ID: 1116840949

View in Genome Browser
Species Human (GRCh38)
Location 14:49820641-49820663
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 3, 1: 90, 2: 20, 3: 55, 4: 458}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116840949_1116840953 -8 Left 1116840949 14:49820641-49820663 CCTTCCACGGTCTCCCTCTCATG 0: 3
1: 90
2: 20
3: 55
4: 458
Right 1116840953 14:49820656-49820678 CTCTCATGCCGAGCCAAAGCTGG 0: 25
1: 227
2: 708
3: 445
4: 248
1116840949_1116840956 13 Left 1116840949 14:49820641-49820663 CCTTCCACGGTCTCCCTCTCATG 0: 3
1: 90
2: 20
3: 55
4: 458
Right 1116840956 14:49820677-49820699 GGACTGTGCTGCTGCCATCTCGG 0: 73
1: 841
2: 430
3: 172
4: 1041

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116840949 Original CRISPR CATGAGAGGGAGACCGTGGA AGG (reversed) Intronic
900146319 1:1160401-1160423 CAAGGGAGGGAGACAGTAGAGGG + Intergenic
900303548 1:1990369-1990391 CGGGAGAGGGAGACAGTGGCGGG + Intronic
900544514 1:3220992-3221014 CAAGAGAGGGAGACCCTGTCTGG + Intronic
900618362 1:3575768-3575790 CATGGGAGGGACCCAGTGGAAGG - Intronic
900714732 1:4137008-4137030 CAAGAGAGGGAGAGGATGGAAGG - Intergenic
900858445 1:5205305-5205327 CATGAGAGGGACCCAGTGGGAGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG + Intergenic
902134756 1:14295380-14295402 CATGAGAGGGAGAAGCTGGGAGG - Intergenic
902688508 1:18095005-18095027 CATGAGAGGGACCCAGTGGGAGG - Intergenic
902979471 1:20112852-20112874 CAGGAGAGTGACACCATGGAGGG - Exonic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903163152 1:21503477-21503499 AGGGAGAGGGAGACCGTGGGGGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904118093 1:28176939-28176961 CATGAGAGTGAGAAAGAGGAGGG + Exonic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904992488 1:34604366-34604388 GAGGAGAGGGAGGCTGTGGAAGG + Intergenic
905493383 1:38362881-38362903 CATGAGAGGGACCCAGTGGAAGG - Intergenic
905655364 1:39683298-39683320 CATGAGAGGGAGAGAGTGATAGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907560226 1:55381156-55381178 CAAGAGAGTGGGACAGTGGAGGG - Intergenic
907846069 1:58208134-58208156 CATGAGAGGGACCCAGTGGGAGG - Intronic
908116225 1:60943041-60943063 CATGAGAGGAAGACACTGCATGG + Intronic
908348182 1:63257542-63257564 CAGGAGAGAGAGACTGGGGAGGG - Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445441 1:64195556-64195578 CATGAGAGGGATTCCGTGTAAGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908613955 1:65896389-65896411 CATGGGAGGGACACAGTGGGAGG - Intronic
908800077 1:67871079-67871101 CATGAGAGGGACCCAGTGGGAGG + Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909810408 1:79925726-79925748 CATGAGAGGGACTCAGTGGCAGG + Intergenic
909871076 1:80739821-80739843 CATGAGAGGGACCCAGTGGGAGG - Intergenic
910378875 1:86603803-86603825 CATGAGAGGGACCCAGTGGGAGG - Intergenic
912028374 1:105206761-105206783 CAAGAGAGAGAGACAGTGAATGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915528482 1:156490227-156490249 CATGAGAAGGAGACCCGAGAGGG - Intronic
915627320 1:157122966-157122988 CAGGTGAGGGAGACAGTAGATGG - Exonic
915786892 1:158623487-158623509 CATGGGAGGGAGCCAGTGGGAGG + Intronic
915972331 1:160363389-160363411 CCTGAGAGGTAGATCGTTGAGGG - Intergenic
916120066 1:161521599-161521621 CATGGGAGGGACCCAGTGGAAGG + Intronic
916129827 1:161603248-161603270 CATGGGAGGGACCCAGTGGAAGG + Intronic
916258723 1:162818906-162818928 CATGAGAGGGAAACTTTTGATGG + Intergenic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
917107182 1:171503982-171504004 CATGGGAGGGACTCGGTGGAAGG - Intronic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
919510193 1:198453538-198453560 CATTAGAGAGAGAATGTGGAAGG - Intergenic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
920844015 1:209578284-209578306 CATGGGAGGGACCCAGTGGAAGG + Intergenic
921399622 1:214707222-214707244 CATGGGAGGGACCCAGTGGAAGG + Intergenic
921429048 1:215042098-215042120 CATGGGAGGGAACCCGTGGGAGG - Intronic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
921709474 1:218359072-218359094 AACGAGAGGGAGACAGAGGAAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922625578 1:227038097-227038119 CATGGGAGGGACACAGTGGGAGG + Intronic
922740329 1:228010770-228010792 GATGTGAGGGAGACCCTGGAGGG - Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
923904605 1:238369906-238369928 CATGAGAGGGACCCAGTGGAAGG - Intergenic
924430294 1:243990699-243990721 CATGGGAGGGACACAGTGGGAGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063462882 10:6225581-6225603 CATGAGAGGGACAGCGTGATGGG - Intronic
1063493071 10:6482911-6482933 CATGGGAGGGACCCAGTGGAAGG - Intronic
1063542713 10:6950536-6950558 CATGGGAGGGACCCAGTGGAAGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064170516 10:13028145-13028167 CATGAGAGGGACCCAGTGGGAGG + Intronic
1065289336 10:24214458-24214480 AAAGAGAGAGAGAACGTGGAAGG + Intronic
1065456200 10:25909145-25909167 CATGGGAGGGACCCCGTGGGAGG + Intergenic
1068198700 10:53753420-53753442 CATGGGAGGGACACAGTGGGAGG - Intergenic
1068252203 10:54456756-54456778 CATGGGAGGGACACAGTGGGAGG + Intronic
1068924929 10:62526537-62526559 CATGGGAGGGACACAGTGGGAGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069313548 10:67069323-67069345 CATGTAAGGGAGACTTTGGAAGG - Intronic
1069339724 10:67396760-67396782 CATGGGAGGGACACGGTGGGAGG + Intronic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1070846337 10:79525109-79525131 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1070927460 10:80235197-80235219 CCTGTGTGGGAGACTGTGGAGGG + Intergenic
1071266339 10:83968133-83968155 CATGGGAGGGAGTCAGTGGGAGG - Intergenic
1071673386 10:87632516-87632538 CATGGGAGGGAGCTGGTGGAAGG - Intergenic
1072407913 10:95171657-95171679 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1072528732 10:96298186-96298208 CATGAGAGGGAGCCTGTCGGGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072634318 10:97167724-97167746 CATGGGAGGGAGCCGGTGGGAGG + Intronic
1072647269 10:97266843-97266865 CATGAGAGGAACTCGGTGGAAGG - Intronic
1076239924 10:128897083-128897105 CAAGAGAGGGAAAGAGTGGAAGG + Intergenic
1076528752 10:131130298-131130320 CATGAGAGGGACCCAGTGGGAGG - Intronic
1077514491 11:2993133-2993155 CATGAGAGGGAGAACAGGGCGGG - Intergenic
1078161154 11:8840651-8840673 CTTGAGAGGGATGCTGTGGATGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078316398 11:10296510-10296532 CATGGGAGGGATCCGGTGGAAGG - Intergenic
1079015394 11:16864557-16864579 CATGGGAGGGACCCAGTGGAAGG + Intronic
1079669340 11:23147485-23147507 AATGAGAGGGAGACATGGGAGGG - Intergenic
1079750685 11:24192325-24192347 CATGAGAGGGACTCCGTGGGAGG - Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081291179 11:41327684-41327706 CATGGGAGGGACCCCGTGGGAGG + Intronic
1082687748 11:56260614-56260636 CATGGGAGGGAGGCTGTGGGGGG - Intergenic
1082706037 11:56496522-56496544 AGGGAGAGGGAGACCGTGGAAGG - Intergenic
1082706044 11:56496547-56496569 AGGAAGAGGGAGACCGTGGAGGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083437054 11:62649749-62649771 CATGAGAGGGTGGAGGTGGACGG + Exonic
1083506143 11:63159343-63159365 CATGGGAGGGAGCCTGTGGGAGG + Intronic
1083519230 11:63292319-63292341 CATGGGAGGGAGCCAGTGGGAGG - Intronic
1083904018 11:65658540-65658562 GTTGAGGGGGAGACCATGGAGGG - Intronic
1084021878 11:66422612-66422634 GCTGAGAGAGAGACAGTGGATGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085496827 11:76978041-76978063 CATGGGAGGGAGGCCGAGGCGGG + Intronic
1085906421 11:80769622-80769644 CATGGGAGGGACACTGTGGGAGG + Intergenic
1086111788 11:83207237-83207259 CATGGGAGGGACACAGTGGGAGG - Intronic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1086606630 11:88703593-88703615 CATGAGAGGGACCCGGTGGGAGG + Intronic
1086620769 11:88884661-88884683 CATGAGAGGGACCCAGTGGGAGG + Intronic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087862761 11:103182657-103182679 CATGCAAAGAAGACCGTGGAGGG + Intronic
1088367197 11:109052255-109052277 CATGGGAGGGAGTCCAGGGATGG - Intergenic
1088883443 11:113989419-113989441 CAAGAGAGGGAGACCCCGGGTGG - Intronic
1090227482 11:125080445-125080467 AAGGAGTGGGAGACCTTGGATGG - Intronic
1090667662 11:128925486-128925508 CATGAAAGGGAGAGGGTGGGAGG - Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090879384 11:130820401-130820423 AAGGACAGGGAGACCATGGATGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093162440 12:15764267-15764289 CATGAGAGGGACCCGGTGGGAGG - Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094181153 12:27593869-27593891 GATGGGAGGGAGAAAGTGGATGG + Intronic
1095188836 12:39232698-39232720 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1097018215 12:56002166-56002188 CAAGATAGGGAGACCCTGGGAGG - Exonic
1097142101 12:56910269-56910291 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098761722 12:74433801-74433823 CATGAGAGGGACATGATGGAAGG + Intergenic
1100774364 12:97958094-97958116 CAGGAGATGGAGACCTTGGCGGG + Intergenic
1100928988 12:99584873-99584895 CATGGGAGGGACCCAGTGGAAGG - Intronic
1101793282 12:107950184-107950206 GATGACAGGGAGCCCCTGGAAGG - Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102136627 12:110581541-110581563 CATGAGAGGGAGACTTAGAAAGG - Intronic
1102782412 12:115576539-115576561 AATGAAAGGAAGACAGTGGAGGG - Intergenic
1103045225 12:117730501-117730523 AGGGAGAGGGAGACCGTGGAAGG - Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1104170918 12:126279542-126279564 CATGAGAGGGACCCGGTGGGAGG + Intergenic
1104353530 12:128065687-128065709 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1105469232 13:20677167-20677189 GAGGAGAGGGAGACTCTGGAGGG - Intronic
1105633458 13:22194758-22194780 CAGGAGAGGGACCCTGTGGAAGG - Intergenic
1106475536 13:30095096-30095118 CATGGGAGGGACACTGTGGGAGG + Intergenic
1106771739 13:32967995-32968017 CATGTAAGGCAGACCCTGGAAGG + Intergenic
1107702455 13:43061643-43061665 CAAGAGAGGGAGAGTGTGGTGGG + Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1108705764 13:52984499-52984521 CATGGGAGGGAGCTGGTGGAAGG - Intergenic
1108770838 13:53698989-53699011 CAGGAGAGAGAGAGCGTGCAGGG - Intergenic
1108844396 13:54660145-54660167 CATGTGAGGGAGACTGAGGGAGG - Intergenic
1109174280 13:59135936-59135958 AATGAGAGAGAAACAGTGGAAGG - Intergenic
1109750647 13:66686175-66686197 CATGAGAGGGACCCAGTGGGAGG + Intronic
1109850398 13:68056070-68056092 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1109982256 13:69924116-69924138 CATGGGAGGGAGGCCAAGGAGGG + Intronic
1110695620 13:78484733-78484755 CATGAGAGGGACCCGGTGGAGGG + Intergenic
1110777953 13:79432320-79432342 CATGGGAGGGAGGCCAAGGAGGG + Intergenic
1110970352 13:81753815-81753837 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1111457596 13:88505457-88505479 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1111966382 13:94866291-94866313 CAGGAGCGGGAGAGCTTGGAGGG - Intergenic
1112020773 13:95369380-95369402 CAGGAGAGGGAGAGTGTGCAGGG + Intergenic
1112647814 13:101355060-101355082 CACGAGAGAGAGATAGTGGAGGG - Intronic
1112732161 13:102376454-102376476 GAGGAGAGGCAGACAGTGGAAGG - Intronic
1112900307 13:104350382-104350404 CATGAGAGGGACCCGGTGGGAGG - Intergenic
1113249355 13:108434509-108434531 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1113365733 13:109674125-109674147 CAGGAGAGAGAGAGCGTGCAGGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114330207 14:21629152-21629174 CAGGAGAGAGAGACAGTGAAGGG + Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114975972 14:28099914-28099936 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1115662724 14:35512830-35512852 AATGAGAAGGAGACCATGCAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115718309 14:36130305-36130327 CATGGGAGGGAGCCTGTGGGAGG + Intergenic
1115942895 14:38628590-38628612 CATGGGAGGGAACCAGTGGAAGG - Intergenic
1116589771 14:46757192-46757214 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1118331425 14:64818619-64818641 GAGGAGAGGGAGACAGAGGATGG + Intronic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1119327415 14:73769100-73769122 GATGCGAGGGAGACCCTGGGAGG - Intronic
1119377820 14:74208886-74208908 CATGGGAGGGAGCACGTGGTGGG + Intergenic
1119838711 14:77774242-77774264 CATGGGAGGGACCCCGTGGGAGG - Intergenic
1119917310 14:78413887-78413909 CATGAGAGGGACCCTGTGGGAGG + Intronic
1120255767 14:82117484-82117506 TATGAGAGGGAGATGGAGGAAGG + Intergenic
1120269652 14:82295624-82295646 CATGAGAGGGTGTCTCTGGATGG + Intergenic
1120432095 14:84432187-84432209 CAAGAGAATGAGACCGTAGATGG - Intergenic
1121318441 14:92975853-92975875 CATGGGAGGGAGCCGGTGGGAGG + Intronic
1122090857 14:99339260-99339282 CATGACAGGGACACTGGGGACGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1125231395 15:37461558-37461580 CATGGGAGGGACCCAGTGGAAGG - Intergenic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126824939 15:52539642-52539664 CATGAGAGGGACCCCATGGGAGG - Intergenic
1126990891 15:54374386-54374408 CATGAGAGGGAGGCCGGGGTGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127638820 15:60896186-60896208 CATGAGAGGGTGACCTGGCAAGG + Intronic
1128704187 15:69826740-69826762 CAAGAGAGAGATACCATGGACGG + Intergenic
1129479364 15:75810822-75810844 CAAGAGAGGGAGACTGTGCTGGG - Intergenic
1129791117 15:78341186-78341208 TTTGAGGAGGAGACCGTGGACGG + Exonic
1130060073 15:80563389-80563411 CATGGGAGGGAGACAGTGATGGG - Intronic
1130552076 15:84895636-84895658 CAGGAGAGGGAGGTTGTGGAGGG + Intronic
1130820625 15:87491355-87491377 CATGGGAGGGAGTCGGTGGGAGG + Intergenic
1131450366 15:92534510-92534532 CACGGGAGGGACCCCGTGGAAGG + Intergenic
1131921307 15:97331751-97331773 CATGGGAGGGAGTCAATGGAGGG + Intergenic
1132806143 16:1776028-1776050 CATGAGAGGGCGCCTGGGGACGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133509561 16:6444398-6444420 CATGGGAGGGAACCCGTGGGAGG + Intronic
1133693274 16:8236573-8236595 CATGAGAGGGACCCAGTGGACGG - Intergenic
1133704932 16:8345251-8345273 CATGAGAGGGATCCAGTGGGAGG + Intergenic
1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG + Intronic
1135079389 16:19421326-19421348 CATGAGAGGGACGCTGTGGGAGG + Intronic
1135693818 16:24568922-24568944 CATGAGATCTAGACCGTGAACGG - Exonic
1135866810 16:26110810-26110832 TGAGAGAGGGAGACAGTGGAAGG - Intronic
1135922554 16:26664120-26664142 CATGAGGAGGAGGCGGTGGAAGG + Intergenic
1135966392 16:27039296-27039318 CATGGGAGGGACCCAGTGGAAGG - Intergenic
1136111668 16:28067361-28067383 CATGAGCTGAAGACAGTGGATGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1138354588 16:56367140-56367162 CCTGAGTGAGAGCCCGTGGAAGG - Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1138895567 16:61199547-61199569 CATGAGAGGAAGCCAGTGGGAGG + Intergenic
1139342245 16:66275210-66275232 CAAGAGAGAGAGACAGTGAAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140939743 16:79710196-79710218 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1140991683 16:80219193-80219215 CATGAGAGGGACTCTGTGGGAGG + Intergenic
1141000490 16:80302932-80302954 CATGAGAGGGACCCCGTGGGAGG + Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1203142322 16_KI270728v1_random:1776257-1776279 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144588483 17:16503584-16503606 CAGGAGAGAGAGCCAGTGGAGGG + Intergenic
1144862652 17:18315201-18315223 CATGAGAAAGAGGCCTTGGATGG - Intergenic
1145394959 17:22487514-22487536 CATGAGAGGGAGAACTTCTAGGG - Intergenic
1145784047 17:27582711-27582733 GCTGAGAGGGTGTCCGTGGAAGG - Exonic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146319951 17:31839300-31839322 CATGAAAGGGACCCGGTGGAAGG + Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1148390671 17:47270119-47270141 CATGAGAGGGACTCAGTGGGAGG - Intronic
1148865109 17:50624252-50624274 GATGAGGGGGAGAGAGTGGAAGG + Intronic
1149109352 17:53008615-53008637 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1149190190 17:54051584-54051606 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1149292574 17:55231737-55231759 CATGAAAGGGAGTCCGGGGATGG - Intergenic
1149370087 17:55985355-55985377 CATGGGAGGGACACAGTGGAAGG - Intergenic
1149401886 17:56305245-56305267 CATGGGAGGGAGCCAGTGGGAGG - Intronic
1151432126 17:74070823-74070845 CAAGCTAGGGAGGCCGTGGAAGG - Intergenic
1151536508 17:74741914-74741936 CAGGAGAGGGAGACCGAAGTGGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152521028 17:80857157-80857179 CAGGGGAGGGAGGGCGTGGAGGG - Intronic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG + Intronic
1152795101 17:82302746-82302768 CCTGGGAGGGAGACTGGGGAGGG + Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153608132 18:6855021-6855043 CATGGGAGGGAGGCCGAGGTGGG + Intronic
1153690297 18:7585640-7585662 CATGAGAGGGAGATAGATGAGGG - Intronic
1156243730 18:35277434-35277456 CATGAGAGGGACCCAGTGGGAGG + Intronic
1156468507 18:37362795-37362817 GATGTGAGGGAGGCCCTGGAAGG - Intronic
1156613274 18:38752318-38752340 CATGAGGGGGAGAAAGTGTAGGG + Intergenic
1156621532 18:38857377-38857399 CATGAGAGGGACATGATGGAGGG - Intergenic
1156668843 18:39442733-39442755 CATGAGAGGGACACAGTGCGAGG + Intergenic
1158321990 18:56273620-56273642 CATGAGAGGGACTCAGTGGGAGG + Intergenic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1158812852 18:61057846-61057868 CATGAGAGGGGCTCCGTGGGAGG + Intergenic
1159286961 18:66366460-66366482 CATGGGAGGGACGCAGTGGAAGG + Intergenic
1159583680 18:70262490-70262512 CATGGGAGGGAGTCAGTGGGAGG + Intergenic
1159634665 18:70790091-70790113 CATGAGAGGGAGCTGGTGGAAGG - Intergenic
1159769007 18:72526824-72526846 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1160295365 18:77632405-77632427 CATGAAAGGGACCCAGTGGAAGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1164828049 19:31298691-31298713 CATGACATGGAGCCCATGGACGG - Intronic
1164904003 19:31952066-31952088 CATGGGAGGGACCCAGTGGAGGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168368500 19:55810885-55810907 CATGAGAGGGAAGCCCTTGAAGG - Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925572065 2:5323070-5323092 CATGAGAGGGAAAATGTGCACGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928044183 2:27910920-27910942 CATGGGAGGGACCCGGTGGAAGG + Intronic
928097749 2:28415005-28415027 TATGAGAGAGAGAACTTGGAGGG - Exonic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928609788 2:32981688-32981710 CATGAGAGGGACCTGGTGGAAGG + Intronic
929345908 2:40884541-40884563 CATGAGAGGGACCCGGTGGGAGG + Intergenic
929493018 2:42413860-42413882 CATGAGAGGGACCCAGTGGGAGG - Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930446706 2:51482536-51482558 CATGAGAGGGACCCAGTGGGAGG + Intergenic
931178850 2:59879848-59879870 AATGAGAGGGAGAGCGGGAAGGG + Intergenic
931818000 2:65923445-65923467 CATTTCAGGAAGACCGTGGATGG + Intergenic
933394099 2:81710314-81710336 CATGAGAGGGACCCAGTGGGAGG + Intergenic
933943800 2:87267078-87267100 CATGGGAGGGACACAGTGGCAGG + Intergenic
935245139 2:101212384-101212406 CATGGGAGGGACACAGTGGGAGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935800486 2:106690637-106690659 AATGAGAGGGAGCCAGTGGGAGG - Intergenic
936094874 2:109523839-109523861 TCTGAGAGGGAGACCGTCGCAGG - Intergenic
936336420 2:111594501-111594523 CATGGGAGGGACACAGTGGCAGG - Intergenic
936669403 2:114639343-114639365 CATGGGAGGGACCCAGTGGAAGG - Intronic
936956159 2:118024295-118024317 TATGAGAGGGACACGGTGGGAGG + Intergenic
937031688 2:118746048-118746070 CATGAGAGGGACACAGTGGGAGG - Intergenic
937266199 2:120616060-120616082 CCTGAGAAGGGGACCCTGGAGGG - Intergenic
937658481 2:124403991-124404013 CATGAGAGGGACCCAGTGGGAGG - Intronic
937836812 2:126479416-126479438 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
937903170 2:127038145-127038167 CATGAGGAGGAGAGTGTGGAGGG - Intergenic
938091649 2:128438431-128438453 TATGAGAGAGAGCCCGTGCACGG + Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938671372 2:133589508-133589530 CAGGAGAGAGAGACCCAGGATGG + Intergenic
939647990 2:144724781-144724803 CATGGGAGGGACACAGTGGGAGG - Intergenic
940322107 2:152388524-152388546 CATGGGAGGGACTCGGTGGAAGG - Intronic
940599743 2:155843975-155843997 CATGAGTGGGAGAGTGAGGAAGG + Intergenic
940621584 2:156120513-156120535 CATGAGAGGGACCCTGTGGGAGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941062947 2:160868782-160868804 TGTGAGAGGGAGACCATGAAAGG - Intergenic
941346031 2:164370833-164370855 CATGGGAGGGACCCCATGGAAGG + Intergenic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944289609 2:197990658-197990680 CATGGGAGGGACTCTGTGGAAGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
947070363 2:226281473-226281495 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
947379149 2:229528272-229528294 CATGAGAAGGTGACTGTTGACGG + Intronic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169492969 20:6086732-6086754 CAGGAGAGGGAGAGAGTGAAGGG - Intronic
1170614577 20:17938381-17938403 CATGGGAAGCAGGCCGTGGAAGG + Intergenic
1172396489 20:34609821-34609843 CATGAGAGGGACCCGGTGGGAGG + Intronic
1172997949 20:39084406-39084428 AAGGTGAGGAAGACCGTGGAGGG - Intergenic
1173207649 20:41007301-41007323 CATGGAAGGGAGACCAAGGAAGG - Intergenic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1174148035 20:48465791-48465813 CAGGAGAGGGAGACTTTGGGGGG + Intergenic
1174514323 20:51079820-51079842 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1174671947 20:52316631-52316653 GATGAGAGGGAAAAGGTGGAGGG + Intergenic
1174857957 20:54064622-54064644 CAGGAGAGCGAGACTGCGGAGGG - Intronic
1175730066 20:61348370-61348392 CATGGGAGGGACCCCGTGGGAGG - Intronic
1176975116 21:15312245-15312267 CAGGAGAGAGAGAGCGTGGAGGG - Intergenic
1177344681 21:19854079-19854101 CATGGGAGGGAGGCCGAGGTGGG - Intergenic
1177692449 21:24528975-24528997 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1177803376 21:25849608-25849630 CAGGAGAGAGAGACGGTGCAGGG - Intergenic
1178750404 21:35297230-35297252 CATGAAAGGGACAACATGGATGG - Intronic
1178873287 21:36393215-36393237 AGGGAGAGGGAGACGGTGGAGGG + Intronic
1178947344 21:36959357-36959379 GATGGGAGGGAGGCCGAGGAGGG + Intronic
1179811676 21:43875223-43875245 CACGGGAGGGAGGCCGAGGAGGG - Intronic
1180087221 21:45513183-45513205 CATGAGATGGGGGCCCTGGATGG - Exonic
1180100812 21:45584182-45584204 CATGTGAGCGAGAACTTGGATGG + Intergenic
1180729382 22:17970213-17970235 CATGGGCGGGGGACAGTGGAGGG - Intronic
1180854624 22:19038219-19038241 CCTGAGAAGGAGAGCTTGGAAGG - Exonic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181814770 22:25429785-25429807 CATGAAGGAGAGACCCTGGAAGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182891828 22:33825660-33825682 CATGGGAGGGACACAGTGGGAGG - Intronic
1182968023 22:34541313-34541335 CATGAGAGGGACCCCATGGGAGG - Intergenic
1183024997 22:35058370-35058392 CATGGGAGGGAAGCCGAGGAGGG - Intergenic
1183256967 22:36768727-36768749 CATGAGAGGGAAAATGGGGAGGG - Intronic
1183361445 22:37385141-37385163 CCTGAGAGGTAGCCCGGGGAGGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184891655 22:47383095-47383117 CATGGGAGGGATCCAGTGGAAGG + Intergenic
1184960707 22:47926449-47926471 CATGGGAGGGACCCCGTGGGAGG - Intergenic
1185133345 22:49053190-49053212 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
949836851 3:8279263-8279285 GAAAAGAGGGAGACCGTGTAAGG + Intergenic
949845086 3:8361741-8361763 TATGAGAGGGACCCCGTGGGAGG - Intergenic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
951068867 3:18301895-18301917 CATGAGAGGGAGCTGGTGGGAGG + Intronic
951580799 3:24160410-24160432 CAAGAGAGGGTGAACCTGGAGGG + Intronic
951737550 3:25884580-25884602 CATGAGAGGGACCCAGTGGGAGG - Intergenic
952029233 3:29120694-29120716 CATGGGAGGGACACAGTGGGAGG + Intergenic
952109539 3:30106731-30106753 CATGGGAGGGATCCAGTGGAAGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
956033160 3:65061310-65061332 AATGAGAGGGAGGCTGTGGTTGG + Intergenic
956102689 3:65784940-65784962 CTTGAGAGGGTGGCGGTGGAGGG + Intronic
957336047 3:78830667-78830689 CGTGGGAGGGAGCCAGTGGAAGG - Intronic
957430880 3:80104891-80104913 CATGGGAGGGACTCGGTGGAAGG + Intergenic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
957880007 3:86199961-86199983 CATGAGAGGGACCCAGTGAAAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959741994 3:109731133-109731155 CATGAGAGGGACACAGTGGGAGG - Intergenic
959809131 3:110594516-110594538 CATGGGAGGGACCCAGTGGAAGG + Intergenic
960499545 3:118419650-118419672 CATGAGAGGGAACCTGTGGGAGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960953232 3:123012992-123013014 CATGAGGAGGAGACAGTGTAAGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963627210 3:147688830-147688852 CATGGGAGGGACACTGTGGGAGG - Intergenic
963899477 3:150720365-150720387 CATGGGAGGGACACGGTGGGAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964972774 3:162581759-162581781 CATGAGAGGGACCCAGTGGGAGG + Intergenic
965302009 3:167017489-167017511 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302033 3:167017576-167017598 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302043 3:167017607-167017629 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302051 3:167017632-167017654 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302109 3:167017849-167017871 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302119 3:167017880-167017902 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302127 3:167017905-167017927 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
967607778 3:191468005-191468027 CATGGGAGGGACACAGTGGGAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
968892729 4:3379791-3379813 CATGGGAGGGAGTCAGTGGGAGG - Intronic
969544927 4:7819697-7819719 CGGGAGAGGGAGAACGTGGTAGG + Intronic
969641577 4:8402000-8402022 CATGAGGGGGCCACCGTGCATGG + Intronic
970107125 4:12597009-12597031 CATGGGAGGGACTCGGTGGAAGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970424228 4:15931666-15931688 CATGAGAGGGACCCAGTGGGAGG - Intergenic
970758008 4:19450132-19450154 CATGGGAGGGATCCAGTGGAAGG - Intergenic
970992015 4:22223549-22223571 TTAGAGAGGGAGACCGGGGAAGG - Intergenic
971068194 4:23059103-23059125 CGTGAGAGGGACACAGTGGGAGG - Intergenic
972198151 4:36679195-36679217 CAGGAGAGAGAGACCATGCAGGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972665442 4:41160650-41160672 GGTGAGAGGGAGACCAGGGAAGG - Intronic
973072825 4:45886247-45886269 CATGAGAGGGACCCGGTGGGAGG + Intergenic
973598164 4:52513633-52513655 CATGAGAGGGATCCAGTGGGAGG + Intergenic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG + Intergenic
975284869 4:72605976-72605998 CATGAGAGGGACCCAGTGGGAGG + Intergenic
975307223 4:72864270-72864292 CATGGGAGGGACCCAGTGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976108555 4:81645435-81645457 CATGGGAGGGACCCAGTGGAAGG - Intronic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
976836508 4:89380678-89380700 CATGGGAGGGACCCAGTGGAAGG - Intergenic
977053554 4:92161524-92161546 CATGGGAGGGACACAGTGGGAGG - Intergenic
977356546 4:95953737-95953759 TATGGGAGGGACACAGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979649007 4:123107740-123107762 CATGGGAGGGAGGCTGAGGAGGG - Intronic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982045394 4:151440226-151440248 CATGAGAGGGACCCAGTGGGAGG - Intronic
982252345 4:153419959-153419981 CATGAGAGGGACCCGGTGAAAGG - Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982723262 4:158881188-158881210 AGGGAGAGGGAGACCGTGGAGGG - Intronic
983079351 4:163366078-163366100 CAAGGGAGGGACACAGTGGAAGG + Intergenic
983164697 4:164460572-164460594 CATGAGAGGGACCCAGTGGGAGG + Intergenic
983580849 4:169308419-169308441 CATGGGAGGGACCCAGTGGAAGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983685818 4:170407592-170407614 CATGTAAGAGAGACCCTGGAAGG + Intergenic
984368342 4:178828106-178828128 CATGAGTGGTACACAGTGGAGGG - Intergenic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984804410 4:183737780-183737802 AGGGAGAGGGAGACCGTGGAGGG + Intergenic
986289839 5:6390903-6390925 CATGAGAGGGACTCGGTGGGAGG + Intergenic
986784793 5:11104457-11104479 CAAGAGTGGCAGACGGTGGATGG - Intronic
986828086 5:11543330-11543352 CATGTAAGGGAGACCCTGCAAGG + Intronic
987003920 5:13689505-13689527 CAGGAGAGAGAGAACGTGAAGGG - Intergenic
987024265 5:13908361-13908383 AAGGAGAGGGAGGCAGTGGAAGG - Intronic
988356849 5:30187675-30187697 CATGGGAGGGACACAGTGGAAGG + Intergenic
988362531 5:30254796-30254818 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
988685234 5:33519237-33519259 CATGAGAGGGACTCAGTGGGAGG + Intergenic
989425453 5:41290911-41290933 CATGGGAGGGAGACTGAGCAGGG - Intergenic
989545342 5:42665981-42666003 CATGAGAGGGAGCTGGTGGAAGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989787209 5:45346173-45346195 CATGGGAGGGACCCCGTGGGAGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991405159 5:66294159-66294181 CTTGAGCGGGAGCCCGTGGAAGG - Intergenic
993967337 5:94373667-94373689 CATGAGAGGGACCCAGTGGGAGG - Intronic
994057367 5:95433412-95433434 CATGAGAAGGACCCCGTGGGAGG - Intronic
994081947 5:95716783-95716805 CATGAGAGGGACCCAGTGGGAGG + Intronic
995283316 5:110358770-110358792 CATGAGAGGGACCCAGTGGGAGG + Intronic
995924455 5:117353891-117353913 CATGGGAGGGATCCAGTGGAAGG + Intergenic
996250917 5:121331006-121331028 CATGAGAGAGACACAGTGGGAGG + Intergenic
996699901 5:126439790-126439812 CATGGGAGGGAGCCAGTGGGAGG + Intronic
996967440 5:129322354-129322376 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
997148603 5:131466508-131466530 CATGGGAGGGAGCCAGTGGGAGG + Intronic
997321806 5:132983928-132983950 AGGGAGAGGGAGACCGTGGGGGG + Intergenic
997689468 5:135816077-135816099 CAGGAGAGAGAGAGCGTGCAGGG + Intergenic
998714940 5:144872440-144872462 CATGATGAGGAGACCGTAGAAGG + Intergenic
998754203 5:145358256-145358278 TATGAGAGGGAGGAGGTGGATGG + Intergenic
998875812 5:146597945-146597967 CATTAGAGAGAGACCGCTGAAGG - Intronic
999367254 5:151031217-151031239 CATGGGACGGACACCTTGGAGGG - Intronic
999792094 5:154950143-154950165 CAGGAGAGAGAGACAGTGCAGGG + Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000372896 5:160554273-160554295 TATGAGAGGGAGACAGAAGAAGG - Intergenic
1000498127 5:162011561-162011583 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1000659626 5:163921171-163921193 CATGGGAGGGAGCCCATGGTTGG + Intergenic
1000691031 5:164320955-164320977 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1001008495 5:168075968-168075990 CGTGGGAGGGAGACGGTGGGAGG - Intronic
1001603614 5:172944847-172944869 CTGGAGGGGGAGACCCTGGATGG - Intronic
1002600623 5:180352543-180352565 CACGAGAGGGAGTCCGGGGCGGG - Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1006766372 6:36510230-36510252 CATGAGAGGGAGGCCAAGCAGGG - Intronic
1007404424 6:41625838-41625860 CAAGAGAGGGGGACAGAGGAAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009243410 6:61205162-61205184 CATGGGAGGGAGACTGAGGGGGG - Intergenic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1010819283 6:80394830-80394852 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1010864150 6:80952735-80952757 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1011003901 6:82622519-82622541 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1013338526 6:109190569-109190591 CATGAGAGGGACTCGGTGGGAGG + Intergenic
1013338800 6:109192542-109192564 CATGGGAGGGACACAGTGGGAGG + Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1013715947 6:112961754-112961776 CAAGAGAGGGAGATAGTGAAGGG - Intergenic
1013769354 6:113610158-113610180 CATGAGAGGGACTCGGTGGGAGG + Intergenic
1014134125 6:117867746-117867768 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1014619432 6:123647437-123647459 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1014882944 6:126745777-126745799 CATGCGAGGGACCCAGTGGAAGG - Intergenic
1014987443 6:128029202-128029224 CAAGAGAGGGAGACAGGAGAGGG - Intronic
1017277371 6:152585017-152585039 CATGAGAGGGACCCGGTGGGAGG + Intronic
1017375712 6:153765742-153765764 GATGAGAGGGATAGCGTAGATGG - Intergenic
1018472931 6:164112401-164112423 CATGGGAGGGACTCTGTGGAAGG + Intergenic
1019379047 7:711975-711997 GATGAGGGTGAGACTGTGGATGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021136805 7:16974843-16974865 CATGGGAGGGACACCGTGGGAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1024413653 7:49078178-49078200 CATGGGAGAGAGCCGGTGGAAGG - Intergenic
1024826922 7:53401114-53401136 CATGAGAGGGACTCGGTGGAAGG - Intergenic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026502453 7:70954502-70954524 CATGGGAGTGACACCGTGGGAGG + Intergenic
1026538680 7:71261608-71261630 CGTGAAATGGAGACCCTGGAAGG + Intronic
1027797904 7:82716658-82716680 CATGGGAGGGACCCAGTGGAAGG - Intergenic
1028023543 7:85807953-85807975 CATGAAAGGGACTCAGTGGAAGG + Intergenic
1028527452 7:91801530-91801552 CATGGGAGGGAGGCCAAGGAGGG - Intronic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1031064997 7:117095228-117095250 CATGAGAGCCAGAACGTGGCTGG + Intronic
1031298683 7:120038120-120038142 CATGGGAGGGACACAGTGTAAGG - Intergenic
1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1031654228 7:124332412-124332434 CATGAGAGGGACTCGGTGGGAGG + Intergenic
1031720163 7:125164657-125164679 CATGCGAGGGAGATCATGGCAGG + Intergenic
1031772768 7:125865959-125865981 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1031788441 7:126065960-126065982 CATGGGAGGGACCCCGTGGGAGG - Intergenic
1031837070 7:126691167-126691189 CATGAGAGGGAGGCCAAGAAGGG - Intronic
1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG + Intronic
1032529329 7:132607314-132607336 CAGGAGGGGGAGAAGGTGGAAGG - Intronic
1032560212 7:132883027-132883049 CAGGAGAGAGAGAGCGTGCAGGG - Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033256313 7:139804617-139804639 CATGGGAGGGACACAGTGGGAGG + Intronic
1033281898 7:140012069-140012091 CAGGAGTGGGAGCCCGTGTACGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033792475 7:144807403-144807425 CATGGGAGGGACACAGTGGGAGG - Intronic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034974316 7:155439063-155439085 CCAGATAAGGAGACCGTGGAGGG + Intergenic
1035117579 7:156537403-156537425 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1035734794 8:1880334-1880356 CGTAAGAGGGAGACAGTGAAAGG - Intronic
1035834942 8:2740040-2740062 CATGGGAGGGATCCAGTGGAAGG + Intergenic
1036095408 8:5718793-5718815 CATGGGAGGGACACAGTGGGAGG - Intergenic
1036434457 8:8720525-8720547 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1037263552 8:17034974-17034996 CATGAGAGGGACCCAGTGGGAGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038745648 8:30252572-30252594 CATGAGAGGGAGGCCCTTGCTGG + Intergenic
1038813494 8:30876835-30876857 CATGGGAGGGACCCAGTGGAAGG + Intronic
1038980364 8:32752690-32752712 AATGACAGAGAGACCGAGGAAGG - Intronic
1039365364 8:36923075-36923097 CATGAGAGGAGGAACATGGAGGG - Intronic
1039526888 8:38225088-38225110 CATGAGAGGGACTCGGTGGGAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1042060810 8:64815350-64815372 AATGTGAGGGAGAACTTGGAGGG - Intergenic
1042193452 8:66211506-66211528 CATGGGAGGGAGCCGGTGGGAGG - Intergenic
1042608974 8:70577169-70577191 CACGAGAGGGAGGCCGAGGGGGG + Intronic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1043781792 8:84345625-84345647 AATGAGAGGGAGATGCTGGAGGG - Intronic
1043801054 8:84610028-84610050 CATGAGAGGGATCCAGTGGGAGG - Intronic
1044945726 8:97387116-97387138 CATGTGAGAGAGACAGTGGTAGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046391341 8:113576840-113576862 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1046552254 8:115731643-115731665 CATGAGAGGGACCCAGTGGGAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047001232 8:120574802-120574824 AATGAGATGGAGACCCAGGAAGG + Intronic
1047056760 8:121173718-121173740 CATGAGAGGGAACCCGTGGGAGG - Intergenic
1048189168 8:132272745-132272767 CATGGGAGGGACCCAGTGGAAGG - Intronic
1048633382 8:136268765-136268787 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
1049613537 8:143566881-143566903 CATGAGGTGGAGACCCAGGAGGG + Exonic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1049658408 8:143808964-143808986 GATGACAGGGAGATCGAGGAGGG - Exonic
1050142184 9:2527579-2527601 CATGGGAGGGACCCGGTGGAAGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051089189 9:13386006-13386028 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1052552596 9:29970025-29970047 CATGGGAGGGAGACCGAAGGTGG - Intergenic
1053665980 9:40317925-40317947 GATGGGAGGGGGACCGGGGATGG + Intronic
1053915561 9:42942970-42942992 GATGGGAGGGGGACCGGGGATGG + Intergenic
1054518630 9:66058358-66058380 GATGGGAGGGGGACCGGGGATGG - Intergenic
1056486078 9:87059214-87059236 CATGGGAGGGACCCAGTGGAAGG + Intergenic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057262032 9:93590403-93590425 CAGGAGTGGGAGAGAGTGGAAGG - Intronic
1058456641 9:105143725-105143747 CATGAGAGGAAGCCGATGGAAGG - Intergenic
1059716939 9:116921855-116921877 CAAGAGAGGGACCCAGTGGAAGG - Intronic
1059913874 9:119077128-119077150 CATGGGAGGGAAATAGTGGAGGG - Intergenic
1061436040 9:130562816-130562838 CATGAGAGGGAACCGGTGGGAGG - Intergenic
1062438626 9:136558602-136558624 CAGGAGAGGGAGACAGCGAAGGG - Intergenic
1185550147 X:976479-976501 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1185820549 X:3198843-3198865 CATGGGAGGGAGCTGGTGGAAGG + Intergenic
1185882172 X:3751211-3751233 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1186053534 X:5625497-5625519 CATGGGAGGGACCCGGTGGAAGG - Intergenic
1186174108 X:6907093-6907115 AATGGGAGGGAGACGGTGGGAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189120971 X:38394639-38394661 CATTAAAGGGAGGCCATGGAGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192057196 X:67785037-67785059 CATGAGAGTGAGAAAGTGGCAGG - Intergenic
1194713379 X:97262467-97262489 CAAGTGAGGGAGAACGTAGAAGG + Intronic
1194756441 X:97744171-97744193 CATGGGAGGGACACTGTGGAAGG + Intergenic
1194778070 X:97990560-97990582 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1197861709 X:130978094-130978116 CATGAGAGGGAAAACCTGAAGGG - Intergenic
1198825785 X:140696574-140696596 CATGGGAGGGACCCAGTGGAAGG - Intergenic
1199982438 X:152928374-152928396 CAGGGGTGGGAGACCGGGGAAGG + Intronic
1200212356 X:154352372-154352394 CATGAGGCCGAGATCGTGGAAGG - Exonic
1201629559 Y:16055099-16055121 CATGAGAGGGACACAGTGAGAGG - Intergenic
1201668537 Y:16488583-16488605 CATGGGAGGGACACAGTGGGAGG - Intergenic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic