ID: 1116856975

View in Genome Browser
Species Human (GRCh38)
Location 14:49961172-49961194
Sequence CTGTATTTTCAGAGAAGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116856962_1116856975 18 Left 1116856962 14:49961131-49961153 CCAGGCCCAGTCCCCAGGTCCTG No data
Right 1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG No data
1116856969_1116856975 -1 Left 1116856969 14:49961150-49961172 CCTGGTGCTGTATGTTCCCTTAC No data
Right 1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG No data
1116856964_1116856975 13 Left 1116856964 14:49961136-49961158 CCCAGTCCCCAGGTCCTGGTGCT No data
Right 1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG No data
1116856966_1116856975 7 Left 1116856966 14:49961142-49961164 CCCCAGGTCCTGGTGCTGTATGT No data
Right 1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG No data
1116856967_1116856975 6 Left 1116856967 14:49961143-49961165 CCCAGGTCCTGGTGCTGTATGTT No data
Right 1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG No data
1116856968_1116856975 5 Left 1116856968 14:49961144-49961166 CCAGGTCCTGGTGCTGTATGTTC No data
Right 1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG No data
1116856965_1116856975 12 Left 1116856965 14:49961137-49961159 CCAGTCCCCAGGTCCTGGTGCTG No data
Right 1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116856975 Original CRISPR CTGTATTTTCAGAGAAGGCG GGG Intergenic
No off target data available for this crispr