ID: 1116849966

View in Genome Browser
Species Human (GRCh38)
Location 14:49898855-49898877
Sequence GCACAGTCCCTATAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116849966_1116849969 3 Left 1116849966 14:49898855-49898877 CCTGTTTTTTATAGGGACTGTGC No data
Right 1116849969 14:49898881-49898903 AATGGGTGTTACATTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116849966 Original CRISPR GCACAGTCCCTATAAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr