ID: 1116862455

View in Genome Browser
Species Human (GRCh38)
Location 14:50005525-50005547
Sequence TTAAATAAGCAGCAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 407}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116862453_1116862455 -7 Left 1116862453 14:50005509-50005531 CCGAAGCAGCAGACACTTAAATA 0: 1
1: 0
2: 1
3: 14
4: 236
Right 1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG 0: 1
1: 0
2: 3
3: 34
4: 407
1116862452_1116862455 -6 Left 1116862452 14:50005508-50005530 CCCGAAGCAGCAGACACTTAAAT 0: 1
1: 0
2: 2
3: 17
4: 174
Right 1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG 0: 1
1: 0
2: 3
3: 34
4: 407
1116862450_1116862455 2 Left 1116862450 14:50005500-50005522 CCTGAGGCCCCGAAGCAGCAGAC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG 0: 1
1: 0
2: 3
3: 34
4: 407
1116862451_1116862455 -5 Left 1116862451 14:50005507-50005529 CCCCGAAGCAGCAGACACTTAAA 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG 0: 1
1: 0
2: 3
3: 34
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116862455 Original CRISPR TTAAATAAGCAGCAGGAAGA AGG Intronic
900762826 1:4484221-4484243 TTAAAGAAGGAGAAGGAAAAGGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903139963 1:21333405-21333427 TAAAATAAGTAGCAGAGAGATGG + Intronic
903251156 1:22053531-22053553 TTAACCAAGCAGCAGAACGACGG - Intronic
903927714 1:26842643-26842665 TAAAATGGGCAGCATGAAGAAGG - Intronic
904489687 1:30850699-30850721 TTAAAACAGCAGCAGGCACATGG - Intergenic
904912399 1:33945149-33945171 TTAAAGAAGCACCACCAAGAAGG + Intronic
906182723 1:43835746-43835768 TTTCATAAACAGCAGAAAGATGG - Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
907446293 1:54510080-54510102 ATAAAAAAGCAGCAGGAACTGGG + Intergenic
907710055 1:56871981-56872003 TTAAATAAGCAACAGGGATCTGG - Intronic
908001982 1:59689269-59689291 GCAGAGAAGCAGCAGGAAGAGGG + Intronic
909480623 1:76125798-76125820 TTAAAAATGCATCAGGATGAAGG - Intronic
909572252 1:77128242-77128264 TTAAAGAAGCACAAGAAAGATGG + Intronic
909808670 1:79904703-79904725 TTTTATTAGCAGCACGAAGACGG - Intergenic
910376118 1:86573160-86573182 TAAATTAAGCAGGAGAAAGACGG + Intronic
910596850 1:88990321-88990343 TAAAATGAGCAACAGGGAGATGG - Intronic
910682861 1:89885103-89885125 TTTAATAGGCAGCAGACAGATGG - Intronic
911286855 1:96005484-96005506 ATAAATAAGTAAAAGGAAGATGG - Intergenic
911714255 1:101112499-101112521 TTAAAAATGCAGAAGGAAAAGGG - Intergenic
911891041 1:103372184-103372206 TTAAATAAGAGGGAGGAAGGAGG - Intergenic
912185101 1:107265956-107265978 TGAGACAAGGAGCAGGAAGATGG - Intronic
913494911 1:119419618-119419640 TTAAATGAGGATCAGAAAGAAGG + Intronic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
915415634 1:155740467-155740489 TTAAATTATCATCAGGAATATGG - Intergenic
915929177 1:160048106-160048128 TTAAATTAGGAGCACAAAGATGG - Intronic
917745798 1:178005730-178005752 AGAAATTAGCAGAAGGAAGAGGG - Intergenic
917846542 1:179025462-179025484 TTAAAAAGGCAACAGGAGGAGGG + Intergenic
918795250 1:188886877-188886899 TTAAATTGGGAGCAGAAAGATGG + Intergenic
920838493 1:209534157-209534179 ATAAATTAGCAGTAGGAAGGAGG + Intergenic
921304182 1:213779364-213779386 TTAGATAGGCAGCAGGGTGAAGG - Intergenic
921586652 1:216954441-216954463 TAAATTAAGCAGCAAGAAGTAGG - Intronic
921937904 1:220811754-220811776 TTAAAGAAGACGCAGGGAGAGGG - Intronic
922069880 1:222181522-222181544 ATGAATTAGCAGCAGGAAGGGGG + Intergenic
922511906 1:226175660-226175682 TTAAAGCAGCAGTAGGAAAATGG + Intronic
922778219 1:228227364-228227386 TAAAAACAGCAGCAGGAAGATGG - Intronic
923144507 1:231188457-231188479 ATAAAGATGCAGCTGGAAGATGG + Intronic
923239331 1:232065910-232065932 ATAAATAAGCAGGAAGCAGAAGG + Intergenic
923871448 1:237998557-237998579 TTAGATATGGAGGAGGAAGATGG - Intergenic
924468970 1:244322926-244322948 TTTAAAAAGCAGTAGCAAGACGG + Intergenic
1062826986 10:577610-577632 TTAAATAAGCAGCAGGCTGATGG - Intronic
1062917529 10:1253055-1253077 TCAAGTAAGCAGCAGAAACAGGG - Intronic
1063262277 10:4403372-4403394 TAAAAAAAGGAGCAGAAAGAGGG + Intergenic
1063528126 10:6803321-6803343 TTAAATAAGCAGGAGGGAGTAGG - Intergenic
1063538129 10:6905386-6905408 TGGAATATGCAGGAGGAAGAAGG - Intergenic
1066009343 10:31179998-31180020 TGAAATAAGTTGCAGGATGAGGG + Intergenic
1066029036 10:31398805-31398827 TTGAAAAAGCAGCAGCCAGAGGG - Intronic
1068460898 10:57327045-57327067 TAAAAAAAGGAGGAGGAAGAAGG - Intergenic
1069334541 10:67332517-67332539 TTAAATAAGCAGGAGGTTCATGG + Intronic
1069491159 10:68861744-68861766 TTAAAGGAGCTGCAGAAAGATGG - Intronic
1070221032 10:74444953-74444975 TTAGAAAAGAAGCAGTAAGAAGG + Intronic
1070891316 10:79943892-79943914 CCAAGTCAGCAGCAGGAAGATGG + Intronic
1071048548 10:81416444-81416466 TTAAAAAAGCAACATGAAGTGGG + Intergenic
1071179572 10:82967369-82967391 ATAAATAAGCAACGGGAGGAGGG - Intronic
1071427381 10:85572611-85572633 TTAAATATGAAGTAGGAATAGGG - Intergenic
1071577560 10:86740533-86740555 TTAAACAAGCAGAAGGAAAAAGG - Intergenic
1074006560 10:109431120-109431142 TTGAATAAGCAGGAAGAACAGGG - Intergenic
1074562865 10:114549492-114549514 TTAAACTAGCTGCAGCAAGAGGG - Intronic
1074614183 10:115049928-115049950 TTTAATAAATAACAGGAAGATGG + Intergenic
1075007306 10:118840246-118840268 TAAAGGAAGCAGCAGGAAGGCGG + Intergenic
1075522643 10:123152865-123152887 TTAAATAAACAACTGGGAGAAGG + Intergenic
1075895856 10:125994061-125994083 TACCATAAGGAGCAGGAAGAGGG + Intronic
1078127508 11:8582486-8582508 TTCACAAGGCAGCAGGAAGAGGG + Intronic
1079825209 11:25182163-25182185 TTTAATAATCAGAAGGAAGCAGG + Intergenic
1080889861 11:36400120-36400142 TTAAATAAGCAGAGGGAAAAAGG + Intronic
1084719457 11:70894926-70894948 TTAGGGAGGCAGCAGGAAGACGG + Intronic
1084910623 11:72385283-72385305 TTACATAAATAGCAGGAAGAAGG - Intronic
1085556415 11:77426612-77426634 TTCAATTAGCACCAGGCAGATGG + Intronic
1085874209 11:80386570-80386592 TCAACTTTGCAGCAGGAAGAAGG - Intergenic
1086802025 11:91187634-91187656 TTAAAAAAGAAGCAGGGAAAAGG - Intergenic
1086828266 11:91526707-91526729 TAAAATCAACAGCAGAAAGAGGG - Intergenic
1087423547 11:97963542-97963564 TTTAATAAGCGAAAGGAAGAAGG + Intergenic
1087614417 11:100471656-100471678 CTAGAGAAGTAGCAGGAAGATGG - Intergenic
1089204032 11:116743962-116743984 TATAATATGCATCAGGAAGAAGG - Intergenic
1089726237 11:120482917-120482939 TAAAATAAGTAACATGAAGAGGG - Intronic
1089802392 11:121044547-121044569 TAAAATAATCAGTAGGGAGAAGG - Intronic
1090424381 11:126596940-126596962 TTAAAGCAGCAGGAGGAAGCAGG + Intronic
1090541866 11:127715526-127715548 AAAAATAAAGAGCAGGAAGAAGG - Intergenic
1091947262 12:4558771-4558793 TAAAATAAGCAGCAAAAAAAAGG - Intronic
1092123312 12:6059195-6059217 TTAAATAAGGAGGTGGGAGAAGG - Intronic
1093230064 12:16533042-16533064 TTAAAGTGGCAGGAGGAAGAGGG - Intronic
1093390979 12:18620798-18620820 TTAAATAACCAGGATTAAGAGGG - Intronic
1094360279 12:29623422-29623444 TGAAATAGGAAGCAAGAAGAAGG + Intronic
1094750625 12:33402899-33402921 TTATATAATTAGCATGAAGAAGG + Intronic
1096691469 12:53324770-53324792 TTAAATAAGCAGTATGGAGGAGG - Intronic
1098104285 12:67053129-67053151 TTAAATAGTCTGCAGGAGGAAGG + Intergenic
1098746889 12:74249239-74249261 TTAAATAATAAGAAGGAGGAAGG - Intergenic
1098772339 12:74568301-74568323 TTAAATAAGTGCCAGAAAGAGGG - Intergenic
1098931848 12:76426017-76426039 TTAAATAAGCAGGAGGCCAATGG + Intronic
1099108696 12:78528918-78528940 TGAGATAAGCAGGAGAAAGAAGG - Intergenic
1099426131 12:82524876-82524898 TGATATAAGCAGCGGGCAGATGG + Intergenic
1099453047 12:82831050-82831072 TGAAATAAGTAACAGGAAAATGG + Intronic
1099585698 12:84509473-84509495 TGAAATAATGAGCAGGAAAAAGG - Intergenic
1100558089 12:95717740-95717762 CTAGATAAGGAGCAGGAAAATGG + Intronic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100587194 12:95991114-95991136 ATAAATAAGAAGAAGGAAGGAGG + Intronic
1101201059 12:102436813-102436835 ATACATAAGTGGCAGGAAGAAGG + Intronic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1107985180 13:45769680-45769702 TATAAAAAGCAGCAGGCAGATGG - Intergenic
1108006108 13:45948312-45948334 ATGAAGAAGCAGCAGCAAGAGGG - Intergenic
1108946665 13:56034647-56034669 TTAACTAAGCAGTAAGAAGAAGG - Intergenic
1108989759 13:56640324-56640346 TTAAATTAGCTCTAGGAAGAGGG + Intergenic
1109168980 13:59072990-59073012 TCAAATTAGACGCAGGAAGACGG - Intergenic
1110352854 13:74529943-74529965 TTAATGAAGAAGGAGGAAGATGG - Intergenic
1110674494 13:78224712-78224734 TCAAATAAGCTGCCAGAAGATGG - Intergenic
1111136926 13:84059308-84059330 TTAAATATGCATCTGGAACAGGG + Intergenic
1111811652 13:93099048-93099070 TTAAAAAAGCAGGCAGAAGAAGG + Intergenic
1112061500 13:95743853-95743875 TTAAATAAGCAGGAGGCAGCCGG - Intronic
1113225428 13:108154118-108154140 TTAAATGAGCTTCAGGAGGAAGG - Intergenic
1113322201 13:109244984-109245006 TTAAAGAAGCAGAAGCATGATGG + Intergenic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1115044889 14:28979551-28979573 TAAAATAAGTAGCAAGAAGCAGG + Intergenic
1115879141 14:37895144-37895166 TTAAGGAAGCAGCAAGAAAAAGG - Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1116610564 14:47066062-47066084 TTAAATAAGCAGTTGGAAATAGG + Intronic
1116611642 14:47080835-47080857 TTAAGTAATCAGCAGCAAGATGG - Intronic
1116705664 14:48295502-48295524 TTAAATGAGCAGGAGGGAGGTGG - Intergenic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1117229799 14:53705107-53705129 TTAAATAAGAAGGAGGGGGAGGG + Intergenic
1117266679 14:54095540-54095562 TTAAAGAAGCTGAAAGAAGATGG - Intergenic
1118009127 14:61591828-61591850 TGAGACTAGCAGCAGGAAGAAGG + Intronic
1119267126 14:73269600-73269622 TCAAATAAGCAGGAGGGAAAGGG + Intronic
1119543752 14:75457279-75457301 TTCAAGAAGCACCAGGAAGGAGG + Intronic
1121195016 14:92063481-92063503 AAAAATAAGGCGCAGGAAGAAGG + Exonic
1121244283 14:92451109-92451131 TGATAAAAGCTGCAGGAAGATGG - Intronic
1202844538 14_GL000009v2_random:156045-156067 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1202913929 14_GL000194v1_random:146286-146308 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1202878725 14_KI270722v1_random:36416-36438 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1123885888 15:24728086-24728108 TAAAGAAAGCAGCAGGAAGGTGG - Intergenic
1124180807 15:27471746-27471768 TTAAATTAGTAGGAGGAAGAAGG - Intronic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126464063 15:48944450-48944472 TTTTCCAAGCAGCAGGAAGAAGG - Intronic
1127210787 15:56772482-56772504 TTAAATAAAGAGCAGGAGGAAGG + Intronic
1127988124 15:64090882-64090904 TAAAATAAGCAGAAGGGAGTGGG + Intronic
1128801096 15:70497630-70497652 ATAAATAAGCAGCAAGAGCAAGG - Intergenic
1129074298 15:72978457-72978479 TTGAATAAGCTGGAGGAAGCAGG - Intergenic
1130025861 15:80269873-80269895 TTAAATAAGTGGCAGGTACATGG - Intergenic
1130360872 15:83184737-83184759 TCAAAAAAAGAGCAGGAAGAAGG + Intronic
1133407246 16:5534611-5534633 TAAAAAAAGCAGGTGGAAGAAGG - Intergenic
1133962485 16:10506584-10506606 GTAAACAAGCAGAAGGAAGAAGG - Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137218900 16:46427807-46427829 TGCAAAAAGCAGCAGGAACAGGG + Intergenic
1137300196 16:47142621-47142643 TTAAATCAGCAGGGGGAAAAAGG + Intronic
1137468228 16:48730587-48730609 GTAAAAGAGCAGCAGAAAGAGGG - Intergenic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1139411938 16:66769320-66769342 TAAACTAAGTACCAGGAAGAAGG - Intronic
1140165047 16:72542463-72542485 TTAAATAGGCAGAAGAAAGGAGG - Intergenic
1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG + Intronic
1140652735 16:77106421-77106443 TTAAATAGGAAGCAACAAGATGG + Intergenic
1141577487 16:84973549-84973571 TAAAATTAGCAGCTGGATGAGGG + Intergenic
1141677836 16:85526941-85526963 TTAATTAAGTAGCAGCAATATGG + Intergenic
1145410148 17:22653188-22653210 TTATAAAAGAAGCAGGAATATGG + Intergenic
1147490297 17:40859769-40859791 TCAAAGAAGCAGAAGGGAGAGGG - Intergenic
1148717438 17:49725853-49725875 TTAAATAAGAAAGAGGCAGAGGG + Intronic
1149159557 17:53674840-53674862 TCAAATAAGAGCCAGGAAGAGGG + Intergenic
1149171591 17:53818651-53818673 TTTAATAAGCAGGGGAAAGATGG + Intergenic
1149333107 17:55606805-55606827 TTTAAGAAGCAGGAGGAAGGAGG - Intergenic
1149544315 17:57491805-57491827 TTGAATGAACAGCAGGAAGGAGG - Intronic
1149836803 17:59920413-59920435 TTAAATAAAAATCAGCAAGAAGG - Intronic
1150884029 17:69064407-69064429 TCCTATAAGGAGCAGGAAGATGG - Intergenic
1151398000 17:73837348-73837370 TTAAATATGGAGTGGGAAGAGGG + Intergenic
1152164619 17:78694481-78694503 TTAAATAAGGAGGATAAAGAAGG + Intronic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153525720 18:5992724-5992746 TTACAAAAGCAGGAGCAAGAGGG - Intronic
1153547348 18:6221342-6221364 TTTAATAAGCAGCAATAAAAGGG + Intronic
1154149596 18:11895912-11895934 TAGAAACAGCAGCAGGAAGAAGG + Intronic
1154178123 18:12102217-12102239 TCAAATAAGCAGCTGGAAGCAGG + Intronic
1154968733 18:21385684-21385706 TTAAATAAAAGGCATGAAGATGG - Intronic
1155488621 18:26374342-26374364 TTATAGAAGAAGCAGGCAGACGG - Intronic
1156574453 18:38298289-38298311 TGAAACAAGCAGCAGAAACATGG - Intergenic
1157254729 18:46128576-46128598 TTAAATCAGTAGTAGAAAGATGG + Intergenic
1157983022 18:52404433-52404455 TTCACTATGCAGCAGGAGGAAGG - Intronic
1158211266 18:55053220-55053242 TTAAACAAACAGCAGGAAGATGG - Intergenic
1158804320 18:60951397-60951419 TTTAATAATCAGAAGAAAGAAGG + Intergenic
1160677468 19:399093-399115 TTTTATACGCAGCAGGAGGAAGG - Intergenic
1162218240 19:9154185-9154207 TTAAATAACTAGAAGCAAGAAGG + Intronic
1162467166 19:10849160-10849182 TTAAAAAAGGAGCAGCAAGGAGG - Intronic
1165220029 19:34308533-34308555 TTAATTAAGCAGCTGGAATTTGG + Intronic
1167153948 19:47726672-47726694 TTAAAAAAGAAGGAAGAAGAGGG - Intronic
1202654348 1_KI270708v1_random:5450-5472 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
925012562 2:496641-496663 TGCCATAAGCAGCAGGAAAACGG - Intergenic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926865838 2:17357376-17357398 TGAAATAGGCAGCAGAAAGATGG - Intergenic
927267530 2:21169105-21169127 TTAAAAAACCAACAGGAAAATGG - Intergenic
927527265 2:23756610-23756632 TTTAAGAAGCAGCAGAAAGAGGG - Intronic
927667907 2:25044846-25044868 TCCCATAAGCAGAAGGAAGAAGG - Intronic
927875214 2:26650631-26650653 TGACGTAAGCAGCAGGATGAAGG + Intergenic
928399656 2:30968801-30968823 TTAGATAAGCAGTAGAAAAAGGG + Intronic
929451673 2:42042274-42042296 GTAGATGAGCAGCAGGTAGAGGG - Intergenic
929663983 2:43819254-43819276 TTTAAAAAGCAGCAGCAAAAAGG - Intronic
930184293 2:48396218-48396240 TTAAATAAGGTGCAGTAATATGG - Intergenic
930452084 2:51554634-51554656 TTTCAAAAGCAGCAGGAAGGAGG + Intergenic
932524686 2:72451938-72451960 TTAAATGAGCAACAGGAATGTGG - Intronic
932711578 2:74069084-74069106 TTAAAAAATAATCAGGAAGAAGG - Intronic
933386004 2:81610982-81611004 CTCAAAAAGCAGCAGGAAGAAGG + Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933646314 2:84815450-84815472 TTAAATAAGAAAGAGGGAGAGGG - Intronic
934165908 2:89294119-89294141 TCAGAAAAGCAGGAGGAAGAGGG + Intergenic
934201369 2:89888337-89888359 TCAGAAAAGCAGGAGGAAGAGGG - Intergenic
936081328 2:109434565-109434587 TTAACTCAGAAGCAGGAAGAGGG - Intronic
936540831 2:113349663-113349685 TTCAATAAGGAGCACCAAGATGG + Intergenic
936861632 2:117027072-117027094 TGTAATAAGCAGGAGGAACAGGG - Intergenic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
939049745 2:137293759-137293781 CTAAATTGGCAGCAGTAAGAAGG - Intronic
940950594 2:159668677-159668699 TAAACTAAGTAGAAGGAAGAAGG - Intergenic
941094133 2:161216328-161216350 TTCAATTAGCAGAAGCAAGAAGG - Intronic
941977111 2:171417684-171417706 TTAAAAATGCAGCAGGAATATGG - Intronic
942058530 2:172207036-172207058 TGAAATATCCAGCAGGAAGTGGG + Intergenic
943631449 2:190257382-190257404 TAAAATAAGCAGAAGAAAGGAGG + Intronic
943641211 2:190360182-190360204 TTCGATCAGCAGCTGGAAGAGGG - Exonic
946107413 2:217383737-217383759 TGGAATAACCAGCAGGATGACGG + Intronic
946913914 2:224495959-224495981 TTAAAAATGAAACAGGAAGATGG - Exonic
946955038 2:224920406-224920428 TAAAATAAGCAACTTGAAGAAGG - Intronic
947306036 2:228748739-228748761 GTAAATAAGCTCAAGGAAGAAGG - Intergenic
947403602 2:229752330-229752352 TAAAATCACCAGCAGGAAGGAGG + Intergenic
947867416 2:233408847-233408869 TTAAAGAAGCAGGAGGAAGCAGG + Intronic
1168798056 20:625068-625090 GAAAATAAGCACCAGGCAGAGGG - Intergenic
1168963953 20:1887587-1887609 TGAAAGAAGGAGCAGGAAGCAGG - Intergenic
1168969976 20:1924377-1924399 CTGAATCAGCAGCTGGAAGAAGG - Intronic
1170708264 20:18765798-18765820 ATAAATAAGCAGAAAGAAGGAGG - Intergenic
1171136284 20:22697495-22697517 GTACATAAGCTGGAGGAAGAAGG - Intergenic
1171235290 20:23519492-23519514 TAAAATAAGGAGCGAGAAGAGGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172116880 20:32578337-32578359 GTAAAGAAGCAGCTGGAAGTTGG - Intronic
1172145393 20:32754187-32754209 TTAAGTAAGCAGCAGGCTAAGGG - Intergenic
1172249855 20:33471429-33471451 TTAAGTAAGCAGAATGTAGAAGG + Intergenic
1172394238 20:34588274-34588296 TTAAGTAAGTAGCCGGAAGTGGG + Intronic
1172834930 20:37867275-37867297 TTAAAAATGCAGGAGGAAGAGGG - Intronic
1172836328 20:37875527-37875549 TGGAATCAGCAGCAGCAAGATGG + Intergenic
1173244886 20:41329894-41329916 TTAAAGAAGGAGTAGGAAGAGGG - Intergenic
1173853372 20:46233109-46233131 GTACATATGGAGCAGGAAGAGGG + Intronic
1174142566 20:48426108-48426130 TTAAAAATGCAGGAGGGAGAAGG - Intergenic
1174215219 20:48911308-48911330 TTAGATAAGCCACAGGGAGAAGG - Intergenic
1174493242 20:50919156-50919178 TAAAATATGCAGCAGGACAAGGG + Intronic
1174975098 20:55324223-55324245 ATAAACAACCATCAGGAAGATGG + Intergenic
1175014557 20:55775341-55775363 TAAGATAAGCATCAGGAGGATGG - Intergenic
1175026440 20:55907508-55907530 AGAAATAAGAAGAAGGAAGAGGG + Intergenic
1175353449 20:58343208-58343230 TTGAACAAGGAGCAGGAAGATGG - Intronic
1176633284 21:9160961-9160983 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1176640039 21:9293856-9293878 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1178085209 21:29105351-29105373 TGGAATGAGCAACAGGAAGAAGG - Intronic
1178172059 21:30052288-30052310 TTAAAAAAAAAGCAGGGAGATGG + Intergenic
1178461265 21:32804865-32804887 TTAAAGGAACAGCAGGAATATGG + Intronic
1180349053 22:11783238-11783260 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1180373341 22:12066692-12066714 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1180389147 22:12208975-12208997 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1180416794 22:12725496-12725518 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1180424085 22:12901319-12901341 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1180887570 22:19257992-19258014 TAAAGTCAGCAGCAGCAAGATGG - Intronic
1181036462 22:20172023-20172045 TTAATTAAGCGTCAGGAAGCTGG - Intergenic
1181495607 22:23285898-23285920 TTAAGGAAGCAGCAGGAATGCGG + Intronic
1184436435 22:44481010-44481032 TAAATTAAGCAGAAGAAAGAGGG + Intergenic
949869922 3:8579879-8579901 TGCAAGAATCAGCAGGAAGAGGG + Intergenic
951264008 3:20546577-20546599 TTCAATAAACAGTAAGAAGATGG - Intergenic
951796591 3:26545712-26545734 TTAAATAAGCAGCAGGTCATTGG + Intergenic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
953037307 3:39224258-39224280 TTGAATAAAGAGCTGGAAGAAGG - Intergenic
953201015 3:40778572-40778594 TTAAAGAAGGGGCAGGAAGATGG + Intergenic
953239351 3:41134839-41134861 TTTGAAAAGCAGCAGCAAGAAGG + Intergenic
954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG + Intronic
955942734 3:64161960-64161982 TGAAATAAGCAGCAGTAAAGAGG + Intronic
956655402 3:71545823-71545845 TTAAATATGCAGCAACAAAAGGG - Intronic
957021589 3:75134352-75134374 TTAAAAAAACATCAAGAAGAGGG + Intergenic
957935433 3:86935901-86935923 TGAAATCAGCAGCACGAAAATGG - Intergenic
958457854 3:94355660-94355682 TTAAAAAAACAGCAGGCATATGG - Intergenic
958492087 3:94789001-94789023 ACAAATAAGGAGCAGGAAGGGGG + Intergenic
959268675 3:104176109-104176131 TTGAATAAGCAGCCTCAAGAAGG - Intergenic
959335257 3:105056820-105056842 TTAAACAAGCAGCAGCACTAGGG - Intergenic
959882483 3:111460665-111460687 GTAAATAAGCAGCAAGAGGGTGG + Intronic
960269727 3:115660549-115660571 AGAAATAATCAGCAGCAAGAAGG - Intronic
961558924 3:127715533-127715555 TTAAAAGAGCAGCAGGGAAAGGG - Intronic
962003876 3:131328593-131328615 GTAAATAAGCTGCAGGGAAAGGG + Intronic
962526273 3:136240590-136240612 TTTTCTAAGCAGCTGGAAGAGGG + Intergenic
962986389 3:140540042-140540064 GCAAATAAGCAGCAGTAGGAAGG - Intronic
963115840 3:141728291-141728313 CTAAATGAGAAGCAGGAAGGAGG + Intergenic
963568108 3:146957028-146957050 TGAAATAAACAGCAAGAACAGGG + Intergenic
964161172 3:153647356-153647378 GTAAATAAGCCACAGGAATAAGG + Intergenic
964589591 3:158345367-158345389 TTAAGTAAGCAGCATGTAGTTGG - Intronic
965013160 3:163123532-163123554 CTACATAAGCAGAAGGAAAAGGG - Intergenic
966017673 3:175162301-175162323 TTAAATATGCTGGAGGAAGGGGG - Intronic
966518497 3:180846540-180846562 TTAAATAATCTGCAGCAAAATGG - Intronic
1202746856 3_GL000221v1_random:111166-111188 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
968708722 4:2096597-2096619 TTACAAAAGCAGCAGGCAGGAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
968975666 4:3820968-3820990 GGAAATAACCAGCAAGAAGAGGG + Intergenic
970429344 4:15974496-15974518 TTAAATAAGAACCATGAAGTGGG - Intronic
970432791 4:16004274-16004296 TCATCTCAGCAGCAGGAAGAAGG - Intronic
970752797 4:19384931-19384953 TGAAATAAACATCAGGAAAATGG + Intergenic
971441239 4:26689135-26689157 TTAAATAAGCATCTTCAAGAAGG + Intronic
971865264 4:32162067-32162089 TTAAATAAGCAGCAGGATTTAGG + Intergenic
971882788 4:32401889-32401911 ATAAAAAACCAGCAGAAAGATGG + Intergenic
972256432 4:37360793-37360815 ATAAATATGCAGCATGGAGAAGG - Intronic
974476309 4:62386728-62386750 TCAAATAAGCAGAAGGATGGAGG - Intergenic
976210927 4:82668992-82669014 TTAACTTAGCAACAGGTAGAGGG + Intronic
977098696 4:92779532-92779554 TTACAAAAGCATCAGGAAGCAGG + Intronic
978157570 4:105507406-105507428 TGAAAAAACCAGAAGGAAGATGG + Intergenic
978401404 4:108334911-108334933 TAAAATAAGCATCAGTAACAAGG - Intergenic
978828753 4:113056755-113056777 TTTAAAAAGCTGCAGGGAGAAGG + Intronic
979000912 4:115217806-115217828 TAAAATGAGTAGGAGGAAGAAGG + Intergenic
979151724 4:117325560-117325582 ATAAATAAGGAGCAGAAAAAAGG + Intergenic
979436572 4:120700178-120700200 AAAAATAAGCAACAGGAAAAGGG + Intronic
979810298 4:125028422-125028444 TTTTATTAGCAGCAGGAAAATGG - Intergenic
980097094 4:128502262-128502284 TTAAATAAGTAAAAGGATGATGG - Intergenic
981089913 4:140721757-140721779 TAATAAAACCAGCAGGAAGATGG - Intronic
981301314 4:143189102-143189124 TTAAATAAGATGGATGAAGAAGG + Intronic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
982938483 4:161517619-161517641 TTATATAAGCAACAGCAATAAGG + Intronic
984488165 4:180398956-180398978 ATAAAAAAGCAGTAGGAAAATGG - Intergenic
984788997 4:183596653-183596675 TTAAATAGGCTGCCAGAAGAGGG + Intergenic
986512533 5:8523435-8523457 GTAATCAGGCAGCAGGAAGAGGG - Intergenic
986550707 5:8951663-8951685 TTCACAAAGCAGCAGGTAGATGG - Intergenic
986628947 5:9750313-9750335 TTAAGAAAGCAGCAGGATGGTGG - Intergenic
987445397 5:18011510-18011532 GGAAAGAAGCAGCATGAAGAAGG + Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987816922 5:22914218-22914240 TAAAATAAGCAGCAGATTGAAGG - Intergenic
988039036 5:25864203-25864225 TTAAATAAGCTGCAGGCCGCTGG - Intergenic
988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG + Intronic
989175214 5:38517892-38517914 TAAAATAAGAAGTAGGCAGATGG + Intronic
991611944 5:68458546-68458568 CTAAAGAGGCAGCAGGAAGAAGG + Intergenic
995812035 5:116118153-116118175 TTAAACAATCAGCTGGAAAAAGG - Intronic
996809390 5:127498250-127498272 TTAAATAAGCAAGAGAGAGAGGG + Intergenic
997042256 5:130271347-130271369 ATAAATCAGAAGCAAGAAGAGGG + Intergenic
997596466 5:135110479-135110501 TAAAGAAAGCAGCAGGATGAGGG - Intronic
997621020 5:135295368-135295390 TAATATAAGCAGAAGGAATAGGG - Intronic
997897468 5:137732558-137732580 TTAGATAAGAAGCAAGATGACGG + Intronic
999380520 5:151117991-151118013 TTACAAAATCAGCAGGAGGATGG - Intronic
1001095198 5:168770705-168770727 TTAAAAAAGAAACAGGGAGAAGG - Intronic
1001327602 5:170740559-170740581 TTACATACACAGCAGGAAGTGGG + Intergenic
1002797678 6:488028-488050 TTAGAGAAGCAGCAAGAAAAAGG + Intronic
1004372761 6:15066784-15066806 ATAAATAGGGAGGAGGAAGAAGG + Intergenic
1005664254 6:28034599-28034621 TCAAGTCAGCCGCAGGAAGAAGG + Intergenic
1006994285 6:38243872-38243894 TTAAAAAAGAAGAAGGAAAAGGG - Intronic
1007232928 6:40361638-40361660 TTAAATAAGAATCAGGGACAAGG + Intergenic
1007498435 6:42277839-42277861 ATAAATAAGAAGAAGAAAGAAGG + Intronic
1008370912 6:50729250-50729272 TAAACTTACCAGCAGGAAGACGG + Exonic
1008456933 6:51721929-51721951 TTAATGAGGCAGCAGGAAGCAGG - Intronic
1008466591 6:51837977-51837999 TGAAATAAGCAACAGGGTGAAGG - Intronic
1008524001 6:52389412-52389434 TTCAATAAGCAGAAGAGAGAAGG + Intronic
1009187940 6:60596174-60596196 AAAAATAAGAAGAAGGAAGAAGG - Intergenic
1009294470 6:61928341-61928363 GTAAATAAGAAGAAGGAATAAGG - Intronic
1010331933 6:74633460-74633482 TTAAATAAAAAGAAGGAACATGG - Intergenic
1010777347 6:79902641-79902663 TGAAATGAGCAGCAGGCTGAGGG - Intergenic
1011000454 6:82582699-82582721 GTAAAGAAGCAGCAGGAAGGTGG + Intergenic
1011713387 6:90078316-90078338 TTAAATAAAAAACAGGGAGAAGG + Intronic
1012667502 6:101992759-101992781 TTAAAAAATCAACAGGAAAAGGG + Intronic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1015421824 6:133019648-133019670 TTCAATAAACATCTGGAAGAGGG - Intergenic
1015439881 6:133235534-133235556 TTAAAGAAGGACCAGCAAGAAGG + Intergenic
1015994433 6:138983940-138983962 TTAGAAAAGGGGCAGGAAGAGGG - Intronic
1016239863 6:141917327-141917349 TAAACAAAGCAGCAGGAAGCTGG + Intergenic
1016705127 6:147097949-147097971 TTAAACAAGCAGCACAGAGATGG - Intergenic
1016731633 6:147433545-147433567 TTATATAAGCAGAAAGAATATGG - Intergenic
1016891245 6:149008856-149008878 TTAAATAATCACCAGCAGGATGG + Intronic
1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG + Intergenic
1017402291 6:154078260-154078282 TTAAATAGGCAGTTGGAATATGG - Intronic
1017868931 6:158469812-158469834 TTTAACAAGCAGCAGAAGGAAGG + Intronic
1017961930 6:159231013-159231035 TTAAACAAGAAGGAGGAAGCAGG + Intronic
1018051260 6:160010573-160010595 TAAAGAAAGCAGCAGCAAGAAGG - Intronic
1018885560 6:167932971-167932993 TTAAATAAGAAGCATACAGAAGG - Intronic
1018947234 6:168356403-168356425 TTTAAAAAGAAGCAGAAAGAAGG - Intergenic
1019057279 6:169232583-169232605 TCAGAAAAGCAGCAGGAGGAAGG - Intronic
1019315556 7:382895-382917 TTAAATGAGAAGTGGGAAGAAGG + Intergenic
1020214857 7:6182344-6182366 TTAAAAAAGAAGCAGGAGGCTGG - Intronic
1020595613 7:10203725-10203747 TGAAATTAGCAGAAGAAAGAGGG + Intergenic
1021116086 7:16747996-16748018 TTAAACGAGCAGGAAGAAGAAGG + Intergenic
1022151126 7:27607708-27607730 TTAGATAAGCAGCTGGAGGAAGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023680807 7:42685309-42685331 GTAATGAAGCAGCAGGAAGGGGG + Intergenic
1024527009 7:50357412-50357434 CAAAATGAGAAGCAGGAAGAGGG - Intronic
1027650194 7:80856995-80857017 TGAAATAAGAGGGAGGAAGAAGG - Intronic
1027848384 7:83416020-83416042 TTGAAAAAGCAGCAGGAATGTGG - Intronic
1027970721 7:85077472-85077494 GTAAATAATCAGCACGAAAAAGG + Intronic
1028214462 7:88114498-88114520 TAAAATCAGCAGCAGCCAGAGGG - Intronic
1028943043 7:96546570-96546592 TTAATTGAGCAGGAGAAAGAAGG + Intronic
1030507002 7:110437197-110437219 TACAAAAAGCAGGAGGAAGAAGG + Intergenic
1032025938 7:128442605-128442627 TTAAATAAGTAGGAGGTAGGAGG + Intergenic
1032135170 7:129270029-129270051 TTAAATAATACGCAGGAATAAGG - Intronic
1032172954 7:129600942-129600964 TTCAAGAGGCAGCAGGATGAAGG - Intergenic
1032260770 7:130334837-130334859 TAATGTAAGCAGCAGAAAGATGG + Intergenic
1032474235 7:132201552-132201574 ATTATGAAGCAGCAGGAAGAGGG - Intronic
1032480528 7:132242876-132242898 TTAAAGACGCAACAGAAAGAGGG - Intronic
1032665505 7:134032411-134032433 TCCCATTAGCAGCAGGAAGATGG - Intronic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1033449119 7:141447363-141447385 TAAAATGAGCAGCAAGGAGAAGG + Intronic
1033451139 7:141463273-141463295 TTCCAGAACCAGCAGGAAGAGGG + Intronic
1034132985 7:148738195-148738217 TAAAGTGAGCAGCAGGATGACGG - Intronic
1034935334 7:155196110-155196132 GAAAATAGGAAGCAGGAAGATGG - Intergenic
1035028374 7:155841971-155841993 TTAAATCATCTGCAGTAAGATGG + Intergenic
1035412047 7:158652300-158652322 TTCAGGAAGCAGCCGGAAGAAGG - Exonic
1036415585 8:8544761-8544783 TTAAATAAAATGCAGGGAGAAGG + Intergenic
1037073959 8:14689268-14689290 TTAAATAAGCAGTGGCAAAATGG + Intronic
1037558767 8:20053800-20053822 TTATATTAGCAACAGGAAGAAGG - Intergenic
1038133056 8:24755337-24755359 TTCAACAGGCAGCAGGAAGCAGG + Intergenic
1038878672 8:31581884-31581906 TAAAATAAGCAGGAGTAAAAAGG - Intergenic
1039080476 8:33728958-33728980 TCAGAAAAGCAGCAAGAAGATGG - Intergenic
1039816570 8:41099993-41100015 ATAAATAAAAAGAAGGAAGAAGG - Intergenic
1040297383 8:46163236-46163258 TTAATTAAGAAGTTGGAAGAAGG - Intergenic
1041097970 8:54368200-54368222 TCCAAAATGCAGCAGGAAGAAGG - Intergenic
1041755878 8:61312805-61312827 ATAATTAGGCAGCATGAAGAAGG - Intronic
1042885935 8:73551765-73551787 TTAAAAAAGAAGAAGGAAAATGG + Intronic
1043030045 8:75123094-75123116 TAATATGAGCAGCAGGAAGTGGG + Intergenic
1043101259 8:76049448-76049470 TTGAATAGGCAGCAGGAACCAGG + Intergenic
1043934768 8:86130739-86130761 TTCAAGTAGCAGCAGGAAGGAGG - Intronic
1044584469 8:93856717-93856739 TTAGATAAACAGAAGGTAGAAGG - Intergenic
1045815979 8:106276665-106276687 TTAAATAAACAGAAGAAACATGG - Intronic
1045837031 8:106534812-106534834 TTAAAGAAGCAGAAAGAAAATGG + Intronic
1045923721 8:107563858-107563880 TTAAATAAGCAATAGAAAAAGGG - Intergenic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1045959793 8:107953651-107953673 TTTCCTAAGCAGCAGGATGATGG + Intronic
1048247110 8:132817783-132817805 ATAAAAAAGAAGCAGGGAGAAGG - Intronic
1048393436 8:133989502-133989524 TTAAAGGAGTAGCAGGAATATGG + Intergenic
1050282068 9:4060786-4060808 TTTAATAAGCAACAGAAAAATGG + Intronic
1051120851 9:13750588-13750610 TTAGATTAGCTGCAGGAAAACGG + Intergenic
1051255504 9:15208574-15208596 TTACATAAGCAGCTCAAAGATGG + Intronic
1051394261 9:16602210-16602232 TTAAATAAGAAACCAGAAGAGGG - Intronic
1053052518 9:34973603-34973625 TCGTCTAAGCAGCAGGAAGAAGG - Intronic
1053294300 9:36901982-36902004 TAAAAGAAGCAGCAGATAGAAGG - Intronic
1055119185 9:72638509-72638531 CAAAATAAGCAGCAGGAAGGGGG - Intronic
1055265575 9:74492260-74492282 TTAAATTGGCACCAGGAAAAAGG - Intergenic
1055570943 9:77616494-77616516 CTAAGTCAGCAGCAGGAAGATGG + Intronic
1055620404 9:78119571-78119593 TCAAAGAAGGAGCAGGAAGAAGG + Intergenic
1055642207 9:78328333-78328355 TTCCATAAACAACAGGAAGAAGG - Intronic
1058468513 9:105253263-105253285 TAAAAAAACCAGCAGGAAGATGG + Intronic
1058700645 9:107597431-107597453 TAAAAGAAGCAGCAGGATGAAGG - Intergenic
1058882255 9:109295989-109296011 TGAAACAAGCTGCTGGAAGAAGG + Intronic
1059529767 9:115025169-115025191 TTCATTAAGCAGCAGGAATGTGG - Intronic
1060348599 9:122838014-122838036 TAAAGTAACCAGCAGCAAGACGG - Intergenic
1060674085 9:125496649-125496671 ATAAATAAGCATCACAAAGAGGG + Intronic
1203760379 EBV:10089-10111 TTTAACAAGCTGCAGGAAAAAGG + Intergenic
1203756125 Un_GL000218v1:128589-128611 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1203715491 Un_KI270742v1:141259-141281 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1203535726 Un_KI270743v1:36969-36991 GTAAAGAAGAAGCAGGAAGCTGG + Intergenic
1203649741 Un_KI270751v1:104837-104859 GTAAAGAAGAAGCAGGAAGCTGG - Intergenic
1185559376 X:1047524-1047546 TTATGTGAGCAGAAGGAAGATGG - Intergenic
1186349680 X:8729693-8729715 TTTAATAATTAGAAGGAAGATGG - Intronic
1187812423 X:23194075-23194097 TTACATAACTTGCAGGAAGATGG - Intergenic
1187821930 X:23297046-23297068 GAAAATATGAAGCAGGAAGAGGG + Intergenic
1196456985 X:115898028-115898050 AGAAATGAGCACCAGGAAGATGG + Intergenic
1199059817 X:143341641-143341663 TTCAAAATGCAGAAGGAAGATGG - Intergenic
1199392010 X:147291005-147291027 TTACATACACAGCAGGTAGAAGG - Intergenic
1199427623 X:147721388-147721410 TTAAAGAAGCAGCATTAATATGG + Intergenic
1201147286 Y:11072259-11072281 TTAAATGAACAGAAGGAAGCCGG - Intergenic
1201169725 Y:11246207-11246229 GTAAAAAAGAAGCAGGAAGCTGG - Intergenic