ID: 1116862997

View in Genome Browser
Species Human (GRCh38)
Location 14:50009231-50009253
Sequence GAACAGGTTAGAAGTTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116862997_1116863008 27 Left 1116862997 14:50009231-50009253 CCACAGGAACTTCTAACCTGTTC No data
Right 1116863008 14:50009281-50009303 CATCTTGCCACTCTCGGGAGAGG No data
1116862997_1116863005 21 Left 1116862997 14:50009231-50009253 CCACAGGAACTTCTAACCTGTTC No data
Right 1116863005 14:50009275-50009297 GGTAGCCATCTTGCCACTCTCGG No data
1116862997_1116862999 -7 Left 1116862997 14:50009231-50009253 CCACAGGAACTTCTAACCTGTTC No data
Right 1116862999 14:50009247-50009269 CCTGTTCCAGTGTGACCCTAAGG No data
1116862997_1116863006 22 Left 1116862997 14:50009231-50009253 CCACAGGAACTTCTAACCTGTTC No data
Right 1116863006 14:50009276-50009298 GTAGCCATCTTGCCACTCTCGGG No data
1116862997_1116863001 0 Left 1116862997 14:50009231-50009253 CCACAGGAACTTCTAACCTGTTC No data
Right 1116863001 14:50009254-50009276 CAGTGTGACCCTAAGGATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116862997 Original CRISPR GAACAGGTTAGAAGTTCCTG TGG (reversed) Intergenic
No off target data available for this crispr