ID: 1116863169

View in Genome Browser
Species Human (GRCh38)
Location 14:50010553-50010575
Sequence GTTGTTCAGCAGAGGCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116863157_1116863169 18 Left 1116863157 14:50010512-50010534 CCCAGGGATCCCTTCCATGTTTG No data
Right 1116863169 14:50010553-50010575 GTTGTTCAGCAGAGGCCATGGGG No data
1116863160_1116863169 8 Left 1116863160 14:50010522-50010544 CCTTCCATGTTTGAATTTCCCCA No data
Right 1116863169 14:50010553-50010575 GTTGTTCAGCAGAGGCCATGGGG No data
1116863159_1116863169 9 Left 1116863159 14:50010521-50010543 CCCTTCCATGTTTGAATTTCCCC No data
Right 1116863169 14:50010553-50010575 GTTGTTCAGCAGAGGCCATGGGG No data
1116863161_1116863169 4 Left 1116863161 14:50010526-50010548 CCATGTTTGAATTTCCCCACTCC No data
Right 1116863169 14:50010553-50010575 GTTGTTCAGCAGAGGCCATGGGG No data
1116863158_1116863169 17 Left 1116863158 14:50010513-50010535 CCAGGGATCCCTTCCATGTTTGA No data
Right 1116863169 14:50010553-50010575 GTTGTTCAGCAGAGGCCATGGGG No data
1116863156_1116863169 19 Left 1116863156 14:50010511-50010533 CCCCAGGGATCCCTTCCATGTTT No data
Right 1116863169 14:50010553-50010575 GTTGTTCAGCAGAGGCCATGGGG No data
1116863162_1116863169 -10 Left 1116863162 14:50010540-50010562 CCCCACTCCAAGAGTTGTTCAGC No data
Right 1116863169 14:50010553-50010575 GTTGTTCAGCAGAGGCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116863169 Original CRISPR GTTGTTCAGCAGAGGCCATG GGG Intergenic
No off target data available for this crispr