATAGG + Intronic
1198183551 X:134233174-134233196 GTGAAGACACACAGACACATAGG + Intergenic
1198609278 X:138379645-138379667 GTGAAAACACACTAATACAATGG + Intergenic
1198611069 X:138401281-138401303 GTGAAAACACACTAATACAATGG - Intergenic
1198613168 X:138424759-138424781 GGGAAAACCAACAAAGACAGTGG + Intergenic
1198707384 X:139463395-139463417 GTGAAAACACACTAATACACCGG + Intergenic
1198866777 X:141131457-141131479 AAGAAAACTCACAAAGACCTAGG + Intergenic
1199333860 X:146595259-146595281 GTGGAAACCCTCCAGGACATTGG - Intergenic
1199333936 X:146596374-146596396 GTAAAAACCCTCAAAGAACTGGG - Intergenic
1199420508 X:147638240-147638262 GTGAAAACAGACTAATACATGGG + Intergenic
1199456386 X:148034015-148034037 GCGAAAACCCACGCAGATATGGG - Intergenic
1199780707 X:151056604-151056626 GAGAAAATCCACGAAGACATGGG - Intergenic
1199995766 X:153025090-153025112 CTCCAAACCCACAAAGAAATGGG - Intergenic
1200291595 X:154880515-154880537 GTGAAAACATAACAAGACATTGG - Intronic
1200637272 Y:5671934-5671956 TTAAAAACCCTCAAAGAAATGGG - Intronic
1201496247 Y:14593761-14593783 GTGAAAAAACACAAAGAGGTGGG - Intronic