ID: 1116847758

View in Genome Browser
Species Human (GRCh38)
Location 14:49880652-49880674
Sequence CAGAAGTACAAGTCACAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116847758_1116847767 22 Left 1116847758 14:49880652-49880674 CCAAGTTGTGACTTGTACTTCTG No data
Right 1116847767 14:49880697-49880719 GCTCCCATGACTCCCTCCTGGGG No data
1116847758_1116847762 0 Left 1116847758 14:49880652-49880674 CCAAGTTGTGACTTGTACTTCTG No data
Right 1116847762 14:49880675-49880697 ACCCACTGGCTATAAATCAGGGG No data
1116847758_1116847766 21 Left 1116847758 14:49880652-49880674 CCAAGTTGTGACTTGTACTTCTG No data
Right 1116847766 14:49880696-49880718 GGCTCCCATGACTCCCTCCTGGG No data
1116847758_1116847761 -1 Left 1116847758 14:49880652-49880674 CCAAGTTGTGACTTGTACTTCTG No data
Right 1116847761 14:49880674-49880696 GACCCACTGGCTATAAATCAGGG No data
1116847758_1116847760 -2 Left 1116847758 14:49880652-49880674 CCAAGTTGTGACTTGTACTTCTG No data
Right 1116847760 14:49880673-49880695 TGACCCACTGGCTATAAATCAGG No data
1116847758_1116847765 20 Left 1116847758 14:49880652-49880674 CCAAGTTGTGACTTGTACTTCTG No data
Right 1116847765 14:49880695-49880717 GGGCTCCCATGACTCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116847758 Original CRISPR CAGAAGTACAAGTCACAACT TGG (reversed) Intergenic
No off target data available for this crispr