ID: 1116866851

View in Genome Browser
Species Human (GRCh38)
Location 14:50038297-50038319
Sequence GTGAACAAGAGTCAGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116866851_1116866858 12 Left 1116866851 14:50038297-50038319 CCGCCCACCTGACTCTTGTTCAC 0: 1
1: 0
2: 0
3: 24
4: 237
Right 1116866858 14:50038332-50038354 AATCAGAAAAAGATCAGTCCAGG 0: 1
1: 0
2: 1
3: 25
4: 334
1116866851_1116866861 30 Left 1116866851 14:50038297-50038319 CCGCCCACCTGACTCTTGTTCAC 0: 1
1: 0
2: 0
3: 24
4: 237
Right 1116866861 14:50038350-50038372 CCAGGCTGTTCAGAGTTGGATGG 0: 1
1: 0
2: 1
3: 16
4: 180
1116866851_1116866859 26 Left 1116866851 14:50038297-50038319 CCGCCCACCTGACTCTTGTTCAC 0: 1
1: 0
2: 0
3: 24
4: 237
Right 1116866859 14:50038346-50038368 CAGTCCAGGCTGTTCAGAGTTGG 0: 1
1: 0
2: 3
3: 16
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116866851 Original CRISPR GTGAACAAGAGTCAGGTGGG CGG (reversed) Intergenic
900333273 1:2147542-2147564 GTGGACAACAGACAGATGGGTGG - Intronic
900333294 1:2147705-2147727 GTGGACAACAGACAGATGGGTGG - Intronic
900333356 1:2148167-2148189 GTGGACAACAGACAGATGGGTGG - Intronic
900530765 1:3151952-3151974 GAGAACAGGGGTCTGGTGGGTGG + Intronic
900553621 1:3269074-3269096 GGGAACAGAAGACAGGTGGGTGG + Intronic
901445469 1:9305434-9305456 GTGAACAACAGCCATGTGGCCGG - Intronic
901638088 1:10679678-10679700 GTGAAGATGAGGCAGGTGGAGGG - Intronic
902206409 1:14871322-14871344 AGGAACAAGAGTCAAGAGGGAGG + Intronic
902402842 1:16167508-16167530 GTGGAGGAGAGGCAGGTGGGAGG + Intergenic
902758739 1:18566963-18566985 GTGAACTGGAGCCAGGTGGAAGG + Intergenic
903491052 1:23728889-23728911 TTGACCAAGATTCAGGAGGGAGG + Intergenic
903967244 1:27098562-27098584 GTGAAAAAGAGGCAGAGGGGAGG - Intergenic
904398100 1:30236550-30236572 TTCTCCAAGAGTCAGGTGGGTGG - Intergenic
905939872 1:41854412-41854434 GCGAACAGGAGTCAGTGGGGTGG - Intronic
906562893 1:46772302-46772324 CTGAAAAAGAGACGGGTGGGGGG + Intronic
909833859 1:80229432-80229454 GTGAACAAGAGTCAGTTAGCAGG - Intergenic
909968674 1:81952108-81952130 GTGAAAAAGATTCAGCTGGACGG + Exonic
911296934 1:96129034-96129056 GGCAACAAGATTCAGGTGGAAGG + Intergenic
913260005 1:116989268-116989290 GTGGACATGGGGCAGGTGGGTGG - Exonic
913403726 1:118464521-118464543 TGGAACAAAAGACAGGTGGGGGG + Intergenic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
920941875 1:210491242-210491264 GGGCTCAAGAGTGAGGTGGGAGG - Intronic
921798934 1:219379934-219379956 GTGAAGAAGAGGCAGGAAGGAGG + Intergenic
923728603 1:236529166-236529188 ATGAGGAAGAGTGAGGTGGGAGG + Intronic
924784189 1:247180173-247180195 GTGAACAAAAGTCAAGTGACAGG - Intergenic
1065360626 10:24885970-24885992 GTCAACAGGGGTTAGGTGGGAGG + Intronic
1065768442 10:29053912-29053934 GAGAACAAGAAGCAGGTGAGAGG + Intergenic
1065843730 10:29727797-29727819 GGGAACAAGTGCCAGGTGGGAGG + Intronic
1066526725 10:36288238-36288260 GGGAATGAGAATCAGGTGGGTGG - Intergenic
1066997445 10:42577265-42577287 TTGAACAGGAGTCAGAGGGGAGG - Intronic
1068503133 10:57865228-57865250 GTGCACCAGAGTCAGGTGTTAGG - Intergenic
1068899547 10:62251480-62251502 GTGATTAGAAGTCAGGTGGGAGG - Intronic
1069058749 10:63871807-63871829 GAGTATAAGAGTCAGGTTGGAGG + Intergenic
1069354475 10:67567810-67567832 GTCATCAAGAGTCAGTTGGAGGG + Intronic
1072541699 10:96403115-96403137 GTGACCAGGAGCCAGATGGGAGG - Intronic
1072672908 10:97444421-97444443 GTAGGTAAGAGTCAGGTGGGTGG - Intronic
1072703728 10:97664687-97664709 TTGAACAAGAGCCAGGTCAGAGG + Intronic
1074567788 10:114596927-114596949 GTGAAGGAGAGGCAGGTGGGAGG + Intronic
1076233088 10:128838254-128838276 GTCAAGATGAGCCAGGTGGGAGG - Intergenic
1077050507 11:564309-564331 ATGACAGAGAGTCAGGTGGGAGG - Intergenic
1077400046 11:2350646-2350668 ATGAGCAAGAGAGAGGTGGGGGG - Intergenic
1077485391 11:2836115-2836137 GAGACCAAGAGGCAGATGGGTGG + Intronic
1079239572 11:18713056-18713078 GTGAAACAGGGTGAGGTGGGAGG - Intronic
1082866135 11:57901749-57901771 CTGAACAGGGGTCAGGAGGGAGG + Intergenic
1083047426 11:59749366-59749388 GAGAACCACAGTCAGGTGGGAGG - Intronic
1083361000 11:62108096-62108118 GAAAGCAAGAGGCAGGTGGGTGG - Intergenic
1084582275 11:70031602-70031624 GGGACCAAGAGACTGGTGGGAGG + Intergenic
1085387893 11:76167650-76167672 GTGACCACGGGACAGGTGGGCGG + Intergenic
1086170003 11:83825645-83825667 GTGAACAAGATGGAGGTAGGAGG + Intronic
1087743684 11:101918087-101918109 GGGAAAAAAAGACAGGTGGGTGG - Intronic
1088247538 11:107833647-107833669 TTTAACAAGAGTCATGTAGGAGG - Intronic
1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG + Intronic
1089157891 11:116415991-116416013 GTGTACAAGAGTGAGGGGGTAGG + Intergenic
1089612906 11:119679547-119679569 GTGGACAAGAGGCAGGTGCAAGG - Intronic
1089647693 11:119890905-119890927 GAGACCAAGAAGCAGGTGGGAGG + Intergenic
1090817198 11:130308890-130308912 GGGAAAAGGAGTCAGGCGGGTGG + Intronic
1094713611 12:32989151-32989173 GTGAAAAAGAGACAGGTAGGAGG + Intergenic
1096526676 12:52214144-52214166 GTGGACATGTGTGAGGTGGGAGG + Intergenic
1096571111 12:52523869-52523891 CTGAACAAGCGTGAGGTGGAAGG - Intergenic
1096625861 12:52895645-52895667 CTCAGCAAGAATCAGGTGGGTGG - Intergenic
1096737782 12:53669344-53669366 GTGAAAAAGAGGCAGGTAGAAGG + Intronic
1098106196 12:67070222-67070244 GGAAAAATGAGTCAGGTGGGAGG + Intergenic
1098805457 12:75016151-75016173 GTGAATGAGAGCCAGGTGGGAGG - Intergenic
1099932286 12:89088294-89088316 GTGAAGAAAAGACAGGAGGGAGG + Intergenic
1102624558 12:114224681-114224703 GTGAACAAGATTCACCAGGGAGG + Intergenic
1102915388 12:116748610-116748632 GTGAAGAAGACTTAGCTGGGAGG - Intronic
1104470738 12:129027632-129027654 GTGACCAAGAGTCAGGGGTGAGG + Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1109054241 13:57526755-57526777 GTGAATAGGAGCCTGGTGGGCGG + Intergenic
1110840851 13:80141328-80141350 GAGAGCAAGACTCATGTGGGAGG + Intergenic
1115165212 14:30440488-30440510 GGGAACAGGGGTCGGGTGGGGGG - Intergenic
1116866851 14:50038297-50038319 GTGAACAAGAGTCAGGTGGGCGG - Intergenic
1119722332 14:76899645-76899667 TAGAACAAGAGTGAGGAGGGCGG + Intergenic
1120688972 14:87571156-87571178 GTGCTCAAGTGTCAGGTGGCTGG - Intergenic
1120708598 14:87770751-87770773 GAGAGCAAGAGCCAGGTGGGTGG - Intergenic
1122038497 14:98965242-98965264 GGGAAGGAGAGTGAGGTGGGCGG + Intergenic
1122746488 14:103900001-103900023 GTGAAGAAGAGCACGGTGGGTGG + Intergenic
1124024741 15:25954863-25954885 GGGAACAAGAGCCTGGTGAGGGG + Intergenic
1125980828 15:43999597-43999619 GTTACCAGGAGTCAGGTGTGGGG - Intronic
1127294333 15:57596550-57596572 GTGAAAAAGAGCCAGGAGTGTGG - Intronic
1127308219 15:57728658-57728680 GTGAATCAGAGTCAGGAGGTGGG - Intronic
1128520702 15:68372766-68372788 GTGAGGTAGAGTCAGGTGGGAGG - Intronic
1129034615 15:72641739-72641761 GAGGACAAGGGTCAGCTGGGGGG + Intergenic
1129215267 15:74095477-74095499 GAGGACAAGGGTCAGCTGGGGGG - Intergenic
1131351265 15:91702253-91702275 GGGAACAGGAGTCAGGAGGCTGG + Intergenic
1132626599 16:894382-894404 GTGGACAGGGGACAGGTGGGCGG - Intronic
1135354563 16:21758351-21758373 GTGAACATGAGGCAGGTGCTGGG + Intronic
1135453053 16:22574491-22574513 GTGAACATGAGGCAGGTGCTGGG + Intergenic
1135801987 16:25506098-25506120 GTGAACATGTGTTAGGTGGAAGG - Intergenic
1135921360 16:26651590-26651612 GTCAACAGGAGGCAGGTGGTTGG + Intergenic
1136061927 16:27732591-27732613 GTCAACCAGAGTCAGGGAGGAGG + Intronic
1139346594 16:66307740-66307762 GAGAACATGAGTGAGGTGAGAGG + Intergenic
1140618811 16:76701866-76701888 GTGGACTAGAAGCAGGTGGGAGG - Intergenic
1140623870 16:76769322-76769344 GTGAACAGGTGTCAGCTGGGTGG + Intergenic
1141017301 16:80462700-80462722 GTGAACAGCAGTCATCTGGGTGG - Intergenic
1142189027 16:88708945-88708967 GTGAGCCAGAGTCAGATGGCTGG + Intronic
1143615183 17:8045413-8045435 GTGAAGAAGAGTCAGGAGAATGG + Intronic
1144189640 17:12832659-12832681 ATGAACAAGAGTCAACTTGGAGG + Intronic
1144501252 17:15787739-15787761 GGGAACCAGAGCCAGGTGTGAGG - Intergenic
1144715190 17:17430046-17430068 GTGAACAAGAGTTGACTGGGTGG + Intergenic
1145163421 17:20590413-20590435 GGGAACCAGAGCCAGGTGTGAGG - Intergenic
1145792776 17:27638223-27638245 GGGAACATCAGTCAGGTGGCCGG - Intronic
1145807642 17:27746092-27746114 GGGAACATCAGTCAGGTGGCCGG - Intergenic
1146981191 17:37163232-37163254 GGGAGCAAGAGAGAGGTGGGGGG - Intronic
1147408346 17:40229992-40230014 GTGAAAAACAGACAGGTAGGAGG + Intronic
1148548099 17:48532066-48532088 GTGAAGGAGAGACAGGTAGGAGG - Intergenic
1150931584 17:69590557-69590579 AAGAACAAGAGGCAGGAGGGTGG - Intergenic
1152209987 17:78997976-78997998 GCGCAGGAGAGTCAGGTGGGAGG + Intronic
1154326866 18:13397618-13397640 GATAACAAGAGACAGGTGGTAGG - Intronic
1155335760 18:24763937-24763959 CTGTACATGAGCCAGGTGGGTGG - Intergenic
1155610641 18:27663585-27663607 GAGAACAAGAGCCAGGTGAAAGG + Intergenic
1155679014 18:28466821-28466843 GTGAAGAAGGGACAAGTGGGCGG - Intergenic
1157303544 18:46498817-46498839 GTGAAGAAGAATTTGGTGGGTGG + Intronic
1158258740 18:55585628-55585650 GTTATCAAGATTCAGGTTGGAGG + Intronic
1158543212 18:58375077-58375099 ATGCCCAAGTGTCAGGTGGGAGG - Intronic
1159790318 18:72771174-72771196 GTGAACAAAAGGCAGATGGCAGG + Intronic
1159890967 18:73952876-73952898 GAGATCAAGACACAGGTGGGAGG + Intergenic
1161339889 19:3735625-3735647 ATGAGCAACGGTCAGGTGGGTGG + Exonic
1162184525 19:8894578-8894600 GTGGATAAGAGTCAAGGGGGAGG + Intronic
1164475553 19:28573214-28573236 GAGAACAAGAGCCAGGTTTGAGG - Intergenic
1167100849 19:47403505-47403527 GGGAACCAGAGGCAGGTGTGAGG + Exonic
928180724 2:29066586-29066608 CTGAACAAGATCGAGGTGGGTGG + Intronic
929995796 2:46825654-46825676 GTCAAGAAGAGTCAGATGGGTGG - Intronic
931127547 2:59294701-59294723 GTGAACAAGAGTGGAGGGGGTGG + Intergenic
932160843 2:69458168-69458190 GTGAACAAGAGAAAGGAGGGGGG - Intronic
934131185 2:88950607-88950629 GTTATCCTGAGTCAGGTGGGTGG + Intergenic
937375650 2:121334060-121334082 GCTAACAAGAGTCAGGCGGATGG + Intergenic
938422921 2:131158142-131158164 GTGAAAAACAATCAGGTGAGTGG + Intronic
938896915 2:135761150-135761172 GTAAAGAAGAATCAGGTTGGTGG + Intronic
941616494 2:167726367-167726389 CTGGACAAGGGGCAGGTGGGCGG - Intergenic
944499357 2:200342341-200342363 CTGCAGAAGAGTCAGCTGGGTGG + Intronic
946326529 2:218987301-218987323 AAGATCAAGACTCAGGTGGGTGG - Intergenic
946876890 2:224138469-224138491 AGGAACAAGAGTGAGGAGGGAGG + Intergenic
1172848355 20:37943910-37943932 GAGAAGAAGAGTCGGGGGGGGGG - Intronic
1174534577 20:51241020-51241042 GTGACCAAGAGGCAGGTGGCAGG - Intergenic
1174861148 20:54092479-54092501 CTGAGCTAGAGGCAGGTGGGTGG - Intergenic
1176144490 20:63559518-63559540 GTCAGTCAGAGTCAGGTGGGAGG + Intronic
1176144516 20:63559619-63559641 GTCAGTCAGAGTCAGGTGGGAGG + Intronic
1176144557 20:63559778-63559800 GTCAGTCAGAGTCAGGTGGGAGG + Intronic
1176150803 20:63589782-63589804 TTGATCAGGAGCCAGGTGGGCGG - Exonic
1178331540 21:31699030-31699052 TTGAAAAAGAGTGAAGTGGGAGG + Intronic
1179377313 21:40862190-40862212 GTGAAAAAGTGTAAGGTGTGGGG + Intergenic
1180237552 21:46472823-46472845 GTGACCAAGAGTAAGGCAGGAGG + Intronic
1182459456 22:30473382-30473404 GTGAAGGAGAGCCAGGAGGGAGG + Intergenic
1183383533 22:37502531-37502553 GGGAACAGGAGTGAGGTGGGAGG - Intronic
1183846305 22:40543887-40543909 TTGAACAAGAACAAGGTGGGAGG + Intronic
950162318 3:10769607-10769629 GTGAAAAAGAGGCACGGGGGAGG + Intergenic
950634129 3:14303225-14303247 CTGAACAGGAGCCAGGTAGGTGG - Intergenic
951069044 3:18304052-18304074 GTGACCAAGAGGTAGGAGGGTGG + Intronic
952645378 3:35651277-35651299 TTGAACAAGAGGCAGGTCAGAGG - Intronic
952740271 3:36728030-36728052 ATGAACGATAGTCTGGTGGGAGG - Intronic
952886992 3:38018070-38018092 GGGAACCAGAGTCATGGGGGTGG + Intronic
953708313 3:45247800-45247822 GAGAGCAAGAGAAAGGTGGGAGG - Intergenic
953905412 3:46866075-46866097 GTGAACAGGAGGCAGGAAGGTGG + Intronic
954245190 3:49325848-49325870 ATGAACAAGAGGCAGGGGTGAGG + Intronic
954499501 3:50997719-50997741 ATCAAAAAGAGTGAGGTGGGTGG - Intronic
954718448 3:52539085-52539107 GTGAAAAAGAGTCAGGATGATGG + Intronic
959699124 3:109281783-109281805 GTGGATAAGATACAGGTGGGAGG + Intergenic
962436430 3:135371429-135371451 GGGAACAGGAGGGAGGTGGGTGG - Intergenic
962754829 3:138459239-138459261 GTGAACGGGATCCAGGTGGGTGG + Exonic
962982254 3:140501147-140501169 GAGAACAAGAGCAAGGTGGGTGG - Intronic
964710819 3:159669596-159669618 GTGACCTGGAGTGAGGTGGGAGG - Intronic
965362508 3:167758615-167758637 GTGAAAAAGTGTCATGTGGTTGG - Intronic
965362601 3:167760014-167760036 GTGAAAAAGTGTCATGTGGTTGG + Intronic
966201361 3:177361991-177362013 GTGAAGAAGAGCCATGTTGGGGG + Intergenic
966266277 3:178048332-178048354 GTTAACAAGATTCAGGTGCAAGG - Intergenic
966528618 3:180947881-180947903 ATGACCAAGAGCCATGTGGGTGG + Exonic
966569161 3:181421720-181421742 ATGACAAAGAGTCAGGTAGGAGG - Intergenic
967279028 3:187804678-187804700 GTGGTGAAGACTCAGGTGGGAGG - Intergenic
968273105 3:197419941-197419963 TGGATCAAGAGTCAGGAGGGTGG + Intergenic
969315835 4:6380937-6380959 GGGGAGCAGAGTCAGGTGGGAGG - Intronic
969570605 4:8006102-8006124 GAGAACACGAGCCTGGTGGGTGG - Intronic
971167705 4:24201406-24201428 GTGAACAACACCCAGGTGGAGGG - Intergenic
972791960 4:42381331-42381353 GTCAACAAGAAGCAGGTGGTCGG - Intergenic
973588352 4:52414441-52414463 GAGAACAAGAGTGAGGAGTGAGG + Intergenic
973617334 4:52691912-52691934 GTTCACAAGAGTCTGATGGGTGG - Intergenic
973711421 4:53633587-53633609 GTAAACAAGACTCAGGGGGCTGG + Intronic
975545954 4:75560804-75560826 GAGCACAAGAGGCGGGTGGGTGG + Intronic
976382672 4:84418121-84418143 GAGAACAACAGGCAGGTGGCAGG + Intergenic
977487815 4:97670998-97671020 GAGAACAAAAGTCAGGGAGGTGG - Intronic
981456028 4:144954195-144954217 GTGAGCAACAGTGAGGAGGGAGG - Intergenic
982233155 4:153227744-153227766 GTGAACTAGAGTCATGGTGGGGG + Intronic
983004149 4:162461856-162461878 GTGAACATGACTTAGCTGGGTGG - Intergenic
985120108 4:186631610-186631632 GAGCACAGGAGTCAGCTGGGAGG - Intronic
985549520 5:525882-525904 GTGGACAAAGGGCAGGTGGGCGG + Intergenic
985888812 5:2700114-2700136 GGGAACCAGAGCCAGGTGAGGGG + Intergenic
987002671 5:13675973-13675995 ATGAACAGGAGGCAGGTGGCAGG + Intergenic
988646885 5:33104863-33104885 CTGAACGAGAATCAAGTGGGTGG + Intergenic
989609092 5:43274290-43274312 GTGTTCAAGAATCAGGTGGTAGG - Intronic
990583184 5:57184470-57184492 GGGAGCAAGAGTGAGGTGAGGGG + Intronic
994896790 5:105716124-105716146 GAAAACAAGAGTGAAGTGGGAGG + Intergenic
996766995 5:127044611-127044633 GTGAACAAGAGTCATGGGTCTGG + Exonic
998656647 5:144188742-144188764 GTGGAAAAGAGTCAGGTGAGAGG + Intronic
998679617 5:144452483-144452505 GGGAGCAAGAGACAGGTGAGAGG + Intronic
999830342 5:155312969-155312991 AGGGACAAGAGTCAGGTGGTAGG + Intergenic
1002581332 5:180211056-180211078 GAGACCAAGGGTCAGGTGTGGGG + Intergenic
1003179631 6:3780643-3780665 GTCTAAAAGAGGCAGGTGGGAGG + Intergenic
1004176895 6:13347926-13347948 GTGAAGAGGAGTCAGGAGGAAGG + Intergenic
1005572228 6:27156672-27156694 GTGAAAAAGAATCAAGTGGCCGG + Intergenic
1005693416 6:28329129-28329151 GATGACAAGACTCAGGTGGGCGG - Intronic
1005814320 6:29538605-29538627 GTGAACATGAGTCATACGGGAGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007241960 6:40432701-40432723 GTGAACAACAACCAGCTGGGCGG - Exonic
1008204925 6:48643314-48643336 GTCAACAAGAAGCAGGTGGTTGG - Intergenic
1008871644 6:56279173-56279195 AAGAACAAGAGTGAGGTGGGAGG - Intronic
1011613810 6:89179811-89179833 GGAAAGGAGAGTCAGGTGGGAGG + Intronic
1013014874 6:106151875-106151897 GAGAACAAGAGTCAAGCGAGAGG - Intergenic
1013378683 6:109544536-109544558 GAGAAAGAGAGTGAGGTGGGAGG - Intronic
1015934423 6:138394230-138394252 GTTAACAAGAGGCAAGTGGTCGG + Intergenic
1016857225 6:148683346-148683368 GTAAACAGGAGACAGATGGGAGG - Intergenic
1017051776 6:150400078-150400100 GTGAACAAATGTAACGTGGGTGG + Exonic
1017601129 6:156082485-156082507 GTGAATAAGAGACAGGCTGGTGG - Intergenic
1018377518 6:163227266-163227288 AGGAACAAGAGGGAGGTGGGAGG + Intronic
1018974240 6:168552829-168552851 GTGAGCAACAGGCTGGTGGGGGG - Intronic
1019379516 7:713475-713497 GTGAGCAAGAGACGGGTGAGTGG - Intronic
1020154184 7:5708956-5708978 GAGAACAAGAGAAAGCTGGGTGG - Intronic
1020339885 7:7098860-7098882 TAGGACAAGAGTCATGTGGGAGG - Intergenic
1020449602 7:8306199-8306221 GTGAACAAGAGTGAGGATGCTGG - Intergenic
1021121255 7:16798302-16798324 ATGAACAGGAGTCAGTTAGGTGG + Intronic
1021620989 7:22550767-22550789 GTGAAGAACAGTGAGGTAGGAGG - Intronic
1022151054 7:27606960-27606982 GTGAACAAGGGTTAGGGGGTGGG - Intronic
1026300197 7:69091004-69091026 GAGAACCAGAATCAGGTGTGAGG - Intergenic
1026358392 7:69580101-69580123 TTGAACAAGAGTCAGGATGTTGG + Intergenic
1027261107 7:76465224-76465246 GTGAAGCAGAGTCATGGGGGTGG + Intronic
1030098078 7:105919338-105919360 GTGAACGGGAGTTAGGTGGGAGG - Intronic
1031049662 7:116932184-116932206 GTGCACAAGAGTAAGGGGGAAGG - Intergenic
1032879178 7:136070795-136070817 GTGAAAATGAGGCAGGAGGGTGG + Intergenic
1034285463 7:149880748-149880770 AGAAACAAGAATCAGGTGGGCGG - Intergenic
1034331528 7:150287322-150287344 GAAAAGCAGAGTCAGGTGGGAGG + Intronic
1034460577 7:151195835-151195857 GTGAACAGGTGCCAGGAGGGAGG - Intronic
1034666515 7:152822539-152822561 GAAAAGCAGAGTCAGGTGGGAGG - Intronic
1035069143 7:156128111-156128133 GGGAACCAGGGTCAGGTGGGTGG + Intergenic
1036025196 8:4899913-4899935 GTGAACAAGACTCTGGTGATGGG - Intronic
1037086487 8:14857124-14857146 ATGAACAAGAGAGAGGAGGGAGG - Intronic
1037760269 8:21737421-21737443 ATGAAGTAGAGTCAGGTGGAGGG - Intronic
1037926645 8:22848638-22848660 GAGAAAAAGAGGCAGGTGGGAGG + Intronic
1038662577 8:29510028-29510050 GTCAACAGGAGGCAGGTGGTTGG - Intergenic
1038713786 8:29973503-29973525 GTGAACAAGAGATAGGTGTGGGG + Intergenic
1039845278 8:41321498-41321520 GTGACCAAGAGTCTGGGGAGAGG - Intergenic
1041365575 8:57100045-57100067 GAGATCAAGAATCATGTGGGAGG - Intergenic
1042910252 8:73818775-73818797 GGGAACAAGAGTCAGTGGCGAGG - Intronic
1043203836 8:77410147-77410169 GTGATCAAGAGTCAAGAGGAAGG - Intergenic
1043734401 8:83725197-83725219 GTGAACAGGAGTCAACTGGGTGG - Intergenic
1043768064 8:84162610-84162632 GTGAAAAAGACACAGATGGGTGG - Intergenic
1048477225 8:134754666-134754688 TTGAAGAAGGGTGAGGTGGGTGG - Intergenic
1051445493 9:17135241-17135263 GTGAAGAAGGGTCAGGGGGCCGG + Exonic
1060033079 9:120232325-120232347 GTGAGCAAGTGACAGGTGGGTGG + Intergenic
1061028808 9:128067548-128067570 GTGAATAAAGGTTAGGTGGGCGG - Intronic
1061182797 9:129034833-129034855 GTGGACAAGAGACAGGTATGTGG - Intergenic
1061802480 9:133120144-133120166 GTCAGCAGCAGTCAGGTGGGAGG + Intronic
1061927962 9:133815482-133815504 GTGAAGAACAGTCAGAAGGGTGG - Intronic
1062534719 9:137016422-137016444 GACAACCAGAGGCAGGTGGGTGG + Exonic
1185959156 X:4528376-4528398 ATGAACAAAGGTCAGGTGAGTGG - Intergenic
1192604854 X:72505969-72505991 GTGACTCTGAGTCAGGTGGGAGG - Intronic
1193233836 X:79082120-79082142 GTGAATGAGTGTCTGGTGGGGGG - Intergenic
1195342815 X:103921354-103921376 CTGAACAAGAGTCTTCTGGGAGG - Intronic
1195424532 X:104713435-104713457 GAAAACAAGAGTAAGGTGGAAGG - Intronic
1195705573 X:107735727-107735749 GAGAGCAATAGTCAGCTGGGGGG - Intronic
1195880336 X:109586529-109586551 GAGAACAGGAGGGAGGTGGGTGG - Intergenic
1197834560 X:130680834-130680856 TTGGATAAGAGTCAGGTTGGGGG - Intronic
1201747684 Y:17396751-17396773 ATGAACAAAGGTCAGGTGAGTGG - Intergenic