ID: 1116862173

View in Genome Browser
Species Human (GRCh38)
Location 14:50003470-50003492
Sequence GGGCGTCCCCGCGCCCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116862173_1116862182 10 Left 1116862173 14:50003470-50003492 CCCCCGGGGGCGCGGGGACGCCC 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1116862182 14:50003503-50003525 TATCAGCTGCCACGCCCGCGTGG 0: 1
1: 0
2: 0
3: 5
4: 28
1116862173_1116862184 14 Left 1116862173 14:50003470-50003492 CCCCCGGGGGCGCGGGGACGCCC 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1116862184 14:50003507-50003529 AGCTGCCACGCCCGCGTGGGCGG 0: 1
1: 0
2: 1
3: 16
4: 345
1116862173_1116862183 11 Left 1116862173 14:50003470-50003492 CCCCCGGGGGCGCGGGGACGCCC 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1116862183 14:50003504-50003526 ATCAGCTGCCACGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116862173 Original CRISPR GGGCGTCCCCGCGCCCCCGG GGG (reversed) Intronic
900125896 1:1068850-1068872 GGGCGCCCCCGCCCACCCGATGG - Intergenic
900342219 1:2194617-2194639 GTGCTTCCCGGCGCCCCCGCGGG - Intronic
900528323 1:3140158-3140180 AGTGGTCCCCGCTCCCCCGGCGG + Intronic
900581530 1:3412147-3412169 GGGCGGCTTGGCGCCCCCGGGGG + Exonic
901039506 1:6355527-6355549 GGTCGTCCCTGCGCCCCAGGTGG - Intronic
901489275 1:9588612-9588634 GAGCGCCCCCGCGCGGCCGGAGG - Intergenic
901489445 1:9589145-9589167 GGGGGTCTCCGCGCGCCCGCGGG - Intronic
901673103 1:10867303-10867325 GGCCGTCCCCGCGCCGCCCGCGG - Intergenic
903413738 1:23167943-23167965 GGGCCTCCCCCCGCCCGCCGCGG - Intronic
903446260 1:23424509-23424531 GGGCTTGCCCGCGCCTCCCGGGG + Intronic
903466424 1:23555067-23555089 GGGCGCCGCAGCGCCGCCGGTGG + Intergenic
904583683 1:31566741-31566763 GGGCCTCCCTGGGCTCCCGGAGG - Intergenic
905544054 1:38783744-38783766 GGGCCAGCCCGCGCTCCCGGGGG + Intergenic
905734357 1:40315636-40315658 GGGGGGCCCCGCTCTCCCGGTGG + Exonic
910251375 1:85201520-85201542 CGGGGTCCCCGCGGCACCGGGGG - Intergenic
910876906 1:91886265-91886287 GGGCGGCCGAGAGCCCCCGGTGG - Exonic
911052273 1:93681353-93681375 GGGAGTCCCAGCGCGCTCGGAGG + Intronic
913963153 1:143354336-143354358 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
914057509 1:144179922-144179944 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
914121637 1:144786444-144786466 CGGAGTCCCCGGCCCCCCGGAGG - Intergenic
914808379 1:151008415-151008437 CGGCGTCGCCCCGCCCCCAGCGG - Intronic
917797526 1:178542736-178542758 CGACGCCCCCGCGCCCCCGCCGG + Intronic
921599287 1:217089724-217089746 GGCCGGCCCCGCGCCCGCGGGGG - Intronic
922476700 1:225911509-225911531 GGACCTCCCCGCGCCGCCAGAGG - Intronic
922558144 1:226548725-226548747 CGGCGTCCCCACACGCCCGGCGG - Intergenic
924801543 1:247332079-247332101 GGGCTTCCCCGCGGGCCCGCCGG + Intergenic
1063994968 10:11611170-11611192 GGGCCTCCCCGCACCCCGCGCGG + Intronic
1066370637 10:34815525-34815547 GAGGGGTCCCGCGCCCCCGGAGG - Intergenic
1067071897 10:43138518-43138540 GGGTGTCCCCGCGGCGCAGGAGG + Exonic
1068783474 10:60944854-60944876 GTGCGTCCCTACGCCCCCTGGGG - Intronic
1069438532 10:68407306-68407328 GGGCGCCCTCCCGCCGCCGGGGG - Intergenic
1069913472 10:71773415-71773437 GGGCGTCCCCACGGCCCTGGAGG - Exonic
1073122616 10:101131770-101131792 GGAGGTCCCGGCGGCCCCGGAGG + Exonic
1073459961 10:103660683-103660705 TGGGGTCCCCGTGCCCTCGGAGG - Intronic
1073509465 10:104034274-104034296 GGGGGTCCCTGCGGCCCAGGAGG + Exonic
1074182880 10:111078752-111078774 CGCCGTCGCCGCGCCGCCGGGGG + Exonic
1075999842 10:126905727-126905749 CGGCCGCCCCGCGCCCCCGGCGG + Intronic
1076872125 10:133199317-133199339 GGGCGGCCCCGAGTCCCCTGTGG - Intronic
1077049789 11:561431-561453 GGGCGCCTCCGCGCCGCCCGGGG + Exonic
1077215249 11:1392690-1392712 GGGCGTCCTCCAGGCCCCGGTGG - Intronic
1077915947 11:6611783-6611805 GGGTGGCGCGGCGCCCCCGGAGG - Exonic
1080458447 11:32434967-32434989 GGGCGGCCCCGCGCCGCCACCGG - Exonic
1081636886 11:44727333-44727355 GGGGGTCCCCAGGTCCCCGGGGG - Intronic
1083228769 11:61301748-61301770 GGCCCTCCCCGCCCCCCTGGAGG - Intronic
1083758453 11:64803331-64803353 GGGCTTCCCCGCGCCGCCGAGGG - Intergenic
1085010913 11:73141519-73141541 GGGCGTCCCCGCCTCCCCCTCGG + Intronic
1090275030 11:125413088-125413110 GGGCAGCCCCACGCCCCCAGAGG - Intronic
1090890232 11:130916517-130916539 GAGCGTCCGCGCGCGCCCCGAGG + Intergenic
1091124505 11:133082791-133082813 GGGCCTCCTCGCGGCCCGGGCGG + Intronic
1096627255 12:52903571-52903593 GAGGGGCCCCGGGCCCCCGGCGG - Intronic
1097709497 12:62902554-62902576 TGGGGTCCCCCCGCCCCTGGGGG + Intronic
1099202077 12:79689924-79689946 GGGCGGCCCCCGGCCCGCGGCGG - Exonic
1104031255 12:125066789-125066811 GGGAGTCCCTGCGCCAGCGGAGG - Intronic
1106157659 13:27172255-27172277 CGCCGTCCCCTCGCCCGCGGTGG - Intergenic
1106246563 13:27954619-27954641 GAGCCTCCCCGCGCTCCCAGCGG - Intergenic
1113494036 13:110713961-110713983 TGGGGTCCCCGCGGACCCGGAGG + Intronic
1113758689 13:112832742-112832764 GGGGGTCCCCGCGGCCACGAAGG - Intronic
1114070091 14:19098979-19099001 GGGTGACCCCGCGCCCTCGCCGG + Intergenic
1114092171 14:19301023-19301045 GGGTGACCCCGCGCCCTCGCCGG - Intergenic
1115592075 14:34874445-34874467 GGGAGTCCCCACACCCCCCGCGG + Intronic
1116862173 14:50003470-50003492 GGGCGTCCCCGCGCCCCCGGGGG - Intronic
1118285263 14:64465376-64465398 GCGCCGCCCCGCGCCTCCGGCGG + Intronic
1122543320 14:102509555-102509577 GGGCGTCCCCGCCCCTGCCGCGG + Exonic
1122598049 14:102907205-102907227 GGGGGTGCCCACGGCCCCGGTGG - Exonic
1129108243 15:73323238-73323260 AGGCCTCCCCGGGCCCCGGGTGG + Exonic
1130040932 15:80404628-80404650 CTGCGGCTCCGCGCCCCCGGGGG - Intronic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1131838886 15:96416186-96416208 GGGCTTCCCCGCGCCGGCGTGGG + Intergenic
1131873353 15:96781949-96781971 GGGAGTTCCCCCACCCCCGGGGG + Intergenic
1131892153 15:96984263-96984285 GAGCCTCCCCGCGCCGCCGTGGG - Intergenic
1132675064 16:1118122-1118144 GGGTGTCCCCGAGACCCCGGGGG + Intergenic
1132846187 16:2001933-2001955 GAGGGTCCCCGAGCCCCAGGTGG + Intronic
1132868330 16:2104532-2104554 GGGCGTCACGGTGCCCGCGGTGG + Exonic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1134523399 16:14928469-14928491 GGGCGTCACGGTGCCCGCGGTGG - Intronic
1134710993 16:16326953-16326975 GGGCGTCACGGTGCCCGCGGTGG - Intergenic
1134948590 16:18341656-18341678 GGGCGTCACGGTGCCCGCGGTGG + Intergenic
1135040638 16:19114548-19114570 GGGCGCCCCCGCTTCCCCGCAGG - Exonic
1137261136 16:46830996-46831018 GGGCCTCGCCGGGCTCCCGGAGG - Intronic
1139451218 16:67029298-67029320 GGGCGTCCGGGCGCCGCGGGTGG + Exonic
1141079237 16:81036044-81036066 CGCTGTCCCCGCGCCGCCGGCGG + Exonic
1141582830 16:85011809-85011831 GTGTGTACCCGCGCCCGCGGCGG + Intergenic
1142128449 16:88421513-88421535 ACGCGTCCCCGAGCCCCTGGAGG + Intergenic
1144500858 17:15786254-15786276 GGGCCGCCCCCCGCCCCCCGCGG + Intergenic
1144870023 17:18363545-18363567 GGGCTTGGCCCCGCCCCCGGAGG + Intronic
1145163019 17:20588916-20588938 GGGCCGCCCCCCGCCCCCCGCGG + Intergenic
1146058612 17:29593265-29593287 GTGCGCCCCCGCGCCCGCTGCGG + Intronic
1146339678 17:32007870-32007892 GGCTGCCCCCGCGCCCCCGCCGG - Intronic
1147311739 17:39599627-39599649 GGGGGTTCCCGCGACCCCTGTGG + Intergenic
1147883002 17:43665804-43665826 GGGCCCCCCCACGCCCCTGGGGG - Intergenic
1148203101 17:45762948-45762970 GGGCGGCCCCTCCCCCCGGGGGG - Intergenic
1148406883 17:47423727-47423749 GGGCGTTCCCGGGCGCACGGCGG + Intronic
1148432102 17:47650498-47650520 GGGCCTTCCCGCCCTCCCGGAGG + Intronic
1150108554 17:62479006-62479028 GGCCGGTCCCGCGCCCCCCGCGG + Exonic
1151964951 17:77426333-77426355 GTGCCCCCCCGAGCCCCCGGAGG + Intronic
1152215186 17:79027879-79027901 GGGGGTCCCCGTGCCCCTGCTGG - Intronic
1152542037 17:80981416-80981438 GGGCGGCCCCCAGACCCCGGTGG - Intergenic
1152551927 17:81034536-81034558 GGGGGTCGCCGCCCGCCCGGCGG + Intergenic
1152639045 17:81442141-81442163 GGGCGGCCCCGCACCCCGAGGGG + Exonic
1152662188 17:81547698-81547720 GGGTGTCCCCCCGCTCCCGGGGG - Intronic
1152756753 17:82090247-82090269 GGGTGTCCCCGGGCCAGCGGGGG + Intronic
1153855180 18:9137479-9137501 GGGCGCGCCCCCGCCCCCGCGGG - Intronic
1160510542 18:79451133-79451155 GGACGTCCACGCGCCCACAGGGG + Intronic
1160804114 19:984258-984280 CGGCGGCCCCGCGGCCCCAGCGG - Exonic
1160822593 19:1065436-1065458 GGGCCTCCCCGCGGCCCCGCAGG - Exonic
1161175989 19:2842162-2842184 GGGCGTCTCCGCCCCCGCCGAGG - Intronic
1161510944 19:4670528-4670550 CGGCGGCCCCGCCCCCTCGGCGG - Intergenic
1162128244 19:8510881-8510903 CGGCGCCCCCGCGGCCCCCGCGG - Exonic
1162683797 19:12365431-12365453 GGGCGTCCCCGCGGCGACTGCGG - Intronic
1163390303 19:17026718-17026740 GGCCGTCCTCGCGCCGCCGCCGG + Exonic
1165745875 19:38229351-38229373 AGGCGCCCCCGCGACCCTGGAGG + Intronic
1165888925 19:39099087-39099109 GGGTGTCCCTGCGCAGCCGGGGG - Exonic
1167103888 19:47419438-47419460 GGGCCGCCCCCCGCCCCCTGCGG - Intronic
1167268964 19:48497703-48497725 GGCCGTCCCCGTGCCCACTGGGG + Exonic
1167578909 19:50330825-50330847 GGCCGTCCCCGCCCCCTGGGCGG + Intronic
1168111006 19:54191267-54191289 GGGCTTCGCCGAGACCCCGGAGG + Intronic
1168324492 19:55531014-55531036 GGGCCTCCCCTACCCCCCGGAGG - Intronic
1202696993 1_KI270712v1_random:132595-132617 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
928823631 2:35392196-35392218 GGGCATCCCTGCACCCCAGGCGG - Intergenic
930011446 2:46941140-46941162 AGGCCTCCCCACGCCCCCGCGGG + Intronic
933782346 2:85811306-85811328 CGGCCTCCCCCCGCCCCCGCAGG + Intergenic
934278154 2:91589609-91589631 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
934678261 2:96265352-96265374 GGGCAGCCCTGCGCCTCCGGGGG + Exonic
935695657 2:105768846-105768868 GGGAGTCCCCATGCCCCCTGGGG + Intronic
938265225 2:129923426-129923448 GAGGGTCCCAGCGCCCCCTGGGG - Intergenic
939004122 2:136765935-136765957 GGGCGTCCCCGCCCGCCTAGAGG - Intronic
944237416 2:197453143-197453165 GGGCTTCCCGCAGCCCCCGGGGG + Intergenic
946362834 2:219229404-219229426 GCGCGCCCCCGCCCCGCCGGCGG + Intronic
946382580 2:219358881-219358903 TGGCGTCCCAGCCCCCCGGGCGG + Intergenic
947506584 2:230712766-230712788 GGGCGCCCCCGAGCGGCCGGCGG - Intergenic
948046968 2:234952219-234952241 GCACGACCCCGCGCCCCCGCCGG - Intronic
948436186 2:237955970-237955992 AGGCGTCCCCCCAACCCCGGCGG + Intergenic
948436284 2:237956297-237956319 GGGCGCCTCCGCGTCCCCCGCGG + Intergenic
1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG + Exonic
1172118726 20:32585503-32585525 GGCTGCCCCCGCGCCCCCAGGGG - Intronic
1173880328 20:46406769-46406791 GGCCGTCCCCGCCCCCCTAGTGG + Intronic
1175237682 20:57525510-57525532 GGGTCTCCCAGCGCCCCCTGCGG - Intronic
1175562316 20:59940460-59940482 GGGCGTCCCCGCGCGGGCGCCGG + Intronic
1176034664 20:63030375-63030397 GGGCGTCCACGCGCTCCCATGGG + Intergenic
1176159843 20:63642423-63642445 GGGGGTCCCGGCGCCCACCGAGG - Intronic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1184409457 22:44318101-44318123 GGACTTCCCCGCCCCCACGGTGG - Intergenic
1184465774 22:44668452-44668474 GGGCGTCCCGGGTCACCCGGCGG - Intergenic
1185344970 22:50307124-50307146 GGCCGTCCCCGCACCCCCTGGGG - Intronic
952942610 3:38455265-38455287 GGACGTCCCGGCGCGCCCGCCGG - Intronic
955298695 3:57756879-57756901 GAGCGTCCCCGCGACCAGGGCGG - Exonic
955688179 3:61564722-61564744 GGGCGCCCCCGAGCCACTGGTGG + Intronic
961965143 3:130894273-130894295 GGGCGCCCCCGCGAGCCCCGCGG + Intronic
964219153 3:154324358-154324380 GGGGGTCCCCGCAGCTCCGGTGG - Exonic
965590389 3:170356878-170356900 GGGCTGCCCCTCGCCCCCGCGGG - Intergenic
966982623 3:185152578-185152600 GGGCGTCCCCCGGACCGCGGCGG + Intronic
968660121 4:1795376-1795398 GGGAGGCCCCGCGCGCCCGCAGG - Intronic
969114017 4:4860194-4860216 GGGGCTCCCAGCGACCCCGGCGG - Exonic
970394855 4:15655421-15655443 GCGCGCCCCCGCGTCCCCGCCGG - Intronic
981429839 4:144645998-144646020 GCGCGTCCCCCGGGCCCCGGCGG - Intergenic
983940228 4:173529401-173529423 GGGCGGGCCCGGGCGCCCGGGGG - Exonic
985616210 5:923353-923375 GGGCGTCCCTGTGCCCCCCAAGG + Intergenic
986233972 5:5890672-5890694 GGGTCTCCCAGAGCCCCCGGGGG + Intergenic
987050756 5:14144759-14144781 GGGCGTCCCCGGTACCCCAGCGG + Intronic
989537523 5:42581846-42581868 GGGCATCCCCGTGCTCTCGGGGG + Intronic
992939613 5:81750362-81750384 GCGCGTCTCCGCGCCCCGCGGGG + Intronic
995462564 5:112419295-112419317 GCGCGTCCCCGCGCATCCTGCGG + Exonic
995764590 5:115602045-115602067 AGCCCACCCCGCGCCCCCGGCGG + Intronic
998208337 5:140175349-140175371 GCGCGTCCCCGGGCTCCCTGGGG + Intronic
999395433 5:151223974-151223996 CGGCGTCCGGGAGCCCCCGGAGG - Exonic
1000345846 5:160312628-160312650 CGGCGCCCCCGCGCCCCGCGGGG + Intronic
1002638943 5:180621509-180621531 GCGCGTCCCCGCCCTCCCCGCGG + Intronic
1003552124 6:7108837-7108859 GGGCAGCCCCGCGCCCTCGCGGG + Intronic
1006431896 6:34002320-34002342 GGGCGTCCCCTTCCCCCCGAGGG - Intergenic
1010032789 6:71288509-71288531 GGGCGTCCCCCGGCTCCGGGCGG + Intergenic
1013538826 6:111087809-111087831 GCTCGGCCCCGCGCCCACGGGGG + Exonic
1017810625 6:157981486-157981508 GGGAGGCGCAGCGCCCCCGGCGG + Intergenic
1018696165 6:166393438-166393460 GAGCCTCCCCCCGCCCCCGTAGG - Intergenic
1019340116 7:504884-504906 GGGAGCCCACGCGCCCGCGGTGG - Intronic
1020037632 7:4974340-4974362 GGGCGTCTCCAAGCCCCCTGCGG + Intergenic
1020560546 7:9726143-9726165 GGCCGTCCTCGCGCCGCCGCCGG - Intergenic
1021992609 7:26152474-26152496 GGGCGTTCCCGGGCGCGCGGCGG + Exonic
1029121352 7:98270434-98270456 GGGCCTCCCAACGCCCCCGATGG + Intronic
1029437845 7:100572823-100572845 GGGCAGCCTTGCGCCCCCGGGGG + Intronic
1029730144 7:102433530-102433552 GGGGGACCCCGCGCGACCGGCGG + Exonic
1032122869 7:129169348-129169370 GGTGGTCCCCGCCCCCGCGGCGG + Intronic
1034306329 7:150047785-150047807 GTCCTTCCCCACGCCCCCGGAGG - Intergenic
1034800518 7:154052868-154052890 GTCCTTCCCCGCGCCCCCGGAGG + Intronic
1035732959 8:1865536-1865558 GGGCGTCCCCCGGCACCCAGGGG + Intronic
1036664556 8:10730322-10730344 GGCCGTCCCCCGGCCCCCGGGGG - Intronic
1037819910 8:22130582-22130604 GAGCGCCCCCGCCGCCCCGGGGG - Exonic
1037855451 8:22367814-22367836 CTGCGTCCCCGGGCCCCCGCCGG + Intronic
1037877210 8:22554105-22554127 TGGCTTCCCCACTCCCCCGGAGG - Intronic
1039918413 8:41876175-41876197 GGCCGTCCCCGCGCCCGCCTGGG - Intronic
1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG + Exonic
1048985378 8:139732125-139732147 GGGCGACCCCGTGCGCCTGGAGG - Exonic
1049585407 8:143430505-143430527 CGGCGCCCCCCCGCCCCCGCCGG - Intergenic
1051604420 9:18906354-18906376 GTGAGTCCCCGTGCCCCAGGGGG - Intronic
1051929022 9:22363564-22363586 GAGCCTCCCCGCTCCCCGGGTGG - Intergenic
1052691358 9:31820586-31820608 GGGCATCCCCGCACTCCTGGGGG + Intergenic
1052740065 9:32384504-32384526 GGGCGCCCCCGCGGGCCTGGAGG - Intergenic
1057076815 9:92142239-92142261 GGGCCTCCCGGCTCCCCCAGGGG + Intergenic
1057408265 9:94793224-94793246 GGGCGTCCCAGCGACTCGGGAGG + Intronic
1057772681 9:97982859-97982881 GGGCGGCCCGACGCCCGCGGAGG - Intergenic
1058843475 9:108933671-108933693 GCGCCTCCCAGCGCCCCCGATGG + Intronic
1061208498 9:129177594-129177616 GAGCGCCCCCGCGCCGCCCGCGG + Exonic
1061261268 9:129482285-129482307 AGGCGTCCCCACGCCGCCCGGGG - Intergenic
1061397203 9:130349622-130349644 AGGGGTCCCCACGCCCCAGGTGG + Intronic
1061453513 9:130681668-130681690 GAGCGCGCCCGCGCCCCCGCCGG + Exonic
1062162342 9:135087420-135087442 TGGAGTCCCCGCGCCGCCGCCGG + Intronic
1062482333 9:136758290-136758312 GGGGGTCACCGAGCCCCAGGTGG - Intronic
1062600164 9:137315904-137315926 GGGCGCCCCGGAGCCCCCGGAGG - Intronic
1062656671 9:137607212-137607234 GGGTGTACCGGGGCCCCCGGGGG + Intronic
1062685255 9:137809407-137809429 CGGCGGCCCTGCGCCCTCGGAGG + Intronic
1185621723 X:1454067-1454089 GGGGGTCCCCGCGGGCCGGGTGG + Intergenic
1185621746 X:1454114-1454136 GGGGGTCCCCGCGTGCCTGGTGG + Intergenic
1187825842 X:23333454-23333476 GGGCTCCCCCGCGCCCCCTGCGG + Intergenic
1189333895 X:40158412-40158434 GGGCGTTCCCGGGCTGCCGGGGG + Intronic
1197448478 X:126581125-126581147 GGGTGGCCCCGCGGGCCCGGGGG - Intergenic
1200128889 X:153830589-153830611 GCGCGCCCCCGCGCTCCCTGGGG - Intergenic
1200178676 X:154136895-154136917 GGGCCTTCCCGCGTTCCCGGGGG + Intergenic