ID: 1116862114

View in Genome Browser
Species Human (GRCh38)
Location 14:50003293-50003315
Sequence GCTCACGGCTGCAGCCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116862107_1116862114 16 Left 1116862107 14:50003254-50003276 CCTGAAATGGCAGAGTGTGTGTT 0: 1
1: 0
2: 0
3: 18
4: 246
Right 1116862114 14:50003293-50003315 GCTCACGGCTGCAGCCGCCCGGG 0: 1
1: 0
2: 1
3: 18
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116862114 Original CRISPR GCTCACGGCTGCAGCCGCCC GGG Intronic
900602709 1:3509864-3509886 ACTCACGGCTGCAGCCCCTACGG + Exonic
900918890 1:5658479-5658501 GCTCAGGGCTCCTGCCTCCCAGG - Intergenic
900970645 1:5991027-5991049 GCTCACCTCTGCACCCTCCCGGG - Intronic
901011667 1:6205994-6206016 CCTCAAGGCAGCAGCCACCCTGG + Intronic
901242228 1:7702189-7702211 GGTCATGGCTGCAGCAGCCCAGG - Intronic
901456504 1:9366132-9366154 GCTTCCAGCTGCAGCCTCCCAGG - Intronic
901879294 1:12184756-12184778 GCTGCCGCCTGGAGCCGCCCTGG + Intronic
901934176 1:12616680-12616702 CTTCAGAGCTGCAGCCGCCCAGG + Intronic
903023937 1:20413658-20413680 TCTCTCTGATGCAGCCGCCCTGG + Intergenic
903059843 1:20661904-20661926 GCTCACGGCTCCAGGGGCCATGG + Intergenic
905364386 1:37441174-37441196 GTTCAAGGCTGCTGCAGCCCAGG + Intergenic
905584343 1:39105334-39105356 GCCCGCCGCTGCAGCCGCGCCGG + Intronic
905745639 1:40415040-40415062 GCACAGGGCAGCAGACGCCCAGG - Intronic
905991061 1:42337109-42337131 GCTCACGGCTCCAACCGTCCTGG - Intergenic
907671391 1:56477675-56477697 CCTCCCGGCAGCCGCCGCCCCGG + Intergenic
907682792 1:56579524-56579546 GATCACAGCAGCAGCCGCCGCGG - Exonic
910678498 1:89839359-89839381 GCTCAGGCCTGTAGCCACCCTGG + Intronic
911048432 1:93648858-93648880 GCTCCTGGCTGCAGCTTCCCTGG + Intronic
911078901 1:93909158-93909180 GCCCATGGCAGCGGCCGCCCAGG + Exonic
911230911 1:95360692-95360714 ACTCTTGGCTGCAGCAGCCCTGG + Intergenic
912382229 1:109253855-109253877 GCACAGGGCTGCCGCCACCCAGG + Intronic
912510925 1:110189691-110189713 CCTCACTGCTTCAGCCACCCTGG + Intronic
913714322 1:121519066-121519088 ACTCCCGGCTGCAGCCTCTCCGG - Intergenic
915485389 1:156216686-156216708 GCTCTCCGCTGCGGGCGCCCGGG + Intronic
922335597 1:224616392-224616414 ACCCACTGCTGCAGCCACCCGGG + Exonic
922796362 1:228341662-228341684 GCACCCGGCTGCAGCCGCACAGG + Intronic
924216647 1:241829035-241829057 GCCCACGGCTGCAGCAGCTCAGG - Intergenic
1062968543 10:1628814-1628836 GCTCACGGCGGCCTCCGGCCAGG + Intronic
1063371592 10:5525920-5525942 GCTGAGGGCTGCAGCCCCCCTGG - Exonic
1063664500 10:8053435-8053457 GCCAGCGGCTGCAGCCACCCGGG + Intergenic
1068955847 10:62818172-62818194 GCGCACGGCTGCAGCGGTCGAGG - Intronic
1069411101 10:68154318-68154340 TTTCAAGGCTGCAGCAGCCCTGG + Intronic
1070162260 10:73873788-73873810 GCTGGCCGCTGCAGCAGCCCCGG - Intronic
1071688394 10:87787541-87787563 GCCCACTGCTGCAGCCTCCTGGG - Intronic
1072719097 10:97769987-97770009 CATCATGGCTGCAGCCGCCAGGG - Intronic
1076667201 10:132100098-132100120 GGTCACAGCTGCATCTGCCCTGG - Intergenic
1076683227 10:132185981-132186003 GCTCTGGGCGGCGGCCGCCCGGG + Intergenic
1077331748 11:1987024-1987046 GCTCCAGGCTGCCCCCGCCCTGG - Intergenic
1077466810 11:2737284-2737306 CCACACGGCAGCAGCTGCCCGGG - Intronic
1078146187 11:8723169-8723191 GCCCACGGCAGCAGCCACACTGG - Intronic
1078351974 11:10602237-10602259 GCTCAGGGCTGCACCACCCCAGG + Intronic
1081528491 11:43942808-43942830 GCCCCCGGCTGCTGCCTCCCGGG + Exonic
1081990347 11:47333985-47334007 GGCCACGGCTTCAGCTGCCCAGG - Exonic
1083062812 11:59892086-59892108 GCTCAGGTCAGCAGCCGCTCAGG - Intergenic
1083562236 11:63681884-63681906 ACTGACGGCTTCAGCCCCCCGGG + Intronic
1084471444 11:69361661-69361683 GAGCACGGCTGCAGCCTCCGGGG - Intronic
1084860570 11:72015315-72015337 GCGCAGGGCTGCAGATGCCCTGG - Exonic
1088579136 11:111299349-111299371 GGTCAGGGCCGGAGCCGCCCCGG + Exonic
1089300745 11:117497364-117497386 GCTCAGGGCTGCAGACCTCCTGG + Intronic
1089432495 11:118436069-118436091 GCTCAAGGCTGCAGGCGGCCCGG + Intergenic
1089622212 11:119728666-119728688 GCCGACGGCTGCAGCTGACCTGG - Exonic
1202814729 11_KI270721v1_random:42200-42222 GCTCCAGGCTGCCCCCGCCCTGG - Intergenic
1092195482 12:6547342-6547364 GATCACGGCTGCAGTGGGCCTGG + Intronic
1096476212 12:51910824-51910846 GGACACAGCTGCAGCAGCCCAGG + Intronic
1096504910 12:52086651-52086673 GCTCAGAGCTGCAGCCTCTCTGG + Intergenic
1098150268 12:67539289-67539311 GATCATGGCTGCAGCCACCATGG - Intergenic
1101592875 12:106139116-106139138 GCTCACGGCGGCCCCGGCCCCGG - Exonic
1102601913 12:114037704-114037726 GCTGGCGGCTGCAGCTGCCCTGG + Intergenic
1103703787 12:122860855-122860877 GCTCAGGGCAGCAGCAGGCCTGG - Intronic
1104749671 12:131230228-131230250 GCTGATGGCTGCAGCCAGCCCGG - Intergenic
1104783754 12:131437070-131437092 GCTCACAGCTGCAGCCAGCCCGG + Intergenic
1108088183 13:46818089-46818111 GGGCATGGCTGCAGCCGCCCAGG + Intergenic
1108521636 13:51251729-51251751 GCACACTGCAGCAGCCGCCCTGG + Exonic
1110026585 13:70547914-70547936 GCTCACTGCCTCAGCCTCCCAGG - Intergenic
1111622239 13:90739294-90739316 GCTCACTGCAGCTGCCTCCCAGG + Intergenic
1112609851 13:100945633-100945655 TCCCAAGGCTGCAGCAGCCCAGG - Intergenic
1113910611 13:113839590-113839612 CCTCAGGGCTGCAGCCTCCTTGG + Intronic
1113949859 13:114065943-114065965 ACTCACAGCTGCAGCGGCCGTGG + Intronic
1116862114 14:50003293-50003315 GCTCACGGCTGCAGCCGCCCGGG + Intronic
1120881453 14:89417496-89417518 GCCCACGGTCGCGGCCGCCCTGG - Intronic
1121589035 14:95085478-95085500 GCTCACGTCTGCAGCTGTCACGG - Intergenic
1122651982 14:103231208-103231230 GATCACAGCTGGAGCCCCCCAGG - Intergenic
1122801322 14:104231090-104231112 GCTCAGGTCTGCAGCTTCCCAGG + Intergenic
1123204479 14:106699114-106699136 GCACAAAGCCGCAGCCGCCCTGG + Intergenic
1123209486 14:106745585-106745607 GCACAAAGCGGCAGCCGCCCTGG + Intergenic
1123735546 15:23179900-23179922 GCTACCGGCAGGAGCCGCCCTGG - Intergenic
1124034688 15:26044400-26044422 GCTCACTGCCTCAGCCTCCCAGG + Intergenic
1124286261 15:28402883-28402905 GCTACCGGCGGGAGCCGCCCTGG - Intergenic
1124296442 15:28508753-28508775 GCTACCGGCGGGAGCCGCCCTGG + Intergenic
1124590370 15:31048185-31048207 GCTCACTGCAGCTGCCTCCCCGG - Intronic
1126436714 15:48645117-48645139 GCCCCCGGCGGCAGCAGCCCCGG + Intronic
1128139303 15:65287167-65287189 CCTCACAGCAGCAGCAGCCCTGG + Intronic
1129053776 15:72805453-72805475 GCTCACTGCAGCAGCCTCCTGGG - Intergenic
1131327829 15:91466012-91466034 GCTCACGGCTGGAGTTGCCAGGG - Intergenic
1132312069 15:100864548-100864570 TCTCATGGCTGTAGCCTCCCTGG + Intergenic
1132791595 16:1692559-1692581 GATCAGAGCTGCAGCCTCCCTGG + Intronic
1132806106 16:1775874-1775896 GCGCAGGGCTGCAGGCGGCCTGG + Exonic
1134074709 16:11282460-11282482 GCTCCCTGCTCCACCCGCCCTGG - Intronic
1135002617 16:18789926-18789948 TCTCACTGCTGCGGCCGCGCTGG - Intronic
1136630858 16:31488557-31488579 TCGCGCAGCTGCAGCCGCCCTGG + Intronic
1136776573 16:32874934-32874956 GCCCACGGGTGCAGATGCCCTGG - Intergenic
1136866974 16:33766843-33766865 GCTCCAGGCTGCATCCTCCCGGG - Intergenic
1136894042 16:33986579-33986601 GCCCACGGGTGCAGATGCCCTGG + Intergenic
1140825948 16:78706864-78706886 GGTCAAGGCTGCAGCCAGCCAGG - Intronic
1141022791 16:80513422-80513444 GCTCACTGCTGCAGACACCAGGG + Intergenic
1141190802 16:81823287-81823309 CCTCTCTGCTGCAGCTGCCCCGG - Intronic
1141392805 16:83678618-83678640 GCTGACGGCTGCAGAGGGCCAGG + Intronic
1141445572 16:84055618-84055640 GCCAATGGCAGCAGCCGCCCTGG - Intronic
1141533380 16:84661932-84661954 TCTCCCAGCTGTAGCCGCCCAGG - Exonic
1141720641 16:85753402-85753424 TCTCACGGCAGCAGCCTCCTGGG - Intergenic
1142209733 16:88803404-88803426 GCTCGAGCCTGCAGCCCCCCAGG + Exonic
1142213235 16:88818256-88818278 GCTCAAGCCTGCAGCGGCCCCGG + Intronic
1203078988 16_KI270728v1_random:1137043-1137065 GCCCACGGGTGCAGATGCCCTGG - Intergenic
1203105188 16_KI270728v1_random:1349359-1349381 GCTCCAGGCTGCATCCTCCCGGG + Intergenic
1203128326 16_KI270728v1_random:1613009-1613031 GCTCCAGGCTGCATCCTCCCGGG - Intergenic
1142549799 17:731991-732013 GCCAGCGGCTGCAGCCGCTCCGG - Intergenic
1142672265 17:1492661-1492683 GGACACGGCTGGAGCCGTCCAGG + Exonic
1142727965 17:1830158-1830180 GCTCGGGGCCGCAGCCACCCCGG - Intronic
1142836931 17:2594054-2594076 GGTCCGGCCTGCAGCCGCCCGGG - Intronic
1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG + Intronic
1144490586 17:15704895-15704917 GTTCATGGCTGCGGCCGGCCGGG + Intronic
1144852741 17:18252219-18252241 GCTCTTGTCTGCAGCCGCCAGGG + Intronic
1146577358 17:34006336-34006358 ACTCTGGGCTGCAGCCACCCTGG - Intronic
1151680393 17:75619906-75619928 GCTCCAGGGTGGAGCCGCCCCGG - Intergenic
1152341533 17:79728524-79728546 GCTCCAGGCTGCATCCTCCCGGG - Intergenic
1152571546 17:81123343-81123365 GCTCACGGCTGTCGCCCCACAGG - Exonic
1152934325 17:83127419-83127441 GGTCACGGCTGCTGCTGCTCAGG - Intergenic
1153565610 18:6414728-6414750 GCCCACGGCCGCCGCCGCGCGGG - Intronic
1155403989 18:25467745-25467767 GCACAGGGCTCCAGCAGCCCAGG - Intergenic
1157271051 18:46276580-46276602 GCTCACTGCTGCAGCAGATCTGG + Intergenic
1157794105 18:50559631-50559653 CCGCGCGGCTGCAGCCGCCGGGG - Intergenic
1160344618 18:78123196-78123218 GCTCCCTGCTGCAGGCGCTCAGG - Intergenic
1160745613 19:709587-709609 GCGCACGGCTCCTGGCGCCCTGG + Intronic
1161010556 19:1957676-1957698 GCCCACGTCTGCAGTCACCCGGG - Intronic
1161072458 19:2269721-2269743 TCTCACTGCTGCTGCCGCCGCGG - Exonic
1161504853 19:4638544-4638566 ACTCACAGCTGCATCCTCCCCGG + Intergenic
1165080370 19:33302992-33303014 GCTCTGCGCTGCAGCCTCCCCGG - Intergenic
1165176008 19:33930344-33930366 CCCCAAGGCTGCAGCCACCCTGG - Intergenic
1165956336 19:39504078-39504100 GCTCAGGGCTGCAGCCTGCTCGG - Exonic
1167323562 19:48810989-48811011 GATCATGGCCGCAGCCGCTCTGG - Exonic
1167559213 19:50215268-50215290 TCTCATGGCTGCCGGCGCCCCGG - Intronic
925101109 2:1246426-1246448 GCCCTCTGCTGGAGCCGCCCAGG - Intronic
926283125 2:11466214-11466236 TCTCCCGGCGGCTGCCGCCCGGG + Intergenic
927109043 2:19851284-19851306 GCTCATGGCTGCAGCATCCCCGG - Intergenic
927216636 2:20671107-20671129 GCTTGCGGCTGCAGCGGCTCCGG - Exonic
932419929 2:71595707-71595729 GCTCATGGCTGGATCCTCCCTGG + Intronic
932976004 2:76600338-76600360 GCTAAAGACTGCAGCCTCCCAGG - Intergenic
934993277 2:98936185-98936207 GCTCCCAGCTGCAGGCGCGCCGG + Exonic
937282533 2:120730194-120730216 GGACACTGCTGCAGCCGTCCTGG - Intergenic
942146227 2:173029719-173029741 TCTCACAGCTGCAGCCACCATGG - Intronic
948746174 2:240095743-240095765 GGCCACGGGTGCAGGCGCCCTGG + Intergenic
948836915 2:240630341-240630363 GCACACGGCCGCAGCCTGCCTGG - Exonic
1169056577 20:2626913-2626935 GCTCAGGGCTGCAGAAGCTCAGG - Intronic
1170898946 20:20441451-20441473 GGTCACTGCTGCAGAGGCCCAGG - Intronic
1173396233 20:42682727-42682749 GCTCAGGGCCGCTGCTGCCCAGG - Intronic
1175310872 20:58010921-58010943 GCTGAAGGCTGCAGGCTCCCAGG - Intergenic
1175859401 20:62142588-62142610 GGGCCGGGCTGCAGCCGCCCGGG - Intronic
1176546936 21:8206234-8206256 GCTCTCCGCTGCGGGCGCCCGGG + Intergenic
1176554841 21:8250443-8250465 GCTCTCCGCTGCGGGCGCCCGGG + Intergenic
1176565887 21:8389281-8389303 GCTCTCCGCTGCGGGCGCCCGGG + Intergenic
1176573762 21:8433468-8433490 GCTCTCCGCTGCGGGCGCCCGGG + Intergenic
1180039869 21:45270365-45270387 GCTCACAGCTGCAAACTCCCCGG + Intronic
1181055017 22:20256737-20256759 GATCATGGCTGCAGCAGGCCTGG + Intronic
1181633409 22:24163280-24163302 GCTCAGGGCTGGAGGTGCCCTGG + Intronic
1181751217 22:24990545-24990567 GCCCACGCCAGCAGCAGCCCTGG + Intronic
1183605853 22:38866433-38866455 GGTCACAGCTGCTGCCGGCCCGG - Exonic
1184640727 22:45868608-45868630 GGTCACGGCTGCACCTTCCCTGG + Intergenic
1185320037 22:50196382-50196404 GCTCACACCTGCACGCGCCCAGG - Intronic
1203251811 22_KI270733v1_random:122519-122541 GCTCTCCGCTGCGGGCGCCCGGG + Intergenic
1203259862 22_KI270733v1_random:167602-167624 GCTCTCCGCTGCGGGCGCCCGGG + Intergenic
950743023 3:15064860-15064882 CGTCACGACTGCAGCCGGCCCGG + Intronic
950956421 3:17058214-17058236 GCTCACTGCTGCTGCTGGCCGGG - Intronic
952919610 3:38275700-38275722 CCACAGGGCTGCAGCCTCCCTGG + Intronic
953886384 3:46716693-46716715 GCTCACTGCTGCAGCCGCTTTGG + Intronic
954215830 3:49124025-49124047 GGTCACTGCAGCTGCCGCCCAGG - Exonic
954364725 3:50139745-50139767 GCTGAGGGCTTCAGCCTCCCAGG - Intergenic
955203860 3:56877445-56877467 GCTCACTGCAGCAACCTCCCAGG + Intronic
956850146 3:73221246-73221268 GCTCACTGCAGCAACCTCCCAGG - Intergenic
962811614 3:138963282-138963304 GCTCAGGGCTGCAGGCGGCTGGG - Intergenic
966411944 3:179653553-179653575 GTCCTCGGCTGCAGCAGCCCTGG - Intronic
968468330 4:764394-764416 TCCCACGGCTGCAGCCTCCAGGG - Intronic
969121695 4:4915664-4915686 GCTCACTGCAGCAGTCTCCCTGG + Intergenic
969522900 4:7689142-7689164 GCTCACGGATGCAGCTGCTGGGG - Intronic
969716710 4:8871485-8871507 CCTCCCGGCTGCCGTCGCCCTGG + Exonic
982122779 4:152158475-152158497 GCTCTGGGCTGCAGCCACCCTGG - Intergenic
985789375 5:1916968-1916990 ACTCACAGACGCAGCCGCCCTGG + Intergenic
985792492 5:1937711-1937733 CCTCAGGGCTGCAGCTGCCCGGG + Intergenic
993716558 5:91280653-91280675 GCCCCGGGCTGCGGCCGCCCAGG - Intergenic
994313929 5:98310132-98310154 CCTCCCAGCTGCAGCCACCCAGG + Intergenic
997233456 5:132259291-132259313 GCTGACGGCTGCAGGCGGCAGGG + Intronic
999238307 5:150113156-150113178 CCTCACGGCTGCAGCATCTCAGG - Intronic
1002140515 5:177134535-177134557 GCTCTGGGGTGCAGCCGCCTCGG + Intronic
1002567128 5:180118565-180118587 GTTCCCTGCTGCAGCCCCCCTGG + Intronic
1005299161 6:24454124-24454146 GCACCAGGCTACAGCCGCCCCGG - Exonic
1005303028 6:24489551-24489573 GCTCAGAGCTGCAGCAGCACTGG + Exonic
1006655697 6:35590468-35590490 GCTCCCAGCAGCAGCCGACCTGG - Intronic
1013117468 6:107114441-107114463 GCTCCCGGCCGCCGCCGCCGCGG + Intronic
1014561654 6:122898460-122898482 GCTCAAGGCTGCTGGCACCCTGG - Intergenic
1016688251 6:146905751-146905773 GGCCACTGCTGCAGCCTCCCTGG - Intergenic
1018922309 6:168183777-168183799 GCTGACACCTGCTGCCGCCCTGG - Intergenic
1019421259 7:952350-952372 GCTCACGGCTGGTGCAGACCTGG - Intronic
1019472694 7:1229827-1229849 GCTCGGGGCTGCGGCCGGCCGGG - Intergenic
1019560664 7:1654963-1654985 GCGCACCCCTGCAGCAGCCCGGG + Intergenic
1019623446 7:2003569-2003591 GCTCACACCTGCAGCCTCCACGG - Intronic
1020462862 7:8443510-8443532 GAACACGGCTGGAGCCACCCAGG + Intronic
1034150401 7:148910631-148910653 CCTCACTGCTGCAGCCTCCAGGG + Intergenic
1034475124 7:151277147-151277169 GCTCCGGGCTGCAGCGGCGCAGG - Intronic
1034670930 7:152857870-152857892 GCTCAAGGCTGCAGGAGCCAGGG + Intergenic
1035203767 7:157281801-157281823 GCTCACCTCTCCAGCCTCCCCGG - Intergenic
1035567381 8:650510-650532 CCTCCCAGCAGCAGCCGCCCCGG + Intronic
1035751988 8:2002641-2002663 GCTCGCGGCTGCTGCTGCACGGG - Exonic
1038508108 8:28103803-28103825 GCTCACTGCAGCAACCTCCCAGG + Intronic
1038540418 8:28386077-28386099 GCTCCGGGCTGCAGCGGCCGCGG + Intronic
1038548474 8:28444550-28444572 GCTCACTGCAGCCTCCGCCCTGG + Intronic
1042722677 8:71842462-71842484 GCCCACGGCTACAGCTGCGCCGG - Exonic
1049756353 8:144312815-144312837 GGTCTCGGCTGCTGCCGCCCAGG - Intronic
1050204410 9:3181729-3181751 GCTCAGGGCTGCCGCCCCGCTGG - Intergenic
1052491167 9:29169920-29169942 GCTCACTGCTTGAGCCTCCCAGG - Intergenic
1056759654 9:89405493-89405515 GCTCACGGCAGCAGGTGGCCGGG + Exonic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1061674751 9:132209463-132209485 TCTCAGGGCTGCAGCCCGCCCGG - Intronic
1062415036 9:136444356-136444378 GGTCACTGCTGCACCCGCCCCGG + Intronic
1062588926 9:137264256-137264278 GCTCTCGGATGCAGGCGTCCAGG - Exonic
1062642946 9:137530814-137530836 GCTCACGGCTGCTGCTGTTCAGG + Intronic
1203772660 EBV:57535-57557 GCCCACGCCATCAGCCGCCCCGG - Intergenic
1203468213 Un_GL000220v1:105670-105692 GCTCTCCGCTGCGGGCGCCCGGG + Intergenic
1203476034 Un_GL000220v1:149642-149664 GCTCTCCGCTGCGGGCGCCCGGG + Intergenic
1187393810 X:18903438-18903460 GCCCACGGCCACAGCTGCCCGGG - Intronic
1190735087 X:53250687-53250709 GCTGATGGCTGCAGCCCCCATGG - Exonic
1192079405 X:68032745-68032767 GCTGTCTGCTGCAGCCACCCTGG - Intergenic
1195750986 X:108161877-108161899 CATCAAGGCTGCAGCCGCCTGGG + Intronic
1199593452 X:149488718-149488740 GCTCCTGGCTGCAGCAGCACAGG - Intronic
1199598565 X:149526713-149526735 GCTCCTGGCTGCAGCAGCACAGG + Intronic
1200064990 X:153499961-153499983 GCTCAGGGGGGCAGACGCCCAGG + Intronic
1200093818 X:153648025-153648047 GCTCGCGGCTGCGGCAGTCCAGG - Exonic
1200103288 X:153699106-153699128 GCCCACGGGTGCAGATGCCCTGG + Intergenic
1200108292 X:153726217-153726239 GCTCACGGCTGCCTGCCCCCGGG - Intronic
1200152515 X:153958204-153958226 GCTGAAGACTGCAGCCGCCCAGG - Exonic