ID: 1116862109

View in Genome Browser
Species Human (GRCh38)
Location 14:50003267-50003289
Sequence AGTGTGTGTTTCACAAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116862107_1116862109 -10 Left 1116862107 14:50003254-50003276 CCTGAAATGGCAGAGTGTGTGTT 0: 1
1: 0
2: 0
3: 18
4: 246
Right 1116862109 14:50003267-50003289 AGTGTGTGTTTCACAAAACAGGG 0: 1
1: 0
2: 1
3: 28
4: 262
1116862103_1116862109 13 Left 1116862103 14:50003231-50003253 CCCATGGCAACGGGCAAGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1116862109 14:50003267-50003289 AGTGTGTGTTTCACAAAACAGGG 0: 1
1: 0
2: 1
3: 28
4: 262
1116862105_1116862109 12 Left 1116862105 14:50003232-50003254 CCATGGCAACGGGCAAGTGCGGC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1116862109 14:50003267-50003289 AGTGTGTGTTTCACAAAACAGGG 0: 1
1: 0
2: 1
3: 28
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116862109 Original CRISPR AGTGTGTGTTTCACAAAACA GGG Intronic
900283423 1:1887046-1887068 AGTGTAAGTCTCACAAGACATGG - Intronic
901798322 1:11692842-11692864 AGTGTTCCTGTCACAAAACAGGG + Intronic
911142506 1:94521267-94521289 AATGTGTGTTTGACAAAATTTGG - Intergenic
912915390 1:113809954-113809976 AGTGTGTTTTTTAAAGAACATGG + Intronic
913026253 1:114844412-114844434 AGAGTCTGTTTCAAAAAAAAAGG - Intergenic
917061072 1:171040413-171040435 TGTGTGTGTTACACACAAAAAGG + Intronic
917124435 1:171673639-171673661 CTTGTGTGTTTCACACAGCAAGG + Intergenic
919561479 1:199125474-199125496 AGTGTGGGATTGAGAAAACATGG + Intergenic
921381501 1:214529380-214529402 AGTATGTGTTTCAGAGACCAAGG + Intronic
923381925 1:233429099-233429121 TGTGTGTGTGTCTCAAAACTGGG - Intergenic
1064238297 10:13598756-13598778 AGTGTGTGTTAGACAACACTGGG - Intronic
1064820900 10:19331669-19331691 AGTGTGTGTATCTCAACACCAGG + Intronic
1064840803 10:19589500-19589522 AGGGAGTGTTTCTCAAAAGAAGG - Intronic
1066042208 10:31560751-31560773 AAAGTGTGTTTCAAAAGACATGG + Intergenic
1066169824 10:32829410-32829432 AATGTGTTTTTAACAAAAGAAGG - Intronic
1066785481 10:38999348-38999370 ATACTGTGTATCACAAAACAAGG - Intergenic
1067202284 10:44183937-44183959 TGATTGTGTTTCACAGAACATGG + Intergenic
1067816429 10:49481056-49481078 AGTGTGTATTTCCAAAAACAAGG - Intronic
1069633325 10:69910802-69910824 TGTGTGTGGATCACAAAACCTGG + Intronic
1069663054 10:70136560-70136582 TGTGTGTGTTTGAAGAAACAGGG + Intergenic
1070991255 10:80734195-80734217 CATGTGTGTTTCAGAAAGCATGG + Intergenic
1071054810 10:81497156-81497178 TGTGTGTGTGTAACACAACAAGG - Intergenic
1071416139 10:85443751-85443773 ACTCAGTGTTTCACAAAAGAAGG + Intergenic
1071735340 10:88292717-88292739 AGTGTGAGTATCAAAATACAAGG - Intronic
1071852140 10:89584574-89584596 AAATTGTGTGTCACAAAACATGG + Intronic
1073692725 10:105828562-105828584 TGTGTGTGTTTCATAACATATGG - Intergenic
1074090129 10:110244306-110244328 TGTTTTTGTTTCACAAAATAAGG + Intronic
1075337178 10:121616992-121617014 GGTGTCTGTTTCCCAAAACCTGG - Intergenic
1075434395 10:122422828-122422850 AGTGTGTATTTCCTAAAACATGG - Intronic
1076586237 10:131549629-131549651 AGTGTGTGTGTCATAAAATAGGG + Intergenic
1077973924 11:7225727-7225749 CGTGTATGTACCACAAAACATGG - Intergenic
1078194585 11:9124915-9124937 AGTGAGTGATTCACAAAAGGGGG + Intronic
1081004593 11:37719117-37719139 AGACTGTTTTTCAAAAAACAGGG + Intergenic
1085229669 11:74954636-74954658 TGTGTGTGTTTAATGAAACAAGG + Intronic
1086998021 11:93380911-93380933 ATTTTGTTTTTCATAAAACATGG - Intronic
1087078393 11:94146937-94146959 AGTGTGTGTCTTCTAAAACAAGG - Intronic
1087508358 11:99057429-99057451 AGTGTGTTTTTAACAACACTAGG + Intronic
1091342263 11:134824962-134824984 AGTGTGTGTTCCACAAATGCAGG + Intergenic
1093796160 12:23314776-23314798 AGGGTGTGTTTAACACAAAAGGG + Intergenic
1093889298 12:24500356-24500378 TGTGTGTGTCTCAGAAACCATGG + Intergenic
1095520437 12:43058039-43058061 ATTTAGTGTTTCACAAAACATGG + Intergenic
1097795561 12:63857739-63857761 AGTGTTTTTTTTACCAAACAAGG - Intronic
1099454031 12:82842998-82843020 AGTGTGTGTGGCACATAACAGGG + Intronic
1100309751 12:93383396-93383418 AGTGGGTGTTTCTAATAACACGG + Intronic
1101926716 12:108977727-108977749 TGTGTGTGTTTTAAAAAATATGG + Intronic
1102829164 12:115980023-115980045 AGTATGTGCATCACAAAACGAGG + Intronic
1104700588 12:130900882-130900904 ATTGTTTGTTTTACAAAAAATGG + Intergenic
1105582892 13:21717719-21717741 AGTTTGTTATTCATAAAACAGGG - Intergenic
1106046831 13:26150170-26150192 ATTGTGCGTTTAACAAAATATGG - Intronic
1107438417 13:40402666-40402688 TATGTGTGTTTCGCAAAACTTGG - Intergenic
1107956486 13:45518098-45518120 AGTGTGTGCTTGCCAAACCAGGG + Intronic
1110061809 13:71050285-71050307 AAATTGTGTTTCACAAAAGAAGG + Intergenic
1111586157 13:90287504-90287526 AGTGTGTTTCTCACAAACCTGGG + Intergenic
1111619678 13:90707606-90707628 AGTGTGTAATTCTCAAATCAGGG + Intergenic
1111936713 13:94565379-94565401 TGTGTGTGTTCCACTAAACACGG - Intergenic
1113611302 13:111646522-111646544 GGTGTGGGTTTCACAGAGCAGGG - Intronic
1114905113 14:27118485-27118507 AGCGTGTTTTTAACAAAAGAAGG + Intergenic
1115291403 14:31776935-31776957 ATTGTTTGTTTCAGAGAACAAGG + Intronic
1115604584 14:34987826-34987848 AGACTGTGTTTAACAAAATATGG + Intronic
1116286222 14:42975180-42975202 TGTATTTGTTTCATAAAACATGG - Intergenic
1116806713 14:49501151-49501173 AGTGTGTGTTTCGGAAAGGAGGG - Intergenic
1116862109 14:50003267-50003289 AGTGTGTGTTTCACAAAACAGGG + Intronic
1117016712 14:51525741-51525763 AGTGTGTGTTCCAGAAGAAATGG - Intronic
1117019204 14:51551903-51551925 TGTGTGTGTTTCTGAAAACATGG - Intronic
1117645008 14:57842631-57842653 AGGGAGTGATTCCCAAAACATGG - Intronic
1118040152 14:61907727-61907749 CCTGTGTGATTCATAAAACATGG - Intergenic
1119163158 14:72470284-72470306 AATGTGTGTTTCAGCAGACAAGG + Intronic
1119689963 14:76663847-76663869 TGTGTGTGGGTCAGAAAACACGG - Intergenic
1122456348 14:101855191-101855213 AGTTTTTGTTTTAGAAAACATGG - Intronic
1124357634 15:29008445-29008467 AGTGTGTGTTTTACTAGATATGG - Intronic
1124409109 15:29420945-29420967 AGAATGTGCTCCACAAAACAAGG + Intronic
1125909178 15:43420976-43420998 AGTCTGTTGTTCAGAAAACAAGG - Intronic
1126337177 15:47598985-47599007 AGTCTGTGTTTCCCAAAATGTGG + Intronic
1128903827 15:71450118-71450140 AGTGTGTGTTTGAAAACTCAAGG + Intronic
1129250033 15:74303654-74303676 AGTGTGTGCTGCACAGAACAGGG - Intronic
1132103572 15:99046304-99046326 AGACTGGGTTTCACAAAACATGG + Intergenic
1135419582 16:22296975-22296997 AGTGTTTATTTTCCAAAACACGG + Intergenic
1135838401 16:25850287-25850309 AGTGAGTGTTTAAAAAAATAGGG - Intronic
1138962240 16:62040866-62040888 AGTGTGTAGTCCACAAAACCTGG - Intergenic
1139010381 16:62624620-62624642 AATCTGTCTTTCACAAACCAGGG - Intergenic
1139253958 16:65522813-65522835 AATGTGTGGGTCACAAAACTGGG - Intergenic
1143689971 17:8553122-8553144 AGTGTGTCTTTCACCAGACGTGG - Intronic
1145283403 17:21485502-21485524 AGCGTGTGTTTCTGAAACCAAGG - Intergenic
1145394083 17:22480328-22480350 AGCGTGTGTTTCTGAAACCAAGG + Intergenic
1145756951 17:27399220-27399242 AGTGTGTGTTTCCTAAAAACAGG + Intergenic
1148568091 17:48645859-48645881 AGTGTGGGTTTCAAATAAGATGG + Intergenic
1153039217 18:795235-795257 AGTATGTATTTCCTAAAACAAGG - Intronic
1153304227 18:3617702-3617724 GATGTGTTTTTCACAAATCAAGG - Intronic
1153407660 18:4758801-4758823 AGTGTGGGTATTAAAAAACAGGG + Intergenic
1153445343 18:5165867-5165889 AGTGTGGGTTCCACCAAACTAGG - Intronic
1155121771 18:22828047-22828069 AGAGTGTGTTCCACAAATAATGG - Intronic
1155722189 18:29029558-29029580 ATATTGTGTTTCAGAAAACATGG + Intergenic
1155797768 18:30061085-30061107 AGTTTCTGTTACCCAAAACATGG + Intergenic
1156824851 18:41418707-41418729 AGTGTGTGTTTGAAAAATGAAGG + Intergenic
1158094132 18:53751234-53751256 AGTGTATGTTTCAGTAGACATGG + Intergenic
1158215446 18:55096304-55096326 AGTGTGTGTTTAACTAGAAATGG + Intergenic
1158234849 18:55301424-55301446 AATGTCAGTTTCACAAACCAAGG + Intronic
1158740962 18:60141594-60141616 AGTGTGTGCTTAACAAAATTTGG - Intergenic
1159199468 18:65165755-65165777 ATTGTGTCCATCACAAAACATGG + Intergenic
1159209542 18:65299079-65299101 TGTGTGTGTGTGACAAAACTTGG + Intergenic
1159216621 18:65400203-65400225 ATTGTGAGTTTAACAAAAAAGGG + Intergenic
1160119411 18:76114607-76114629 AGTGTGTTTTTGTAAAAACAAGG - Intergenic
1160170445 18:76548664-76548686 AGTGTGTGCTTCACATACCTCGG + Intergenic
1162862352 19:13516007-13516029 TCAGTGTGTTTCCCAAAACAGGG - Intronic
1164332049 19:24268560-24268582 AGTGTGAGTGACACAAAAGACGG - Intergenic
1164661253 19:29971750-29971772 AGTGTGTTATTTACCAAACATGG - Intronic
1164673632 19:30087801-30087823 AGAGTTTGTTTGACAAACCAAGG - Intergenic
1166574668 19:43826568-43826590 AGTGTGTGCTTCAGAATAAATGG + Intronic
1167178379 19:47882062-47882084 GGTGAGTGTTTCACAAAATATGG - Exonic
1167909770 19:52691986-52692008 AGTGTGAGTTTCACAACATGGGG + Intergenic
1168598999 19:57703090-57703112 AGTGTGTGTATGACAAACCCAGG + Intronic
925098461 2:1226292-1226314 AATGTGTGTTTCTCAAAAACGGG + Intronic
925105268 2:1285631-1285653 AGTATGTTTTTAACAAAAGAAGG + Intronic
926438569 2:12862559-12862581 AGTGTGTATTACACAAAACTGGG - Intergenic
926569207 2:14510950-14510972 GGGGTGAGTTTCACAAACCAAGG + Intergenic
926824998 2:16897538-16897560 AGTCTGTGGTTTTCAAAACAAGG - Intergenic
927791388 2:26012564-26012586 AGTGTGCCTTCCACAAAGCAAGG - Intergenic
928798082 2:35049281-35049303 ATTGTGTGTGTAACAAAAAAAGG - Intergenic
930373473 2:50534311-50534333 AGTGTCTATTTATCAAAACAGGG + Intronic
930963429 2:57289253-57289275 TGTGTGTGTTTCACATTACCTGG - Intergenic
932871741 2:75407614-75407636 TGTGTGAGTTTCAGAAAAGAGGG + Intergenic
933610603 2:84430574-84430596 AGGGTGGTTTACACAAAACAAGG - Intronic
936660445 2:114537141-114537163 TGTGTGTGTGTTACAGAACATGG + Intronic
937155900 2:119718669-119718691 AATTTGTTTTTCATAAAACAGGG - Intergenic
937490853 2:122365734-122365756 AGTGGGAGTTACACAAATCAGGG + Intergenic
938338474 2:130519843-130519865 AGTGTGTTTTTCACCGGACACGG + Intergenic
938351365 2:130600907-130600929 AGTGTGTTTTTCACCGGACACGG - Intergenic
938613813 2:132976846-132976868 AATTTTTGTTTCAGAAAACACGG + Intronic
938989557 2:136613972-136613994 AGTCAGTGTTTCACAGGACAAGG + Intergenic
940696682 2:156987978-156988000 TGATTGTGTTTCACAAAGCATGG + Intergenic
941579871 2:167282035-167282057 ACTGGGTGTTTCACAAAGCAGGG + Intergenic
941591011 2:167420491-167420513 ATTGTGTATTTCAAGAAACAAGG + Intergenic
941907862 2:170734487-170734509 GGCTTGTGTTTCACACAACATGG + Intergenic
942448862 2:176097039-176097061 AGTGTGGGACTCACAAAAAATGG - Intergenic
942768168 2:179482305-179482327 TGTGTGTGTTTCCCACAAGAGGG + Intronic
943509531 2:188807154-188807176 AGTGTGTTTTTCTAAAAATAAGG + Intergenic
945313292 2:208341354-208341376 AGACTGTGTTTCACAAAAAGTGG - Intronic
946582339 2:221143201-221143223 TCTGTTTGTTTCACAAAAGAAGG + Intergenic
947929730 2:233953632-233953654 TGTGTGTGTGTCACAAAGCCTGG - Intronic
1169704922 20:8492489-8492511 TGTGTGTGTTTTAAATAACATGG + Intronic
1170504051 20:17005724-17005746 TGTGTTTCTTTCACGAAACAAGG + Intergenic
1173264266 20:41464404-41464426 AATGTATTTTTCACAAAATATGG + Intronic
1174447556 20:50600998-50601020 AGTGTATCTTACACAAAAGAGGG + Intronic
1177655928 21:24017277-24017299 ATTGTATGTTTCTTAAAACAAGG + Intergenic
1178301361 21:31456047-31456069 AGTGTGTGCTTCCCACAACCAGG - Intronic
1179729884 21:43361805-43361827 AGTGTGTGTTTCAGAAGTCCCGG - Intergenic
1181082144 22:20423023-20423045 TGTGGGTGCCTCACAAAACAGGG - Intergenic
1184287555 22:43480138-43480160 AGTGTGTGGCTCAACAAACAAGG - Intronic
1184315346 22:43683709-43683731 AATGAGTGTTTCACAAGAGAAGG + Intronic
950032317 3:9861240-9861262 ATTCTGTGTTGCACAAAACAAGG - Intergenic
950272726 3:11631705-11631727 ATTTTATGTTTGACAAAACATGG + Intronic
951595983 3:24318578-24318600 AGTGAGTCTTTCAAAAAAGAGGG + Intronic
952273455 3:31854852-31854874 AGTGTGTCTTTCTAAAAACAAGG + Intronic
952699970 3:36317259-36317281 AGAATGTGATTCACAAAGCATGG + Intergenic
953122910 3:40063380-40063402 AGTGTGTATTTCCAAGAACAAGG - Intronic
954308758 3:49748019-49748041 AATGTGTGTTTGTCAAACCATGG - Exonic
956695703 3:71917414-71917436 ACTGTGTGTTTCACACACCATGG - Intergenic
957726083 3:84069074-84069096 AGTATGTGTTCCAAAAAATATGG - Intergenic
958021499 3:88002656-88002678 TGTGTGTGTTTCATAATACCAGG + Intergenic
958953222 3:100438842-100438864 ACAGCGTGATTCACAAAACAGGG + Intronic
959714617 3:109418746-109418768 AGTGTGTATTTCCAAAAACAAGG + Intergenic
960828840 3:121822342-121822364 AGTGTGTGTTTATCAACATAGGG + Intronic
960979206 3:123205944-123205966 AGTATGTGTTTTAGAAAGCATGG + Intronic
961785042 3:129342564-129342586 ATTCTGTGTAGCACAAAACAAGG - Intergenic
962587375 3:136856058-136856080 AGTGTATTTTTCACAAATGAAGG - Intergenic
963385899 3:144594115-144594137 AATGTGTGTTTCACATGCCAGGG - Intergenic
963991549 3:151661914-151661936 TGTGTGTGTTTCTATAAACACGG + Intergenic
964043653 3:152295767-152295789 AGTGTGTGTCAAACCAAACAGGG + Intronic
964971446 3:162567946-162567968 AGTGTCTCTTGCAGAAAACATGG + Intergenic
967335439 3:188338900-188338922 AATGGGTTTTTCACAAACCATGG - Intronic
968723547 4:2226314-2226336 ATTGTGTGCCTCAGAAAACAAGG + Intronic
969258336 4:6018098-6018120 TGTGTGTATTTCACAAACCGCGG - Intergenic
969335298 4:6504903-6504925 TGTATGTGTTTCACAAAAATTGG - Intronic
970002461 4:11377874-11377896 TGTTTGTGTGTCCCAAAACAGGG - Intergenic
970159939 4:13178136-13178158 AGGGTGTGTTTCAAGAAACAAGG - Intergenic
970409943 4:15795230-15795252 TGTGTGTATTTCACAGAAAAGGG + Intronic
970696783 4:18687249-18687271 AGTTTGTGTTCAACAAAAAAAGG + Intergenic
971571109 4:28211990-28212012 AGTGTCTATTTCACATAATAAGG + Intergenic
971895741 4:32591381-32591403 ACTGTCTGGTTCACAAAACAGGG - Intergenic
972641259 4:40927208-40927230 ATTATGTGTTTCAAAGAACAAGG + Intronic
973913342 4:55606642-55606664 AGAATGTGTTTCACAAAAGCAGG + Intronic
974155181 4:58062297-58062319 AGTTTGTTTCTCACAAAATAGGG + Intergenic
974916180 4:68182008-68182030 ACTGTGTGGTTCATAAAACAGGG + Intergenic
975929142 4:79497056-79497078 GTTTTGTGTTTTACAAAACAAGG + Intergenic
977686966 4:99858038-99858060 AGTGTGTATTTCCAAAAATAAGG + Intronic
977769197 4:100837014-100837036 AGTGTGTGTTATATAAAACAGGG + Intronic
979387724 4:120088956-120088978 GGTGTGAATATCACAAAACAGGG + Intergenic
979470979 4:121095815-121095837 AGTATGTATTTCATAAAGCAAGG - Intergenic
979725085 4:123951703-123951725 ACTGAGTGTTTCATAAAACTGGG - Intergenic
980395176 4:132203808-132203830 AGTGTGTGGTTCACATAAGCAGG + Intergenic
980427922 4:132650613-132650635 AGTATGTGTTTCAATGAACATGG + Intergenic
981143337 4:141296385-141296407 TGTGTGTGTTTAACCAAAAAGGG + Intergenic
982889641 4:160831507-160831529 ATTTTCTGTTTCTCAAAACATGG + Intergenic
983031549 4:162809195-162809217 AGGGTGTGTTTGAGAAAGCATGG + Intergenic
983127676 4:163974282-163974304 AGTGAGTGCTTCACCAATCAAGG - Intronic
983725611 4:170920765-170920787 AGTTTGTGTTTAAGAAAATAGGG + Intergenic
985544687 5:503614-503636 TGTGTGTCTTTCACCAAACTGGG - Intronic
985923445 5:2997217-2997239 TGTGTGTGTTTCTGAAAACAGGG + Intergenic
986695332 5:10350263-10350285 AGTGGGTATTTCCCCAAACAAGG + Intergenic
986943571 5:12987181-12987203 AGTGTTTGTATCCCAAATCACGG + Intergenic
987952283 5:24690461-24690483 AGTGTGGGTTCAAGAAAACAGGG + Intergenic
988120924 5:26961245-26961267 AGTGTTTTCTTCACAAAAAATGG - Intronic
990017351 5:51080520-51080542 AGTGTGTGTTTCTTTAAATATGG + Intergenic
990216180 5:53534916-53534938 ACTGTGTGTTTCACATTAAATGG - Intergenic
991514532 5:67420027-67420049 TGTGTGTTTTTAACAAAATAGGG + Intergenic
992166332 5:74055685-74055707 AGCGTGTGTTTGAAAAAACTGGG - Intergenic
993451700 5:88079087-88079109 AAGTTGTGTTTCTCAAAACATGG + Intergenic
993526000 5:88966424-88966446 TGTGAGTGGTTCACTAAACAGGG + Intergenic
996824172 5:127662564-127662586 AGATTCTGTTTCTCAAAACACGG + Intergenic
997012841 5:129899243-129899265 AGTATGTATTTCAGAAAATAAGG + Intergenic
998042511 5:138961084-138961106 AGTGTGGGTTCCATAAAACCAGG - Intronic
998836697 5:146208915-146208937 GGTGTGTGTTTTAAAAAGCATGG + Intronic
999021326 5:148168701-148168723 GGGGTGTGTTTAGCAAAACATGG + Intergenic
999586983 5:153100271-153100293 TGTGTGTGTTTTAAAAACCAAGG - Intergenic
999823226 5:155249249-155249271 TTTGTTTGTTTCACACAACAGGG + Intergenic
1000260608 5:159584983-159585005 AGTGTGTCTGTCAGAAATCAAGG - Intergenic
1000486856 5:161857364-161857386 AGTGTGTGTTTCTAAAAAACAGG - Intronic
1000858817 5:166432215-166432237 AGAGTATGTTTCACAAAATATGG - Intergenic
1001575876 5:172763520-172763542 ACTGAGTGTTTTACAAACCATGG + Intergenic
1004101123 6:12612719-12612741 ATTTTGTGTTTCACCAAACATGG - Intergenic
1005655781 6:27935883-27935905 AGTGTGTGTTTCTGCAAAGATGG + Intergenic
1005662938 6:28018935-28018957 AGTGTGTGATTCAGAGAATAAGG - Intergenic
1009335458 6:62483731-62483753 GGTGTGTCTTTAAAAAAACAAGG + Intergenic
1009446766 6:63752033-63752055 AAATTGTGCTTCACAAAACATGG - Intronic
1010425785 6:75727507-75727529 TGTGTGTTTTTCAAAAGACAGGG - Intergenic
1011236024 6:85218152-85218174 AGTCTTTGTTTAAGAAAACAGGG + Intergenic
1011838498 6:91465375-91465397 AGTTTATGTTTCTGAAAACATGG + Intergenic
1012177889 6:96111527-96111549 TGTGTGTGTTTCCCAAATCATGG - Intronic
1013932211 6:115547275-115547297 TGTGTGTTTTTCACATAAGATGG - Intergenic
1014020584 6:116583966-116583988 AATGTGAGTTACACAAAAGATGG + Intronic
1017655245 6:156621359-156621381 AGTGTGTATTTCCTAAAACAAGG - Intergenic
1019132485 6:169887427-169887449 AAAGTCTGTTTCACAAAAAAAGG - Intergenic
1021796283 7:24257635-24257657 AGAGTGTGTTTCCCCAAAGAGGG - Intergenic
1022148152 7:27568867-27568889 AGTTTGTCTTTCACTAAACTTGG + Intronic
1022481052 7:30743430-30743452 AGAGTGTGTTTCAAGAAGCAGGG - Intronic
1022733732 7:33056738-33056760 AGTCTGTGTTTTAAAAAAGAAGG - Intronic
1026050378 7:66941548-66941570 TGTGTGTGTTTTAAGAAACAGGG - Intronic
1027639846 7:80719460-80719482 GGTTAGTGTTTCACAGAACATGG + Intergenic
1028616093 7:92768549-92768571 TGTGTGTGTTTTTAAAAACATGG + Intronic
1028807672 7:95047083-95047105 GGTGTGTGTTACACAGAACCTGG - Intronic
1028967454 7:96817921-96817943 ACTGTGTGTTTCTCCAAACCCGG + Intergenic
1030416087 7:109245110-109245132 TGTATGTGGTTCATAAAACATGG - Intergenic
1030780978 7:113599769-113599791 AGTGTGTATTTCTTAAAACCAGG - Intergenic
1031181879 7:118429645-118429667 TGTGTGTGTTTTACAAAATCTGG + Intergenic
1033818171 7:145100866-145100888 TTTTTGTGTTTCATAAAACAAGG - Intergenic
1034176244 7:149102096-149102118 TGTGTGTGTTGCACAAAACATGG - Intergenic
1034567226 7:151924774-151924796 AATGTGCCTCTCACAAAACAAGG - Intergenic
1035870797 8:3134236-3134258 AGTGTTTGCTGCACAAATCAAGG + Intronic
1038995813 8:32921863-32921885 AGTGTGTGTTTTCCAAAAAAAGG - Intergenic
1039548837 8:38429147-38429169 AATGTGACTTTCACAAAACTAGG - Intronic
1042008342 8:64208947-64208969 AATGTGTGTCCCAGAAAACAGGG + Intergenic
1042365197 8:67928348-67928370 ACTTTTTGTTTTACAAAACAAGG - Intergenic
1043646088 8:82520612-82520634 ATTCTGTGTTTCACAAATTAGGG + Intergenic
1043778996 8:84307854-84307876 AGTTTGTTTCTCACAAAAAAAGG + Intronic
1044473761 8:92602772-92602794 AAAGTGTGTTTCACGGAACATGG - Intergenic
1044561381 8:93615791-93615813 AGTCTGTGTGTCATAATACATGG - Intergenic
1044786556 8:95800133-95800155 TGTGTGTGTTTCACTGAAGAGGG - Intergenic
1046927673 8:119809669-119809691 ATTGTGTGTCTCAGCAAACAGGG + Intronic
1047774554 8:128058995-128059017 GATGTGTGTTGCACAAAGCAAGG - Intergenic
1050631609 9:7564817-7564839 AGTGTGTATTTAAAAATACAAGG + Intergenic
1050964567 9:11782384-11782406 ATTGAGTGTTTTACAAGACAGGG - Intergenic
1051179788 9:14398429-14398451 AGTGTGGGGTTCAGAAAATATGG - Intronic
1051505784 9:17826113-17826135 TGTGTGTGTTTCTTGAAACAAGG + Intergenic
1052261200 9:26518345-26518367 AGTCTGTGTTTCTTAAAATAAGG + Intergenic
1052714436 9:32098588-32098610 AGTGTGAGTGACATAAAACATGG + Intergenic
1055466601 9:76572571-76572593 AGTGTGTGTTTCCTAAAAACAGG + Intergenic
1055706101 9:79006145-79006167 ATTTTTTGTTTCATAAAACATGG + Intergenic
1055938441 9:81625432-81625454 GCTGTGTGTTTAATAAAACATGG - Intronic
1056574775 9:87847399-87847421 AGTGTGCATTTCACACAGCAGGG - Intergenic
1056850757 9:90081751-90081773 AGTGTGTCATTCACAACACCTGG - Intergenic
1058166852 9:101629149-101629171 AAAGTATGTTTCATAAAACAAGG + Intronic
1058352020 9:104036522-104036544 TGTGTGTGTTTCAGAAAGAAGGG - Intergenic
1059875491 9:118629901-118629923 AGTGTGTGTTGAGAAAAACATGG + Intergenic
1187927758 X:24265433-24265455 GTTGTGAGTTTCACAAAATATGG - Intergenic
1188432215 X:30117096-30117118 AATGGCTATTTCACAAAACAAGG - Intergenic
1188672858 X:32901486-32901508 AATTTGTGTTTCAAAAAACTGGG - Intronic
1188686749 X:33078855-33078877 AGTGTGTGTTCCAAAAATTATGG - Intronic
1189917380 X:45869675-45869697 AGGGTATGTTTCCAAAAACAAGG + Intergenic
1190517490 X:51239385-51239407 AGTGTGAGTGACACAAACCAAGG + Intergenic
1191055895 X:56240340-56240362 AGTACCTGTTGCACAAAACATGG + Intronic
1194692621 X:97006432-97006454 AATGTCTGTTTCACAAATCTGGG + Intronic
1195177791 X:102327544-102327566 AGTGTGGATTTCATAAAACTAGG + Intergenic
1195181073 X:102359549-102359571 AGTGTGGATTTCATAAAACTAGG - Intergenic
1195296930 X:103487743-103487765 AGAATGTGGTTCACAAATCATGG - Intergenic
1195394599 X:104397494-104397516 ACTGTGTTTTTCACAGAACTGGG + Intergenic
1195477790 X:105306294-105306316 AGTGTGTATTTCCCAAGAAAAGG + Intronic
1196017414 X:110954803-110954825 ATTGTTTGTGTCACAAATCATGG + Intronic
1197852248 X:130875001-130875023 AGTGTGTGAGTCACTAAACAGGG + Intronic
1197899252 X:131352103-131352125 AGTGCATGTTTAACATAACAAGG - Intronic
1198138406 X:133778019-133778041 ATTGTGTTCTTTACAAAACAAGG - Intronic
1198719566 X:139601601-139601623 AGGATGTGTTCCACCAAACAAGG + Intronic
1199474461 X:148230492-148230514 AATGTGTGTTTCACAAATCTTGG + Intergenic