ID: 1116847767

View in Genome Browser
Species Human (GRCh38)
Location 14:49880697-49880719
Sequence GCTCCCATGACTCCCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116847763_1116847767 -2 Left 1116847763 14:49880676-49880698 CCCACTGGCTATAAATCAGGGGC No data
Right 1116847767 14:49880697-49880719 GCTCCCATGACTCCCTCCTGGGG No data
1116847764_1116847767 -3 Left 1116847764 14:49880677-49880699 CCACTGGCTATAAATCAGGGGCT No data
Right 1116847767 14:49880697-49880719 GCTCCCATGACTCCCTCCTGGGG No data
1116847758_1116847767 22 Left 1116847758 14:49880652-49880674 CCAAGTTGTGACTTGTACTTCTG No data
Right 1116847767 14:49880697-49880719 GCTCCCATGACTCCCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116847767 Original CRISPR GCTCCCATGACTCCCTCCTG GGG Intergenic
No off target data available for this crispr