ID: 1116847760

View in Genome Browser
Species Human (GRCh38)
Location 14:49880673-49880695
Sequence TGACCCACTGGCTATAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116847757_1116847760 23 Left 1116847757 14:49880627-49880649 CCAGTTCAGAAGTCAGTCTCAAA No data
Right 1116847760 14:49880673-49880695 TGACCCACTGGCTATAAATCAGG No data
1116847756_1116847760 24 Left 1116847756 14:49880626-49880648 CCCAGTTCAGAAGTCAGTCTCAA No data
Right 1116847760 14:49880673-49880695 TGACCCACTGGCTATAAATCAGG No data
1116847758_1116847760 -2 Left 1116847758 14:49880652-49880674 CCAAGTTGTGACTTGTACTTCTG No data
Right 1116847760 14:49880673-49880695 TGACCCACTGGCTATAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116847760 Original CRISPR TGACCCACTGGCTATAAATC AGG Intergenic
No off target data available for this crispr