ID: 1116862108

View in Genome Browser
Species Human (GRCh38)
Location 14:50003266-50003288
Sequence GAGTGTGTGTTTCACAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116862105_1116862108 11 Left 1116862105 14:50003232-50003254 CCATGGCAACGGGCAAGTGCGGC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1116862108 14:50003266-50003288 GAGTGTGTGTTTCACAAAACAGG 0: 1
1: 0
2: 5
3: 25
4: 197
1116862103_1116862108 12 Left 1116862103 14:50003231-50003253 CCCATGGCAACGGGCAAGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1116862108 14:50003266-50003288 GAGTGTGTGTTTCACAAAACAGG 0: 1
1: 0
2: 5
3: 25
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116862108 Original CRISPR GAGTGTGTGTTTCACAAAAC AGG Intronic
903669269 1:25025852-25025874 GCGTCTGTGTTTCAGAAGACGGG - Intergenic
907961614 1:59288741-59288763 GAGTGTGTGATCAATAAAACAGG + Intergenic
909251273 1:73359552-73359574 GAATGTGTGTTTCTCACAACTGG + Intergenic
909346778 1:74598764-74598786 GAGTGGGTGTATCACAAAACAGG + Intronic
910000894 1:82340925-82340947 GAGTGTGTGCTGCACAAATATGG + Intergenic
910633710 1:89383849-89383871 GAGTGTGTGTTCCACAGAAGAGG - Intronic
910796280 1:91100617-91100639 GACTGTGGATTCCACAAAACAGG + Intergenic
912168362 1:107067485-107067507 GAGTGGGTGTATCACAAAACAGG - Intergenic
912305951 1:108567598-108567620 GAATGTCAGTTTCAGAAAACTGG + Intronic
917139119 1:171817136-171817158 GTGTGTGTGTTTTACAAATGAGG - Intergenic
918044346 1:180932578-180932600 GAATGTGAGTTCCAGAAAACAGG + Intronic
918160724 1:181896593-181896615 GAGTGTGAGTTTCAAAAATTTGG - Intergenic
920346624 1:205309959-205309981 GAGTGGCTGGTTCACCAAACTGG + Intronic
920941853 1:210491035-210491057 GTGTGTGTGTCTCACAAAAATGG - Intronic
923381926 1:233429100-233429122 GTGTGTGTGTGTCTCAAAACTGG - Intergenic
923795061 1:237145705-237145727 GAGGGTCTGTTTCAAAAAACTGG - Intronic
924233166 1:241979059-241979081 GATTTTGTCTTCCACAAAACTGG - Intergenic
1064238298 10:13598757-13598779 AAGTGTGTGTTAGACAACACTGG - Intronic
1066972997 10:42333189-42333211 GAGACTGTGTTTCACTATACTGG - Intergenic
1068549933 10:58395482-58395504 GTGTGTGTTTTTCATAAAGCAGG + Exonic
1069191599 10:65498076-65498098 GAGTGTCTGTCCCATAAAACAGG + Intergenic
1069293625 10:66815239-66815261 GAGTGTGTGTTCTAGAAAAACGG + Intronic
1069663053 10:70136559-70136581 GTGTGTGTGTTTGAAGAAACAGG + Intergenic
1071907897 10:90195229-90195251 GTGTGTGTGTAACACAAAACTGG - Intergenic
1072294524 10:93996139-93996161 GCGTGTGTGTTCCACACACCTGG + Intronic
1074339067 10:112608128-112608150 GAGTGTCTGTGTCACAGAAAGGG - Intronic
1076586236 10:131549628-131549650 AAGTGTGTGTGTCATAAAATAGG + Intergenic
1077627102 11:3782127-3782149 GAGTCTTTGTTTCAGAAAGCTGG + Exonic
1077760366 11:5089017-5089039 CATTGTGTCTTTAACAAAACTGG + Intergenic
1078194584 11:9124914-9124936 CAGTGAGTGATTCACAAAAGGGG + Intronic
1079399142 11:20091716-20091738 GAGTCAGTGTTTCACAAAGGAGG + Intronic
1080321159 11:31011183-31011205 GTGTGTGTGTTTAAGATAACGGG - Intronic
1080701659 11:34649479-34649501 GGGTGTGTGTTTCACAAAAAGGG + Intronic
1080753956 11:35177572-35177594 GAGTGTGTGTTGCAGAGAAAGGG - Intronic
1080804619 11:35641149-35641171 GAATTTGAGTTTAACAAAACTGG - Intergenic
1082932168 11:58619499-58619521 CAGTTTGTGTTTCACAAACATGG + Exonic
1083987863 11:66228672-66228694 GTTTGTGAGTTTCACAGAACTGG - Intronic
1087812080 11:102619339-102619361 TAGTTTTTGTTTCACAAAATAGG + Intronic
1088630386 11:111768666-111768688 GTGTGTGTGTTTAACAAACAGGG + Intergenic
1089345152 11:117786333-117786355 GATGCTGTGTTTCATAAAACAGG + Intronic
1090041554 11:123296773-123296795 CAGTCTGTGTTTCACAACACAGG - Intergenic
1093796159 12:23314775-23314797 GAGGGTGTGTTTAACACAAAAGG + Intergenic
1095236087 12:39797715-39797737 GTGTGTGTGTTTACCATAACTGG - Intronic
1095578716 12:43769934-43769956 GTGTGTGTGTTTTAGAATACGGG - Intronic
1098133580 12:67377658-67377680 GAGTGGGTGTGTCCCACAACTGG - Intergenic
1099454030 12:82842997-82843019 CAGTGTGTGTGGCACATAACAGG + Intronic
1099955918 12:89352621-89352643 GAGTTTGTCATTCACAAAAACGG + Exonic
1100196073 12:92246472-92246494 GTGTGTGTGTTTTCAAAAACAGG + Intergenic
1106139783 13:27002495-27002517 GCCTGTGTGTTTCAAATAACAGG - Intergenic
1111586156 13:90287503-90287525 GAGTGTGTTTCTCACAAACCTGG + Intergenic
1111593973 13:90388131-90388153 GGGTGTGTCTTTCACAGAACAGG - Intergenic
1111969410 13:94895530-94895552 TAGTGTCTGTTTCACAAACAAGG + Intergenic
1112418425 13:99225618-99225640 GAGTGTTTGTTAAACAAAAGGGG - Intronic
1113469567 13:110534703-110534725 GAGTGTGAACTCCACAAAACTGG + Intronic
1115881881 14:37928498-37928520 GAGTGTGTGTTTCTGCACACAGG + Intronic
1116106557 14:40514751-40514773 GAGTCTCTGTTTCATAATACAGG + Intergenic
1116438942 14:44928942-44928964 GCTTGTGGGTTTCAGAAAACTGG + Exonic
1116618546 14:47169918-47169940 GAGTGTGTCTTTGACAATATAGG - Intronic
1116862108 14:50003266-50003288 GAGTGTGTGTTTCACAAAACAGG + Intronic
1116980282 14:51162560-51162582 AATTGTGTTTTTGACAAAACGGG + Intergenic
1117493376 14:56275298-56275320 GAAATTGTTTTTCACAAAACTGG - Intronic
1119130285 14:72166083-72166105 GTGTGTGTGTGTCTCAAAAATGG - Intronic
1120994869 14:90409444-90409466 GTGTGTGTGTTTTTCTAAACCGG - Intergenic
1121242984 14:92443157-92443179 CAGTGTGTGTTTCACAGCAGAGG - Intronic
1121458961 14:94058831-94058853 GACTGTGTGGTTCACAAAGCTGG - Intronic
1124986123 15:34617119-34617141 AAGTATGTGTTTTAAAAAACAGG - Intergenic
1125283007 15:38063136-38063158 AAGTCTGTATTTCATAAAACTGG + Intergenic
1128392333 15:67190673-67190695 GCTCGTGTGTTTCAGAAAACAGG - Exonic
1128731315 15:70023471-70023493 GTGTGTGTGTGTCACAATAGAGG - Intergenic
1129250034 15:74303655-74303677 GAGTGTGTGCTGCACAGAACAGG - Intronic
1129700770 15:77767447-77767469 GAGGGTGTGCTTCACAAAATGGG + Intronic
1130037040 15:80370317-80370339 GAGGGTTTTTTTCCCAAAACGGG - Intronic
1132150404 15:99454600-99454622 GAGTGTGCGCTGCACAAATCCGG + Intergenic
1133451730 16:5909694-5909716 GAGTGGCTGATTCACCAAACTGG + Intergenic
1138226933 16:55303956-55303978 GTGTCTGTGGTTCTCAAAACTGG - Intergenic
1138383554 16:56620313-56620335 AAGTGTGTGATTCACACAATGGG - Intergenic
1138793594 16:59939864-59939886 GTGTGTGTGTGTCACATGACTGG + Intergenic
1139048538 16:63094573-63094595 GGAGGTGTGTTTAACAAAACAGG - Intergenic
1139219645 16:65168134-65168156 GTGTGTGTGTTTCCCTAAAGAGG + Intergenic
1139253959 16:65522814-65522836 CAATGTGTGGGTCACAAAACTGG - Intergenic
1139529835 16:67537670-67537692 GAGTGTGTGTTTCGCCGAAGCGG + Intronic
1139795957 16:69483038-69483060 GTGTGTGTGTTTTAGAGAACTGG - Intergenic
1141394733 16:83694618-83694640 GAGTGTCTCTGTCACAAAGCAGG + Intronic
1142483902 17:234676-234698 GAGTGTGTGTTGTACACACCGGG - Intronic
1143489977 17:7280756-7280778 GAGTGTCTGGCTCAGAAAACGGG - Intergenic
1146542437 17:33709049-33709071 GAATGTGTTGTTCAAAAAACAGG - Intronic
1147725236 17:42562711-42562733 GAGTGTGTGATTCACCAGCCGGG - Exonic
1151795314 17:76340931-76340953 GGGACTGTCTTTCACAAAACTGG + Intronic
1152045141 17:77930483-77930505 GATTGTTTATTTCACAAAAAGGG - Intergenic
1152186775 17:78862034-78862056 GAGTCTGGGTTACAGAAAACCGG + Intronic
1152860479 17:82693747-82693769 GAGAGTCTCTTTCACATAACGGG + Intronic
1153263935 18:3249558-3249580 GAGTGTCTGTTGTACGAAACTGG - Intronic
1154263790 18:12861776-12861798 GTGTGTGTGTATCACAGAAGTGG - Intronic
1157108972 18:44801608-44801630 GTGTGTGTGTTTCTCAACATTGG + Intronic
1157322459 18:46645173-46645195 GCCTGTGGGTTTCAGAAAACTGG + Intronic
1158202388 18:54955317-54955339 GTGTGTGTGTTTTTCAAGACGGG - Intronic
1159170464 18:64759527-64759549 GACTGTGTATTTCAGAGAACTGG - Intergenic
1159216620 18:65400202-65400224 GATTGTGAGTTTAACAAAAAAGG + Intergenic
1161742019 19:6027191-6027213 GAGTGTGTATTTCAGAGAGCAGG + Intronic
1161974988 19:7603520-7603542 GTGTGTGTGTTTGAAAGAACGGG - Intronic
1163911375 19:20197101-20197123 GAGTGTAAGTTACACAAAAGAGG + Exonic
1163961230 19:20695363-20695385 GAGTGTGAGGTGCACAAAAGAGG + Intronic
1164748694 19:30635408-30635430 GAGTGTGCAATTCACAGAACTGG + Intronic
1167909769 19:52691985-52692007 AAGTGTGAGTTTCACAACATGGG + Intergenic
925098460 2:1226291-1226313 CAATGTGTGTTTCTCAAAAACGG + Intronic
926044137 2:9697271-9697293 GAGACTCTGTTTCAAAAAACAGG + Intergenic
926438570 2:12862560-12862582 GAGTGTGTATTACACAAAACTGG - Intergenic
927190918 2:20516386-20516408 GAGTCTGTGATTCTAAAAACAGG + Intergenic
931003735 2:57822778-57822800 GACAGTGTCTTTCACAAAATAGG - Intergenic
931331017 2:61283613-61283635 GTGTGTGTGTTTTAAAAGACAGG + Intronic
932971872 2:76553505-76553527 GAGTAGGTATTTCACAAAAGAGG + Intergenic
933442196 2:82327076-82327098 GAGTGTGTGTTTAATAAGAAAGG - Intergenic
935426754 2:102927581-102927603 GAATGTGTGTTTCATTAGACCGG - Intergenic
935658761 2:105447667-105447689 GAGTGGGTGTTTCATGAAGCAGG + Intergenic
936269861 2:111041380-111041402 CAGTGTTTGTTTCCCAAAATTGG + Intronic
937161567 2:119767402-119767424 TAGTGTGTATTTAGCAAAACAGG + Intronic
939062237 2:137436424-137436446 AATTGTGTGTATGACAAAACAGG - Intronic
941579870 2:167282034-167282056 TACTGGGTGTTTCACAAAGCAGG + Intergenic
943516996 2:188900933-188900955 GAGAGTGTCTTTCAGATAACAGG - Intergenic
943615846 2:190091535-190091557 GTGTGTGTGTTTAACAAAAGAGG - Intronic
945784690 2:214218367-214218389 GAGGGTGTGTTTCCCAGCACTGG + Intronic
948527861 2:238584009-238584031 GATTGTGTCTTTCAAAAAACGGG + Intergenic
1170259394 20:14386923-14386945 GAGTGTGTGATGCAAAAATCGGG + Intronic
1170411795 20:16100423-16100445 GTGTGTGTGTGTGTCAAAACAGG + Intergenic
1173252763 20:41373401-41373423 CAGAGGGTGTTTCACAAAACAGG + Intergenic
1178882679 21:36461517-36461539 GAGTGTGTGTGGCACAGCACAGG - Exonic
1183718368 22:39547702-39547724 GAGAGTGTATTTAACAAAAGTGG + Intergenic
949941296 3:9156835-9156857 GAGTGTGTATTTCAACAGACAGG + Intronic
951995419 3:28722441-28722463 GTGTGTGTTTTTTACATAACTGG + Intergenic
954732030 3:52672418-52672440 GAGTGTGTTAGTCAGAAAACTGG - Intronic
957402841 3:79738850-79738872 GAGTGTCTCTTTCACTAGACTGG - Intronic
957677079 3:83381377-83381399 GTGTGTGTTTTAAACAAAACTGG - Intergenic
957836786 3:85604490-85604512 GTGTGTGTGTTTCTAAAACCTGG + Intronic
959946249 3:112128521-112128543 GAATGTGAGCTTCACAAAGCTGG + Intronic
962330976 3:134477858-134477880 GAATGTGTTTTTCAAAATACAGG + Exonic
963385900 3:144594116-144594138 GAATGTGTGTTTCACATGCCAGG - Intergenic
966545740 3:181145461-181145483 GATTGTGTCTTTCAAGAAACTGG - Intergenic
966573079 3:181468601-181468623 CATTATGTGTTTTACAAAACTGG - Intergenic
969378757 4:6780894-6780916 GTGTGTGTGTGTCACTATACAGG + Intergenic
970409942 4:15795229-15795251 GTGTGTGTATTTCACAGAAAAGG + Intronic
970914734 4:21319798-21319820 GTGTTTTTGTTTTACAAAACTGG + Intronic
971895742 4:32591382-32591404 TACTGTCTGGTTCACAAAACAGG - Intergenic
971946331 4:33283201-33283223 GTGTGTGTATTTCACATAAAAGG - Intergenic
974916179 4:68182007-68182029 GACTGTGTGGTTCATAAAACAGG + Intergenic
976887122 4:89999534-89999556 GTGTGTGTGTTTCCCACAATGGG - Intergenic
977412850 4:96690035-96690057 GAGTGTCTGTGTCACCAAGCTGG - Intergenic
977769196 4:100837013-100837035 AAGTGTGTGTTATATAAAACAGG + Intronic
979725086 4:123951704-123951726 CACTGAGTGTTTCATAAAACTGG - Intergenic
981143336 4:141296384-141296406 GTGTGTGTGTTTAACCAAAAAGG + Intergenic
981353715 4:143762617-143762639 GTGTGTGTGTTTTACAAATATGG + Intergenic
981745577 4:148049412-148049434 GAGTGTGTTTTACACAAAAGAGG - Intronic
983200474 4:164855377-164855399 ATGTGTGGGTTTCACAAGACTGG + Intergenic
983725610 4:170920764-170920786 GAGTTTGTGTTTAAGAAAATAGG + Intergenic
985544688 5:503615-503637 ATGTGTGTCTTTCACCAAACTGG - Intronic
985923444 5:2997216-2997238 GTGTGTGTGTTTCTGAAAACAGG + Intergenic
987240501 5:15993663-15993685 GTGTGTGTGTTTATGAAAACTGG - Intergenic
987465543 5:18267851-18267873 GTTTGTGTGTTTCAAGAAACAGG - Intergenic
987478676 5:18425589-18425611 GAGGGTATCTTTCACAGAACAGG - Intergenic
987736379 5:21849044-21849066 GATTGTGAGTTTCACATTACTGG - Intronic
991617689 5:68514180-68514202 GAGTGTTTGTTTCTCAGATCAGG - Intergenic
992166333 5:74055686-74055708 GAGCGTGTGTTTGAAAAAACTGG - Intergenic
992738983 5:79754145-79754167 GTGCGTCTGTTTCACAAAATTGG + Intronic
994943810 5:106359493-106359515 AAATTTGTCTTTCACAAAACAGG + Intergenic
996214716 5:120852757-120852779 GACTGAGTGTTTCAAAAAAATGG + Intergenic
997269549 5:132525394-132525416 GAGTGTGTGTTTAGGATAACAGG + Intergenic
998087744 5:139340703-139340725 GAGTATGTGTTTTACAAATCTGG - Intergenic
998682556 5:144486551-144486573 CAAAGTGTGTTTCTCAAAACCGG - Intergenic
999664924 5:153902821-153902843 GACTGTGTGTTTCACAGGACTGG + Intergenic
1000846697 5:166290732-166290754 GAGTGTGTCCTTCAGAAATCAGG - Intergenic
1001120975 5:168979639-168979661 GGGTGTGTGTTTAACAGAAGGGG + Intronic
1004446207 6:15701316-15701338 GAGTGCCTGCATCACAAAACAGG - Intergenic
1006586570 6:35118756-35118778 TAGTGAGTGTTTGACATAACAGG + Intronic
1007246510 6:40467213-40467235 GTGTGTGTGTTTCAAAAATGAGG + Intronic
1012283688 6:97362483-97362505 GAGTCTGTGAACCACAAAACAGG - Intergenic
1013881175 6:114902769-114902791 GAGTGCGTTCTTCACAGAACTGG - Intergenic
1014498226 6:122154530-122154552 GAATGTGATTTTCAAAAAACTGG + Intergenic
1014573799 6:123045132-123045154 GTGTGTGTGTGTCCCAAAAGAGG - Intronic
1015398842 6:132765983-132766005 GTGGGTTTGTTTCATAAAACGGG + Intergenic
1016218705 6:141637404-141637426 GAATGTGTGTTGCATTAAACAGG - Intergenic
1017031177 6:150223817-150223839 GACAGGGTGTTTCACAAAGCAGG + Intronic
1017375222 6:153760786-153760808 GAGTGTGTGTACCACAACAAGGG + Intergenic
1018579177 6:165292964-165292986 GAGTGAGTGTTTAACAAACTTGG + Intronic
1019005627 6:168794222-168794244 GTGTGTGTGTTTCACAACACTGG - Intergenic
1020389030 7:7639491-7639513 GAGGGTATGTTTTAAAAAACAGG + Intronic
1021513239 7:21456549-21456571 GAGTGTGTGTTTAAGAAGTCAGG + Intronic
1021796284 7:24257636-24257658 GAGAGTGTGTTTCCCCAAAGAGG - Intergenic
1022956317 7:35384954-35384976 GATTGTGTGTCACACAGAACTGG - Intergenic
1025971647 7:66332148-66332170 AAGATTGTTTTTCACAAAACCGG + Intronic
1026050379 7:66941549-66941571 GTGTGTGTGTTTTAAGAAACAGG - Intronic
1027256400 7:76433455-76433477 GACTGTGTCTTTCAGAGAACTGG + Exonic
1030271247 7:107670451-107670473 GAGTGTATTTTTTACAAAAGAGG + Intronic
1030583361 7:111386907-111386929 GAATGACTGTTTCACAAAAGAGG + Intronic
1031492182 7:122402758-122402780 GTGTGTGCGTTACACAAAATAGG - Intronic
1036602160 8:10271349-10271371 GAGTGTGTTTTTTAAAAAAGGGG + Intronic
1037613671 8:20497467-20497489 CAGAGTGTCTGTCACAAAACAGG + Intergenic
1038807489 8:30808696-30808718 TACTGTGTGGTTCACATAACAGG + Intronic
1040449947 8:47535054-47535076 GAGTGTGTCTTTCACGTAATTGG - Intronic
1042382444 8:68133153-68133175 GAGCGTGTGTGTCAGAACACAGG + Intronic
1044696735 8:94930765-94930787 GAGTATGTTATTAACAAAACTGG + Intronic
1044975447 8:97660197-97660219 AAGTGTGTGATTCCCAAATCTGG - Intronic
1045147096 8:99358312-99358334 CAGTGTGGGTTTCATAATACTGG + Intronic
1045230924 8:100306193-100306215 GAGTCTTTGGTTCAAAAAACTGG - Intronic
1047293813 8:123553279-123553301 GATTTTGTGTTGCACAAAACTGG + Intergenic
1049028887 8:140018029-140018051 GAGAGTGGGTTTCACCATACTGG + Intronic
1049662844 8:143828108-143828130 CAGTGTGTGATTCACAGGACTGG - Intronic
1052313223 9:27091092-27091114 AAGTGTGTTTTTAAAAAAACAGG - Intergenic
1056088408 9:83179783-83179805 GTGTGTGTGTTTTACACAAATGG - Intergenic
1056316800 9:85398060-85398082 GTGTCTGTGATTCACAACACAGG - Intergenic
1058352021 9:104036523-104036545 GTGTGTGTGTTTCAGAAAGAAGG - Intergenic
1060921583 9:127424248-127424270 GCGTGTGTGTATCATAAACCGGG + Intergenic
1187270071 X:17772106-17772128 GAGTATGAGTCTCACAAAACCGG - Intergenic
1187358231 X:18599206-18599228 GTGTGTGTTTTTCAGGAAACAGG - Intronic
1187546719 X:20261642-20261664 GTGTATGTGTTTTATAAAACAGG - Intronic
1188672859 X:32901487-32901509 AAATTTGTGTTTCAAAAAACTGG - Intronic
1189377892 X:40480084-40480106 GAGTGAGTGTTCCAAGAAACAGG + Intergenic
1191859335 X:65653140-65653162 GTGTGTGTGTGACAGAAAACTGG + Intronic
1193140297 X:78019765-78019787 GACTGTGTGTTTCTCAATAGGGG + Intronic
1194106653 X:89778084-89778106 GAGTGTGTGAATTACAATACAGG + Intergenic
1194519945 X:94907231-94907253 GAGAGTGTGTTTGACAATAGTGG + Intergenic
1194692620 X:97006431-97006453 TAATGTCTGTTTCACAAATCTGG + Intronic
1195394598 X:104397493-104397515 GACTGTGTTTTTCACAGAACTGG + Intergenic
1195588248 X:106591808-106591830 GTGTGTGTGTTTAACAAAATAGG - Intergenic
1197852247 X:130875000-130875022 AAGTGTGTGAGTCACTAAACAGG + Intronic
1199266997 X:145840030-145840052 AAGTGTGTAATTAACAAAACTGG - Intergenic
1199668276 X:150119542-150119564 CTGAGTGTGTTTCCCAAAACAGG + Intergenic
1199723723 X:150562304-150562326 AAGTGTGTTTTACTCAAAACAGG - Intergenic
1199855348 X:151754986-151755008 GAGTGTGCGGTTCAAAACACCGG + Intergenic
1200458617 Y:3425948-3425970 GAGTGTGTGAATTACAATACAGG + Intergenic