ID: 1116863001

View in Genome Browser
Species Human (GRCh38)
Location 14:50009254-50009276
Sequence CAGTGTGACCCTAAGGATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116862997_1116863001 0 Left 1116862997 14:50009231-50009253 CCACAGGAACTTCTAACCTGTTC No data
Right 1116863001 14:50009254-50009276 CAGTGTGACCCTAAGGATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116863001 Original CRISPR CAGTGTGACCCTAAGGATGC CGG Intergenic
No off target data available for this crispr