ID: 1116854659

View in Genome Browser
Species Human (GRCh38)
Location 14:49941432-49941454
Sequence TTGTATGTCCATGCATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116854659_1116854663 29 Left 1116854659 14:49941432-49941454 CCCTCCAATGCATGGACATACAA No data
Right 1116854663 14:49941484-49941506 AACCTTTACAAGATGCATTCTGG No data
1116854659_1116854664 30 Left 1116854659 14:49941432-49941454 CCCTCCAATGCATGGACATACAA No data
Right 1116854664 14:49941485-49941507 ACCTTTACAAGATGCATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116854659 Original CRISPR TTGTATGTCCATGCATTGGA GGG (reversed) Intergenic
No off target data available for this crispr