ID: 1116862110

View in Genome Browser
Species Human (GRCh38)
Location 14:50003268-50003290
Sequence GTGTGTGTTTCACAAAACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116862105_1116862110 13 Left 1116862105 14:50003232-50003254 CCATGGCAACGGGCAAGTGCGGC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1116862110 14:50003268-50003290 GTGTGTGTTTCACAAAACAGGGG 0: 1
1: 1
2: 1
3: 23
4: 223
1116862107_1116862110 -9 Left 1116862107 14:50003254-50003276 CCTGAAATGGCAGAGTGTGTGTT 0: 1
1: 0
2: 0
3: 18
4: 246
Right 1116862110 14:50003268-50003290 GTGTGTGTTTCACAAAACAGGGG 0: 1
1: 1
2: 1
3: 23
4: 223
1116862103_1116862110 14 Left 1116862103 14:50003231-50003253 CCCATGGCAACGGGCAAGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1116862110 14:50003268-50003290 GTGTGTGTTTCACAAAACAGGGG 0: 1
1: 1
2: 1
3: 23
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116862110 Original CRISPR GTGTGTGTTTCACAAAACAG GGG Intronic
902401829 1:16162190-16162212 GTGTGTGTTGCACAAACATGCGG + Intergenic
905620612 1:39442854-39442876 GTCAGTGTTACAGAAAACAGAGG + Exonic
906825161 1:48971434-48971456 GTGTATGTATCACAGAAGAGTGG - Intronic
906996691 1:50802905-50802927 GTGTGAATTTGACAAAACTGTGG - Intronic
907958020 1:59250078-59250100 GTTTGTGTTTCAGAAGCCAGAGG - Intergenic
909226588 1:73032338-73032360 GTCTGTGGTTAATAAAACAGTGG - Intergenic
910666732 1:89733363-89733385 GTCTGTGTTACATACAACAGTGG + Intronic
911261822 1:95695395-95695417 GTGTGTGTTTCAAAATCCATAGG + Intergenic
911344857 1:96683944-96683966 GTGTGGATTTCATAAAAAAGTGG - Intergenic
911959970 1:104289061-104289083 GTATGTGTGTCATATAACAGAGG + Intergenic
913380811 1:118208389-118208411 GTGTGTTCTTCATAAAGCAGAGG - Intergenic
914915622 1:151817475-151817497 GTGTTTGTTTCACAGAGGAGGGG + Intronic
914995446 1:152539530-152539552 CACTGTGTTTCATAAAACAGAGG - Intronic
915978527 1:160406316-160406338 GTTTGCTTTTCAGAAAACAGGGG - Intronic
917061073 1:171040414-171040436 GTGTGTGTTACACACAAAAAGGG + Intronic
917124436 1:171673640-171673662 TTGTGTGTTTCACACAGCAAGGG + Intergenic
917486376 1:175458679-175458701 ATTTGTGTATCACAAAATAGAGG - Intronic
917990404 1:180370678-180370700 GTGTGTGTTTCTGAGAGCAGAGG + Intronic
918555116 1:185790056-185790078 CTGTGTGTTTCACAAATGACAGG - Intronic
918649756 1:186946916-186946938 GTTTCTGGTTCACAAAGCAGAGG + Exonic
922453043 1:225751890-225751912 GTGAGTTTTTCCCAAAGCAGTGG + Intergenic
1063100211 10:2943920-2943942 GTGTATTTTTCAGAAAATAGAGG + Intergenic
1063758397 10:9042393-9042415 CTGTGGGTTGCACAAAACAAAGG + Intergenic
1065490801 10:26279801-26279823 GTGTGTGGTTCCCACAGCAGGGG - Intronic
1067396844 10:45928406-45928428 TTGTGTGTTTCACAGATCAGAGG - Intergenic
1067865162 10:49897505-49897527 TTGTGTGTTTCACAGATCAGAGG - Intronic
1068077358 10:52273237-52273259 GTGTGTTTTTAAAAAAACACAGG - Intronic
1070062857 10:73002007-73002029 GAGTGTGTTTCACTTAACAGAGG - Intergenic
1070970019 10:80555784-80555806 GGGTGTGTTTAACATAGCAGAGG - Intronic
1073917293 10:108420403-108420425 GGGTGTCTTTCAGAAAATAGTGG - Intergenic
1075338540 10:121626741-121626763 GTGTTTGTTTCAGAAATCACTGG + Intergenic
1076104253 10:127807940-127807962 GTGTGTTTATCACAATAAAGTGG + Intergenic
1081037825 11:38171461-38171483 CTGTGTGTTTCAATATACAGAGG + Intergenic
1081501217 11:43668636-43668658 GAGAGTGTATCCCAAAACAGAGG + Intronic
1083083696 11:60120717-60120739 ATGTGTGTTCCACATAATAGAGG - Intergenic
1087134266 11:94699519-94699541 GTGTATGTATCCAAAAACAGAGG + Intergenic
1088416336 11:109593058-109593080 CTGTGTGTATTACAAAACAATGG + Intergenic
1090773367 11:129942321-129942343 GGGTTTGTTTAACAAAAAAGGGG - Intronic
1090966058 11:131598456-131598478 GTGTGGCTTTAACAAAACAAAGG + Intronic
1093796161 12:23314777-23314799 GGGTGTGTTTAACACAAAAGGGG + Intergenic
1094208625 12:27866956-27866978 GTGTGTGTGTCACATTGCAGAGG + Intergenic
1096781749 12:53995930-53995952 GTGTGTTTTTCCCAACAAAGAGG + Intronic
1099006300 12:77238327-77238349 ATCTGTATTTCTCAAAACAGAGG + Intergenic
1100458324 12:94774456-94774478 GTTTGTGTTTCAAAAAGTAGTGG + Intergenic
1101075913 12:101129785-101129807 GTGAGTGATTCAGACAACAGAGG - Intergenic
1101926717 12:108977728-108977750 GTGTGTGTTTTAAAAAATATGGG + Intronic
1102615967 12:114154471-114154493 GTGTGTGTTTCTCACAGCACAGG + Intergenic
1103671147 12:122616660-122616682 GTGTTGTTTTCACATAACAGTGG + Intronic
1111586158 13:90287505-90287527 GTGTGTTTCTCACAAACCTGGGG + Intergenic
1114849440 14:26365888-26365910 GTTTGTTTCTCAAAAAACAGAGG + Intergenic
1116862110 14:50003268-50003290 GTGTGTGTTTCACAAAACAGGGG + Intronic
1117134700 14:52722742-52722764 TTGTGTGTTTCCAAAAACACAGG - Intronic
1118822500 14:69354417-69354439 GTGTGTGTTTCATAAAGACGAGG - Exonic
1119014001 14:71030536-71030558 GGGTGTGTGTAAGAAAACAGCGG + Intronic
1119050314 14:71361440-71361462 GTGTGTATTTCACATTTCAGTGG + Intronic
1119188531 14:72662677-72662699 GCGTGTGTTTCAGACAACACAGG - Exonic
1119957908 14:78820810-78820832 GTGTATGTGTCCCAAAAAAGAGG + Intronic
1122460760 14:101892601-101892623 GTGTGTGTATCAGAAAAAAGAGG - Intronic
1124369502 15:29095871-29095893 GTGTGCTTTTCTCAAAAGAGAGG + Intronic
1125953378 15:43773071-43773093 CTTTGTGTTTCACTAAGCAGAGG + Exonic
1126404223 15:48306077-48306099 GTGTGTGTTTTACAAAAGTCTGG - Intergenic
1128581410 15:68812767-68812789 GTCGGTTTTTCACAAAACACAGG + Intronic
1128834779 15:70800498-70800520 GTGTGTGTGCCAGAAAAAAGGGG - Intergenic
1130965468 15:88694507-88694529 GTCTGTGTTTCTCAAAATGGTGG + Intergenic
1131626011 15:94121648-94121670 GTGTGTGTTTTACAAATTAAAGG + Intergenic
1132213635 15:100046392-100046414 GTGTGTGTGTCTCAATTCAGTGG + Intronic
1133459934 16:5978621-5978643 GAGTCTTTTTCACATAACAGAGG - Intergenic
1135161372 16:20099728-20099750 GTGTTTGTTTCCAAAATCAGCGG + Intergenic
1135838400 16:25850286-25850308 GTGAGTGTTTAAAAAAATAGGGG - Intronic
1137911522 16:52382808-52382830 TTGTTTGTTTCACAGACCAGAGG - Intergenic
1138072465 16:54006752-54006774 GTGTGGGTTTACCCAAACAGCGG - Intronic
1138098953 16:54236181-54236203 GTGTGTTTATCAAAAAATAGGGG - Intergenic
1139281742 16:65776606-65776628 GTTCTTGCTTCACAAAACAGAGG - Intergenic
1143464240 17:7125150-7125172 GTGTTTGTTTCAGAAACTAGAGG - Intergenic
1144037162 17:11377443-11377465 GAGTGTGGTCCCCAAAACAGCGG + Intronic
1145285869 17:21505712-21505734 GTATGTTTTTCAAAAAACATTGG + Intergenic
1145391729 17:22460588-22460610 GTATGTTTTTCAAAAAACATTGG - Intergenic
1147501114 17:40964600-40964622 GTGTGTGTGTCAAGTAACAGGGG + Intronic
1149233137 17:54559366-54559388 TTGTGTTTTTCTCAGAACAGTGG - Intergenic
1153304226 18:3617701-3617723 ATGTGTTTTTCACAAATCAAGGG - Intronic
1154951855 18:21217777-21217799 ATGTGTGTTTCACAAACTACCGG + Intergenic
1155329586 18:24701212-24701234 GTGTGGGTTTAAGAAAACACAGG - Intergenic
1155342808 18:24830068-24830090 GTGTTTGCTTCAAAACACAGTGG + Intergenic
1155605350 18:27599469-27599491 GTGTGTGTGTCACAATACAAAGG - Intergenic
1156047429 18:32892776-32892798 GTGTGTATTACACACAAGAGTGG + Intergenic
1157089223 18:44615939-44615961 GTGTGTGTTTTACAAATAAGCGG - Intergenic
1157322462 18:46645175-46645197 CTGTGGGTTTCAGAAAACTGGGG + Intronic
1157655136 18:49378240-49378262 GTATTTCTTTCAGAAAACAGAGG - Intronic
1158050995 18:53219900-53219922 GTTTGTGTGTAACAAGACAGAGG + Intronic
1159209543 18:65299080-65299102 GTGTGTGTGTGACAAAACTTGGG + Intergenic
1160888507 19:1364123-1364145 GAGTGTGTGGCACAAAACAGAGG - Intronic
1167178378 19:47882061-47882083 GTGAGTGTTTCACAAAATATGGG - Intronic
925390587 2:3491426-3491448 GTGTGTGTTAAACCACACAGGGG - Intergenic
926766656 2:16328166-16328188 GTGTGAGTGTCCAAAAACAGAGG - Intergenic
926769893 2:16361475-16361497 GTTTGTGATTCACAAACGAGAGG + Intergenic
930373474 2:50534312-50534334 GTGTCTATTTATCAAAACAGGGG + Intronic
931044651 2:58337546-58337568 GGGTATGTTTTCCAAAACAGAGG + Intergenic
932036256 2:68250340-68250362 GTCTGTTGTTCAAAAAACAGAGG + Intronic
932067379 2:68580206-68580228 ATCTGTGTTTTCCAAAACAGAGG + Intronic
932871742 2:75407615-75407637 GTGTGAGTTTCAGAAAAGAGGGG + Intergenic
935042391 2:99445700-99445722 GTGTGAGATTTACAAAACAAAGG + Intronic
935299571 2:101682220-101682242 GTGTTTGTTACACAGAGCAGTGG + Intergenic
935702290 2:105823164-105823186 GTGTGTGTGTCACAATGGAGGGG + Intronic
937155899 2:119718668-119718690 ATTTGTTTTTCATAAAACAGGGG - Intergenic
939317001 2:140564952-140564974 GTGTGTCTTTCAAGAAACACTGG + Intronic
939589238 2:144043247-144043269 GTGTGTGTTTAACCAAGTAGGGG + Intronic
941069242 2:160938016-160938038 GTGAGTGGTTCAGACAACAGTGG + Intergenic
942656254 2:178217095-178217117 GTATGTATTTCCCAAAACAAAGG - Intronic
944615691 2:201457451-201457473 GTGAGTTTTACATAAAACAGTGG + Intronic
945454548 2:210035017-210035039 ATGTGTATTTCTCAAAACAAAGG + Intronic
946079069 2:217101404-217101426 TTGTTTGTTTTACAAAAGAGGGG + Intergenic
946640054 2:221774373-221774395 GTGTGTATTTGTCAAATCAGAGG - Intergenic
947867104 2:233406174-233406196 GTGTCTGTTTAAGAAAACAGAGG - Intronic
1173034579 20:39396232-39396254 ATGTCTGTCTCCCAAAACAGAGG - Intergenic
1174447557 20:50600999-50601021 GTGTATCTTACACAAAAGAGGGG + Intronic
1175066117 20:56290426-56290448 CTGTGAGTTTCACAAGAAAGTGG - Intergenic
1176253046 20:64134968-64134990 GTTTGTGATGCACAAAACTGAGG - Intergenic
1176253048 20:64135001-64135023 GTGTGTGACGCACAAAACTGAGG - Intergenic
1176253087 20:64135525-64135547 GTGTGTGATGCGCAAAACTGAGG - Intergenic
1176253092 20:64135620-64135642 GTGTGTGATGCACAAAACTGAGG - Intergenic
1176253097 20:64135682-64135704 GTTTGTGATGCACAAAACTGAGG - Intergenic
1176253103 20:64135744-64135766 GTTTGTGATGCACAAAACTGAGG - Intergenic
1176253116 20:64135934-64135956 GTTTGTGATGCACAAAACTGAGG - Intergenic
1176253120 20:64136033-64136055 GTGTGTGATGCGCAAAACTGAGG - Intergenic
1176253129 20:64136157-64136179 GTTTGTGATGCACAAAACTGAGG - Intergenic
1176253135 20:64136254-64136276 GTGTGTGATGCGCAAAACTGAGG - Intergenic
1177858461 21:26425616-26425638 GTGTATGTTTGAGAAGACAGAGG - Intergenic
1178421309 21:32445662-32445684 CTGTGTCTTTCAGAAGACAGAGG + Intronic
1178861858 21:36296498-36296520 ATGTGTATTTTATAAAACAGAGG + Intergenic
1181082143 22:20423022-20423044 GTGGGTGCCTCACAAAACAGGGG - Intergenic
1183385786 22:37513704-37513726 ATGTCTGTTTCAGAAAAAAGGGG + Intronic
949340859 3:3029240-3029262 ATGTCTGTTTCACAAAAAAATGG + Intronic
949555573 3:5149395-5149417 GTGTGTTTCTCACAAACCTGGGG - Intronic
951381651 3:21991456-21991478 GTGTGTATTTGATAAAACTGTGG + Intronic
951595984 3:24318579-24318601 GTGAGTCTTTCAAAAAAGAGGGG + Intronic
951781620 3:26369690-26369712 TTGTGTTTTTCACAACAGAGAGG + Intergenic
952429359 3:33207032-33207054 GTATGTGTTTCTGATAACAGAGG + Intronic
955400465 3:58587511-58587533 GTGTGTGTGGCCCAGAACAGAGG + Intronic
956015737 3:64880845-64880867 GTGTGTGATTTAAGAAACAGAGG + Intergenic
956069237 3:65430091-65430113 ATGTGTGTGTCCCAAAACACAGG + Exonic
956368825 3:68536005-68536027 GAATGTGTGTCTCAAAACAGAGG + Intronic
957050078 3:75404862-75404884 CTGTGTCTTTCAGAAGACAGAGG - Intergenic
958540116 3:95460436-95460458 GTATGTGTTTCACAAAATATTGG + Intergenic
958953223 3:100438843-100438865 CAGCGTGATTCACAAAACAGGGG + Intronic
960529447 3:118746687-118746709 GTGTTTGTTTTCCAAACCAGAGG + Intergenic
962812003 3:138967302-138967324 GTGTGTGTGTATCAAAAGAGTGG - Intergenic
963991550 3:151661915-151661937 GTGTGTGTTTCTATAAACACGGG + Intergenic
965919982 3:173901377-173901399 GTGTGTGTGTTTAAAAACAGTGG + Intronic
967778707 3:193412492-193412514 GTGTGTGTTTTCCAAAGCACAGG - Intronic
969236664 4:5870224-5870246 GTGTGTGTTGTCCCAAACAGGGG - Intronic
969258335 4:6018097-6018119 GTGTGTATTTCACAAACCGCGGG - Intergenic
969335297 4:6504902-6504924 GTATGTGTTTCACAAAAATTGGG - Intronic
970002460 4:11377873-11377895 GTTTGTGTGTCCCAAAACAGGGG - Intergenic
970492287 4:16586473-16586495 GTGTGTGTATTTCAAGACAGTGG - Intronic
970942647 4:21653211-21653233 GTCTGTGTTTCTAACAACAGTGG - Intronic
972170050 4:36334730-36334752 ATGTGTTTTTCAAAAAGCAGCGG + Intronic
973863961 4:55093534-55093556 CTTTGTCTTTCAAAAAACAGTGG - Intronic
974941646 4:68476549-68476571 GTGTGTATATCACAAAAGACTGG + Intronic
975395272 4:73868277-73868299 GTGTGTGTTTCTCTAGAAAGGGG + Intergenic
975929143 4:79497057-79497079 TTTTGTGTTTTACAAAACAAGGG + Intergenic
979129728 4:117027762-117027784 GTGTTCGTTTCACAAAGCACAGG - Intergenic
980231711 4:130053762-130053784 GTTTGTATTTGACAACACAGGGG - Intergenic
981745577 4:148049412-148049434 GAGTGTGTTTTACACAAAAGAGG - Intronic
983761932 4:171420319-171420341 TTGTGTCTTTCACATAACTGTGG - Intergenic
984033936 4:174641935-174641957 GTGTGTATTTAACAAAACCATGG - Exonic
985544686 5:503613-503635 GTGTGTCTTTCACCAAACTGGGG - Intronic
985845120 5:2338867-2338889 CTGAGTGTGTCACAAAACGGTGG + Intergenic
986476684 5:8141898-8141920 CTGTGTTTTTCAAAAAAAAGAGG + Intergenic
986558398 5:9035373-9035395 GTGTTTGTTTCTCAAAGCTGAGG + Exonic
988009017 5:25459256-25459278 GTGTGTGTGTAAAGAAACAGTGG - Intergenic
989326622 5:40204035-40204057 GTGTGTGTATGAAAAAACTGAGG + Intergenic
989758496 5:44985089-44985111 GTTTATTTTCCACAAAACAGTGG + Intergenic
990267943 5:54098627-54098649 GTGTGTTTTTAACAAAAACGAGG - Intronic
991654958 5:68894690-68894712 TTGTGTGTTTCACAACCCACAGG - Intergenic
993803366 5:92373850-92373872 GTGTTTGTTTGAAACAACAGTGG - Intergenic
994708601 5:103236379-103236401 GTGTGTGTTTAACATAACTGAGG + Intergenic
995088926 5:108149110-108149132 GTGTACATTTCACAAAACAGTGG - Intronic
995983703 5:118141670-118141692 GAGTTTATTTCACAAAAAAGAGG - Intergenic
997054561 5:130425834-130425856 GTGAGTGTTGCATAATACAGAGG + Intergenic
998894602 5:146786297-146786319 ATGTGTGTATCACAGAAAAGTGG - Intronic
998961559 5:147493159-147493181 GTGTATGTGTCAAACAACAGAGG + Intronic
999639656 5:153659585-153659607 ATGAGTGTTTCTCAAAACAGAGG + Intronic
999639764 5:153660776-153660798 ATGAGTGTTTCTCAAAACAGAGG - Intronic
1003729458 6:8804833-8804855 TTGTGTGTTCCCCAAAAGAGAGG - Intergenic
1004083149 6:12416014-12416036 GTCTGTATTACCCAAAACAGGGG + Intergenic
1006865244 6:37204574-37204596 GTGTGAGGCTCACAAAACTGTGG + Intergenic
1007044614 6:38760106-38760128 ATGTGGGAATCACAAAACAGTGG - Intronic
1007122391 6:39393952-39393974 TTGTTTGTTTCACCAAACACAGG - Intronic
1007219776 6:40269273-40269295 ATTAGTGTTTCTCAAAACAGAGG + Intergenic
1008640171 6:53454106-53454128 TTATGTGCTTCAAAAAACAGTGG - Intergenic
1010256716 6:73766265-73766287 GTTTCTGTTTCACAAAATGGAGG + Intronic
1010926059 6:81747724-81747746 GTGGTTGTTTCACAACACAAAGG + Exonic
1011828144 6:91335109-91335131 GTGTGTGTGTCTCAATAAAGTGG - Intergenic
1012068609 6:94581594-94581616 GTATGTGTTTAACTAAATAGAGG + Intergenic
1013932210 6:115547274-115547296 GTGTGTTTTTCACATAAGATGGG - Intergenic
1014938898 6:127415285-127415307 GGGTGTGTATCAAAACACAGTGG + Intergenic
1015412433 6:132909869-132909891 GTATTTGTTACACAAAAAAGAGG - Intergenic
1016442623 6:144099745-144099767 TTGTGTGCTTACCAAAACAGTGG + Intergenic
1017707557 6:157137812-157137834 GTGTGTGTCTTAGAAAGCAGAGG + Intronic
1021299930 7:18959995-18960017 GTGTGTGTTTAAAACAACAGAGG - Intronic
1024130784 7:46350600-46350622 TTGTGTTTTGCACAGAACAGGGG - Intergenic
1026214877 7:68339613-68339635 GTGTGTTTTTAGAAAAACAGGGG + Intergenic
1027589141 7:80095746-80095768 ATAAGTTTTTCACAAAACAGTGG - Intergenic
1029577767 7:101414739-101414761 GTGTGTGTTTCCAAAAAGAAAGG - Intronic
1031181880 7:118429646-118429668 GTGTGTGTTTTACAAAATCTGGG + Intergenic
1031847500 7:126823960-126823982 GTGTGTGTGTGTCAAAGCAGAGG + Intronic
1033245216 7:139712186-139712208 GTGTGTTTTTCAGGAAACAAAGG - Intronic
1036813008 8:11880439-11880461 GTATATTCTTCACAAAACAGAGG + Intergenic
1039747403 8:40441432-40441454 TTGTGTGTTGCACAAAACAGTGG + Intergenic
1040057328 8:43070623-43070645 TTTTGTGTTTTACATAACAGTGG - Intronic
1041662486 8:60413363-60413385 GCGTGTGTTTCACAACAAACAGG - Intergenic
1042008343 8:64208948-64208970 ATGTGTGTCCCAGAAAACAGGGG + Intergenic
1043048977 8:75361439-75361461 GTGTGTTTCTCACAAACCTGGGG + Intergenic
1043294820 8:78649512-78649534 GTTTGTGTTTCACAAACTACAGG + Intergenic
1044786555 8:95800132-95800154 GTGTGTGTTTCACTGAAGAGGGG - Intergenic
1045007494 8:97929040-97929062 GGGTGAGTGTCTCAAAACAGAGG - Intronic
1045023941 8:98068323-98068345 GTGTGTGTTTGGGAGAACAGAGG + Intronic
1046204036 8:110965863-110965885 GGGTGTGTTTCTCAAAAACGGGG + Intergenic
1047040238 8:120985942-120985964 GAGTGTGTATAACAAAACAATGG + Intergenic
1047363824 8:124194279-124194301 GTGTGTCCTTCACAACACTGGGG - Intergenic
1047618454 8:126582448-126582470 TTGTGTGTTTCCCAAAACAACGG + Intergenic
1047774553 8:128058994-128059016 ATGTGTGTTGCACAAAGCAAGGG - Intergenic
1048551265 8:135435789-135435811 GTGTATGCTCCTCAAAACAGAGG - Intergenic
1048691937 8:136975725-136975747 GTGTGTGTTTAAAAAACCTGTGG + Intergenic
1050062290 9:1722147-1722169 TTGTTAGTTCCACAAAACAGAGG + Intergenic
1050964566 9:11782383-11782405 TTGAGTGTTTTACAAGACAGGGG - Intergenic
1051505785 9:17826114-17826136 GTGTGTGTTTCTTGAAACAAGGG + Intergenic
1051786064 9:20745072-20745094 AAGTGTGTTACACAAAAGAGGGG - Intronic
1052856065 9:33407471-33407493 GTGTGTGTCTCACTACAGAGAGG - Intergenic
1053184322 9:36002586-36002608 GGGTGTTTTTCCCGAAACAGAGG + Intergenic
1056331825 9:85527563-85527585 ATGTCTGTTTGACAAAACACAGG + Intergenic
1056574774 9:87847398-87847420 GTGTGCATTTCACACAGCAGGGG - Intergenic
1059352296 9:113674042-113674064 GTGTGTGTGTCACAAAACAGCGG + Intergenic
1059550041 9:115220086-115220108 GTGTGTATTTAAGAAAAAAGGGG + Intronic
1059642543 9:116231722-116231744 GTGTCTGTGTCTCTAAACAGTGG + Intronic
1186413797 X:9366020-9366042 GGGGGTGCTTTACAAAACAGTGG - Intergenic
1189076758 X:37923867-37923889 GTGTGTTGTTCAAAAAACATTGG + Intronic
1189198908 X:39175177-39175199 GAGAGTGTTACACATAACAGTGG - Intergenic
1189839203 X:45054296-45054318 ATGTCTGTTTTATAAAACAGAGG + Intronic
1192369926 X:70504689-70504711 GTGTGTGTTAGAGAAAGCAGGGG + Exonic
1193083210 X:77425656-77425678 GTGTGTGATTCATGAAGCAGGGG - Intergenic
1193847572 X:86493787-86493809 ATGTGTTTGTTACAAAACAGCGG + Intronic
1194204743 X:90999091-90999113 GTGTGTTTTTCACAATTCATAGG - Intergenic
1196197009 X:112847156-112847178 GTGTGAATTTCACAGGACAGTGG - Intergenic
1197029035 X:121791251-121791273 GTGTGTGCTTTACAAAATTGAGG - Intergenic
1197415832 X:126171496-126171518 ATATGTGTTTCACAATACAGCGG - Intergenic
1197605363 X:128579189-128579211 CAGTGTGTTCCACAAACCAGTGG + Intergenic
1197793257 X:130276396-130276418 GGGTGTGTTTTAAATAACAGAGG + Intergenic
1200550587 Y:4574545-4574567 GTGTGTTTTTCACAATTCATAGG - Intergenic