ID: 1116867181

View in Genome Browser
Species Human (GRCh38)
Location 14:50040343-50040365
Sequence GATGGGATAGAGAAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116867174_1116867181 -6 Left 1116867174 14:50040326-50040348 CCAAGCCCACTTGCAAAGATGGG No data
Right 1116867181 14:50040343-50040365 GATGGGATAGAGAAGGGGCATGG No data
1116867169_1116867181 17 Left 1116867169 14:50040303-50040325 CCTGAAGAACTCATCCCAAGAAC No data
Right 1116867181 14:50040343-50040365 GATGGGATAGAGAAGGGGCATGG No data
1116867170_1116867181 3 Left 1116867170 14:50040317-50040339 CCCAAGAACCCAAGCCCACTTGC No data
Right 1116867181 14:50040343-50040365 GATGGGATAGAGAAGGGGCATGG No data
1116867171_1116867181 2 Left 1116867171 14:50040318-50040340 CCAAGAACCCAAGCCCACTTGCA No data
Right 1116867181 14:50040343-50040365 GATGGGATAGAGAAGGGGCATGG No data
1116867172_1116867181 -5 Left 1116867172 14:50040325-50040347 CCCAAGCCCACTTGCAAAGATGG No data
Right 1116867181 14:50040343-50040365 GATGGGATAGAGAAGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116867181 Original CRISPR GATGGGATAGAGAAGGGGCA TGG Intergenic
No off target data available for this crispr