ID: 1116864642

View in Genome Browser
Species Human (GRCh38)
Location 14:50021855-50021877
Sequence AGATGAACACTTCAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116864642_1116864647 -5 Left 1116864642 14:50021855-50021877 CCCTCCAACTGAAGTGTTCATCT No data
Right 1116864647 14:50021873-50021895 CATCTAGGATCCAGAGCACAGGG No data
1116864642_1116864649 20 Left 1116864642 14:50021855-50021877 CCCTCCAACTGAAGTGTTCATCT No data
Right 1116864649 14:50021898-50021920 GAATTCCCTCAAGCTCTGTATGG No data
1116864642_1116864646 -6 Left 1116864642 14:50021855-50021877 CCCTCCAACTGAAGTGTTCATCT No data
Right 1116864646 14:50021872-50021894 TCATCTAGGATCCAGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116864642 Original CRISPR AGATGAACACTTCAGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr