ID: 1116854663

View in Genome Browser
Species Human (GRCh38)
Location 14:49941484-49941506
Sequence AACCTTTACAAGATGCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116854659_1116854663 29 Left 1116854659 14:49941432-49941454 CCCTCCAATGCATGGACATACAA No data
Right 1116854663 14:49941484-49941506 AACCTTTACAAGATGCATTCTGG No data
1116854660_1116854663 28 Left 1116854660 14:49941433-49941455 CCTCCAATGCATGGACATACAAG No data
Right 1116854663 14:49941484-49941506 AACCTTTACAAGATGCATTCTGG No data
1116854661_1116854663 25 Left 1116854661 14:49941436-49941458 CCAATGCATGGACATACAAGCAT No data
Right 1116854663 14:49941484-49941506 AACCTTTACAAGATGCATTCTGG No data
1116854662_1116854663 -7 Left 1116854662 14:49941468-49941490 CCATCAACACACATATAACCTTT No data
Right 1116854663 14:49941484-49941506 AACCTTTACAAGATGCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116854663 Original CRISPR AACCTTTACAAGATGCATTC TGG Intergenic
No off target data available for this crispr