ID: 1116862103

View in Genome Browser
Species Human (GRCh38)
Location 14:50003231-50003253
Sequence CCGCACTTGCCCGTTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116862103_1116862112 24 Left 1116862103 14:50003231-50003253 CCCATGGCAACGGGCAAGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1116862112 14:50003278-50003300 CACAAAACAGGGGTGGCTCACGG 0: 1
1: 0
2: 0
3: 8
4: 146
1116862103_1116862110 14 Left 1116862103 14:50003231-50003253 CCCATGGCAACGGGCAAGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1116862110 14:50003268-50003290 GTGTGTGTTTCACAAAACAGGGG 0: 1
1: 1
2: 1
3: 23
4: 223
1116862103_1116862109 13 Left 1116862103 14:50003231-50003253 CCCATGGCAACGGGCAAGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1116862109 14:50003267-50003289 AGTGTGTGTTTCACAAAACAGGG 0: 1
1: 0
2: 1
3: 28
4: 262
1116862103_1116862111 17 Left 1116862103 14:50003231-50003253 CCCATGGCAACGGGCAAGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1116862111 14:50003271-50003293 TGTGTTTCACAAAACAGGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 185
1116862103_1116862108 12 Left 1116862103 14:50003231-50003253 CCCATGGCAACGGGCAAGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1116862108 14:50003266-50003288 GAGTGTGTGTTTCACAAAACAGG 0: 1
1: 0
2: 5
3: 25
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116862103 Original CRISPR CCGCACTTGCCCGTTGCCAT GGG (reversed) Intronic
916056615 1:161072893-161072915 CCTGACTTGCCCTTTGCCCTTGG - Intronic
922740823 1:228013442-228013464 ACGCACTTGCCAGTTTCCCTGGG - Intronic
924110567 1:240695532-240695554 CCTCACTTGGCCACTGCCATTGG + Intergenic
1072926601 10:99621427-99621449 CCGCACTTCCCTGCTGCCTTTGG - Intergenic
1076738449 10:132468884-132468906 CAGCACTGGCCCCTTGCCCTGGG + Intergenic
1090803879 11:130190535-130190557 CCGCTCATGCCCGCTGCCAGTGG + Exonic
1091863774 12:3811505-3811527 CCCCACTTTCCAGTTGCCTTAGG - Exonic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1120008914 14:79390957-79390979 CCTCTCTTGCCCTTTGCCTTTGG + Intronic
1141488495 16:84356288-84356310 TCGCACTTGCCGGTTGCCTGGGG + Intergenic
1146908483 17:36632947-36632969 CCGCACTTACCCTTTGCTCTAGG - Intergenic
1147793756 17:43028535-43028557 CCTCCCTTGGCCGTGGCCATAGG + Exonic
1150987652 17:70216296-70216318 CCAGACTTGCCTGTTGACATAGG + Intergenic
1152294157 17:79456926-79456948 CAGCACCTGCCCATTCCCATGGG + Intronic
925922082 2:8645042-8645064 CCTCACTGGCCCGGTGCCCTGGG + Intergenic
926307192 2:11646846-11646868 CCTCACTTACCCTTTGCCATGGG - Intergenic
926808481 2:16735198-16735220 GCTCACTTGCCGGTTTCCATAGG - Intergenic
932219670 2:69989945-69989967 CAGCACATGGCCCTTGCCATGGG + Intergenic
939218394 2:139270706-139270728 CCTCACTTGGCAGGTGCCATTGG + Intergenic
940749872 2:157613053-157613075 CCCCACTAGACTGTTGCCATGGG - Intronic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
957884981 3:86275226-86275248 CCGAACTTGCTCATTTCCATGGG + Intergenic
966920398 3:184607458-184607480 CCGCACTTCCCCCGTCCCATAGG + Intronic
969843040 4:9897578-9897600 CCACACTTTCCCTTTTCCATTGG - Intronic
975622141 4:76306496-76306518 CCGGCCTTGCCAGTTGCCAGCGG - Intronic
978274157 4:106928840-106928862 CTGCAGTTGCCAGTTGCCATTGG + Intronic
982442026 4:155447674-155447696 CCCCACTTGGCTTTTGCCATGGG - Intergenic
984844696 4:184099506-184099528 CCGCAGATGCCCCTGGCCATGGG + Intronic
990652627 5:57919220-57919242 CTGCAATTGCCTATTGCCATAGG + Intergenic
991032157 5:62094077-62094099 CCACACTCTCCTGTTGCCATGGG + Intergenic
999062789 5:148654052-148654074 CCGCACATACCCGCTGCCAGAGG + Exonic
999135227 5:149314219-149314241 CCTCACTTAGCCTTTGCCATTGG + Intronic
1002394284 5:178941172-178941194 CTGCGCTTGCGCGTTGCCCTGGG - Exonic
1018849939 6:167579686-167579708 CTGCGCTGACCCGTTGCCATTGG + Intergenic
1021436622 7:20624862-20624884 CCGCCCTTGGCCTTTGCCAAAGG + Intronic
1022171635 7:27837421-27837443 CCACATTTCCCCGTTCCCATGGG + Intronic
1032189385 7:129755069-129755091 CTGCACTGGTCCGTTGCCCTGGG - Exonic
1032345339 7:131110944-131110966 CCTCCCTTGCCCTTTGCCACAGG + Intronic
1035332852 7:158107586-158107608 CCCTACTTGCCTGTTTCCATGGG + Intronic
1048060075 8:130909857-130909879 CCGCACATACCTGTTGACATAGG + Exonic
1053052292 9:34971914-34971936 CCCCTCTTCCCCGCTGCCATGGG + Intronic
1053524451 9:38814567-38814589 TTGCACTTGTCTGTTGCCATTGG + Intergenic
1054196686 9:62038976-62038998 TTGCACTTGTCTGTTGCCATTGG + Intergenic
1054641719 9:67549709-67549731 TTGCACTTGTCTGTTGCCATTGG - Intergenic
1060541635 9:124434599-124434621 CCCCTCTTACCTGTTGCCATGGG + Intergenic
1197907688 X:131443705-131443727 CTCCACTTGCCTGTTGCCACAGG + Intergenic