ID: 1116867438

View in Genome Browser
Species Human (GRCh38)
Location 14:50042274-50042296
Sequence CAGAGCATGGAGAATTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116867438_1116867443 21 Left 1116867438 14:50042274-50042296 CCTGTGTAATTCTCCATGCTCTG 0: 1
1: 0
2: 0
3: 14
4: 199
Right 1116867443 14:50042318-50042340 GGTGAAATCAGAGCATCCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 173
1116867438_1116867440 0 Left 1116867438 14:50042274-50042296 CCTGTGTAATTCTCCATGCTCTG 0: 1
1: 0
2: 0
3: 14
4: 199
Right 1116867440 14:50042297-50042319 TCTCTCTCCCTTTACTTATCAGG 0: 1
1: 0
2: 3
3: 52
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116867438 Original CRISPR CAGAGCATGGAGAATTACAC AGG (reversed) Intergenic
901118268 1:6866937-6866959 GAGATCATGGAGAAGCACACGGG - Intronic
909030154 1:70529875-70529897 CAGAGCTTGGAGAATAAAATTGG + Intergenic
909117727 1:71560413-71560435 TATATAATGGAGAATTACACAGG - Intronic
911621622 1:100072221-100072243 GAGAGGAGGGAGAAATACACTGG - Intronic
912061887 1:105684090-105684112 CAGAGAAGGAATAATTACACAGG + Intergenic
915682005 1:157590411-157590433 CAGATGATTGAGATTTACACAGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917114800 1:171591958-171591980 CAGAGCTTGGAGATGTACAAGGG + Exonic
918178536 1:182066340-182066362 CAGAGCATGGGGAAGAACATAGG - Intergenic
918253548 1:182726349-182726371 CAGAGCATGGAGATTGAGACTGG - Intergenic
918273876 1:182931892-182931914 CAGAGCATAGAGAATTCTAAGGG - Intronic
919035596 1:192304489-192304511 CACACCATGGAATATTACACAGG - Intergenic
919348221 1:196414740-196414762 AAAATCATGGAGAATTACATGGG - Intronic
920024466 1:202983329-202983351 AACAGCATGGAAAATTATACAGG - Intergenic
920034354 1:203056278-203056300 CGGAGCATGGAGAAATGCAGTGG - Intronic
921181741 1:212636881-212636903 CAGAGCTTGGAGAGAAACACCGG - Intergenic
921840505 1:219823101-219823123 TAGAGAATGGAGACTTACAGAGG + Intronic
923264634 1:232302462-232302484 CAGAGAATGGAGAAATAACCAGG - Intergenic
924755248 1:246934652-246934674 TAGATTATGGACAATTACACAGG - Intergenic
924905362 1:248446443-248446465 AAGGGCATGGAGGATTACACAGG - Intergenic
924905379 1:248446543-248446565 AAGGGAATGGAGGATTACACAGG - Intergenic
924922510 1:248645493-248645515 GAGGGCATGGAGGATTACACAGG + Intergenic
924922529 1:248645608-248645630 GAGGGCATGGAGGATTACACAGG + Intergenic
1063860483 10:10302053-10302075 CAGAGCAAAGAGAAGTATACAGG - Intergenic
1070552958 10:77505340-77505362 CAGGGCATGGAGCCTTGCACAGG - Intronic
1071605898 10:86988926-86988948 CTGAGCATAGAGAAATAAACTGG - Intergenic
1071856215 10:89626931-89626953 CAGAGCATGGTTAATTAAAGAGG + Intronic
1071993524 10:91124691-91124713 CAGAGCCTGCAGAATCACGCTGG + Intergenic
1073761789 10:106637004-106637026 CAGAGCCTGGCATATTACACTGG - Intronic
1075207780 10:120462007-120462029 CCCAGCATGGAGTCTTACACTGG - Intronic
1076671365 10:132122546-132122568 CAGAGCATGGAGGCTTTAACAGG + Intronic
1076917986 10:133434029-133434051 CACACCATGGAATATTACACAGG - Intergenic
1076937984 10:133578106-133578128 CACACCATGGAATATTACACAGG - Intergenic
1078375802 11:10792281-10792303 CAGACCAAGGATAATTTCACAGG + Intergenic
1082254559 11:50019229-50019251 CAGAGCATGAAGAAATCCCCCGG - Intergenic
1082566963 11:54692616-54692638 CAGACAATGAAGAAGTACACTGG - Intergenic
1083386377 11:62313254-62313276 CAGATCGAGGAGAAATACACAGG - Intergenic
1083860081 11:65415667-65415689 CAGTGCATGGAGAGACACACGGG + Intergenic
1084713175 11:70856851-70856873 AAGAGCAGGGAGAACCACACTGG - Intronic
1086854333 11:91848424-91848446 CAGGGCAGGGAGCATCACACAGG - Intergenic
1091298185 11:134488030-134488052 CACAGCATGGAATATTACTCAGG + Intergenic
1100414131 12:94354506-94354528 CAGAACATGGAGCATTCCACAGG + Intronic
1101026990 12:100618710-100618732 CAGAGAATGGAGAATAGTACCGG - Intronic
1103071319 12:117944946-117944968 CAGAGCAAGGAAAATTACCAGGG + Intronic
1104134415 12:125923685-125923707 CACAGCATGGACTATTACTCAGG - Intergenic
1105240726 13:18608058-18608080 CAGAACGTGAAGAATTACATTGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1109244965 13:59942830-59942852 ATGAACATGGAAAATTACACTGG - Intronic
1109391128 13:61695039-61695061 GTGAGAATGGAGTATTACACTGG + Intergenic
1113319811 13:109222552-109222574 CAGATCTTGGAGAATGACAGTGG - Intergenic
1113498229 13:110750790-110750812 CAGAGAATGGAGAAATAGAAAGG - Intergenic
1113726875 13:112610637-112610659 CAGAGCAAAGAAAATTACTCGGG + Intergenic
1116867438 14:50042274-50042296 CAGAGCATGGAGAATTACACAGG - Intergenic
1119701008 14:76754724-76754746 CAGTGCATGGAGAAAAACGCTGG + Intergenic
1120126798 14:80754086-80754108 CATTGCATGGAGAATCACAAAGG - Intronic
1120601895 14:86521233-86521255 CAAAGCTTGCATAATTACACTGG - Intergenic
1121647292 14:95527507-95527529 CAGAGAATGTATAATTACAGGGG + Intergenic
1121933449 14:97994581-97994603 CAGAACATTTAAAATTACACAGG - Intergenic
1123337556 15:18948197-18948219 CAGAGCATTGAAAATTTCATTGG + Intergenic
1123490543 15:20776264-20776286 CAGAACGTGAAGAATTACATTGG + Intergenic
1123547045 15:21345351-21345373 CAGAACGTGAAGAATTACATTGG + Intergenic
1124162088 15:27281084-27281106 CAGAGCAAAGAGAATTACCAAGG - Intronic
1124164000 15:27302369-27302391 CAGAGCATAGAAAATTACCAGGG + Intronic
1125060465 15:35415416-35415438 AAGAGCATAGAGCTTTACACAGG + Intronic
1125461191 15:39908291-39908313 CAGAGCCTGGAGAATTGAGCAGG - Intronic
1127336941 15:57996328-57996350 CAGAGGATAGAGAGTGACACTGG - Intronic
1127975816 15:63996670-63996692 ACGAGCATGGAGAAATACAGTGG + Intronic
1129659307 15:77543980-77544002 CAGAGCATAGCTAATTACCCTGG + Intergenic
1131032615 15:89199020-89199042 CAGAGCATTGAGAATTCCCAGGG + Exonic
1132134398 15:99320618-99320640 AAGAGCATGGAGAAATATGCTGG + Intronic
1202955376 15_KI270727v1_random:72567-72589 CAGAACGTGAAGAATTACATTGG + Intergenic
1134899969 16:17928929-17928951 CATATCATGGAGAATCACCCAGG - Intergenic
1135418976 16:22291734-22291756 AAGAGCATTGAGATTTACACTGG - Intergenic
1136643951 16:31592461-31592483 CAGAGATGGGAGAATTACATGGG + Intergenic
1136987768 16:35127025-35127047 CAGAGCATGGAAAATTATTTTGG + Intergenic
1138385457 16:56633015-56633037 CAGAGCCTGGAGGAGAACACTGG - Intronic
1138386025 16:56636104-56636126 CAGAGCCTGGAGGAGAACACTGG - Intergenic
1138871940 16:60900865-60900887 CAGACCTTGGAGAAAAACACAGG + Intergenic
1143224117 17:5286135-5286157 CAGAGCTTGTAGGATTACAGGGG - Intronic
1146550336 17:33775333-33775355 CAGAGGATGCAGCAGTACACTGG + Intronic
1149030775 17:52079951-52079973 CAGAACATTGAGAATTGAACTGG + Intronic
1149364277 17:55925554-55925576 CAAAGCATGAAGAATTTCAAAGG + Intergenic
1150724106 17:67637616-67637638 CAGAGCTTGGAGTTTTCCACTGG + Intronic
1151688123 17:75661763-75661785 TAGAGCAGGGTGCATTACACTGG - Intronic
1152503913 17:80734342-80734364 CGGATCCTGGAGAATTACAAAGG - Intronic
1156219514 18:35037685-35037707 CAGGGTAGGGAGAATTACCCAGG - Intronic
1159724865 18:71944487-71944509 CAGAGGATGCAAAATTCCACAGG - Intergenic
1160111893 18:76040497-76040519 CAGGGCATGGGGAATTCCAGAGG - Intergenic
1163864734 19:19763220-19763242 GAGATCTTGGAGAATTATACTGG + Intergenic
924967252 2:90451-90473 CAGAGCAAGGAAAATTACTAGGG + Intergenic
924996136 2:363653-363675 CAGAGCATTTAGGATTAGACAGG + Intergenic
926632011 2:15145188-15145210 CAGAGTATGTAGAATGTCACTGG - Intergenic
927439172 2:23098383-23098405 CATACCATAGACAATTACACAGG + Intergenic
930058756 2:47272018-47272040 CAGAGCCTGCAGAAGTAAACAGG + Intergenic
933359539 2:81262148-81262170 CAGAGCACAGGTAATTACACAGG + Intergenic
934165196 2:89288108-89288130 CACAGCTTGGAGCATTACCCAGG - Intergenic
934202077 2:89894354-89894376 CACAGCTTGGAGCATTACCCAGG + Intergenic
934882593 2:97996326-97996348 CAGAGCACGGAGGATTGCCCAGG - Intergenic
935322485 2:101902456-101902478 CAGCCCAAGCAGAATTACACAGG + Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
936854877 2:116945276-116945298 CATACAATGGAGAATTACACAGG + Intergenic
937139401 2:119586295-119586317 CACAGGATGTAGAATTACCCTGG + Intronic
937694880 2:124797715-124797737 TAGTGCATAGAGAAATACACTGG - Intronic
938395414 2:130943212-130943234 CAGAGCAAGGAAAATTACCAAGG - Intronic
940917890 2:159277458-159277480 AAGACAATGGAAAATTACACAGG + Intronic
943910516 2:193560667-193560689 CAAAGCAAGGAGATTAACACTGG + Intergenic
944945972 2:204685678-204685700 CTGAACATGGAGATTTAAACAGG + Intronic
945867194 2:215189581-215189603 CAGAGCATGGCCCATTCCACTGG - Intergenic
1169082134 20:2804072-2804094 ATGAGCATGGAGAAATACAAAGG + Intergenic
1169672566 20:8119235-8119257 CAGAGCATGTAGATTGGCACGGG - Intergenic
1170417428 20:16159290-16159312 CAGAGCATCAAGAATGACACAGG + Intergenic
1172701023 20:36853832-36853854 CAGAGCAGGGAGATATCCACAGG + Intronic
1173055494 20:39608263-39608285 GAGACCATGGAAAATTAAACAGG + Intergenic
1173112402 20:40204567-40204589 CAGTGCATGGACAATTTCTCTGG + Intergenic
1174392945 20:50229112-50229134 CAGAGCATGGACAATTAGCTCGG + Intergenic
1178634429 21:34289887-34289909 CAGATCATAGAGAATGACAGTGG + Intergenic
1184738919 22:46415823-46415845 AGGCGCATGGACAATTACACAGG + Intronic
1185126001 22:49011186-49011208 CAGAGGATGGGGAAGTACACGGG + Intergenic
949315000 3:2743377-2743399 CAGAGCACAGAGAATTACTGTGG + Intronic
949772296 3:7592538-7592560 CAGCGCATGCAGAATCAGACTGG + Intronic
950179860 3:10903745-10903767 GAGAGCATTGAGAAATACTCTGG - Intronic
950426127 3:12925657-12925679 CAGAGCATGGGTCATTCCACTGG + Intronic
951454730 3:22877842-22877864 GAGGGCATGGAAAATTAGACTGG - Intergenic
951743856 3:25954782-25954804 CAGAGCATGGAGAATCCTAGAGG + Intergenic
953375653 3:42426408-42426430 CAGACCATGGAGGATTCTACAGG + Intergenic
955532440 3:59888032-59888054 CAGAGCTTGGAAAATAAGACGGG + Intronic
956398778 3:68853868-68853890 CAGAGCATACAGAAATAAACAGG + Intronic
957517827 3:81278764-81278786 CACAGGATGGAGAGTGACACTGG + Intergenic
958651799 3:96945962-96945984 CAGAGCATGGAGAATTTTTAGGG - Intronic
959738418 3:109687657-109687679 AAGAGCATGGAGAAATATTCTGG + Intergenic
961010856 3:123434854-123434876 CAGACCATGCAGGATGACACAGG + Intronic
961336533 3:126183521-126183543 AAGAGCGTGGAGAATCACTCTGG + Intronic
961714886 3:128851555-128851577 CTGTGCATGGAGAAATACAGTGG - Intergenic
963254708 3:143133402-143133424 GAGGGCATGGAGAAAGACACCGG - Intergenic
966508684 3:180736205-180736227 GAGAGAATGGAGACTTAAACAGG - Intronic
970687167 4:18581648-18581670 TAGAGCTTGGAGGATTGCACAGG + Intergenic
971010355 4:22427703-22427725 CAATGCATGAAAAATTACACTGG + Intronic
971210017 4:24607237-24607259 CAGATCATGGAGAATGGCAGTGG + Intergenic
973999220 4:56493946-56493968 CAGGGCATAGAGGAGTACACCGG + Intronic
974720935 4:65737203-65737225 CAGGGCATGGAGACTAACAATGG - Intergenic
975026099 4:69550460-69550482 TAGAGCATGCAGAATTCCATTGG + Intergenic
976958671 4:90938678-90938700 CAGTGCATGTAGGATTCCACAGG - Intronic
977224310 4:94376409-94376431 AAGAGAATGGAGAACTACATTGG + Intergenic
977675340 4:99741016-99741038 CAGAGCTGGGATAGTTACACTGG + Intergenic
978362680 4:107947768-107947790 CAGAGCATACACAATTATACTGG + Intronic
979447942 4:120837015-120837037 CAGAGCATGGTGAATTTGATAGG - Intronic
979552750 4:122009645-122009667 CAGGGAATGAAGAATTACCCTGG + Intergenic
983506356 4:168557740-168557762 CAGAGGTTTGAGAATTACATGGG - Intronic
988107654 5:26771651-26771673 GAGAGCTTGGAGAATGACAGTGG + Intergenic
992242819 5:74788859-74788881 CGGATCTTGGAGAATTACAGTGG + Intronic
993388984 5:87295103-87295125 CAGAGCATGGAAAGTTACCAGGG - Intronic
993412680 5:87592703-87592725 CAGATCCTGGAGAATGACAGTGG - Intergenic
994384246 5:99110554-99110576 GAAAGCATGCAGAATCACACAGG + Intergenic
995515615 5:112951825-112951847 GAGAGCATGGAGAATCTCAATGG - Intergenic
997716627 5:136047601-136047623 AAGAAGATGGAGAATTTCACAGG - Intronic
998973675 5:147620579-147620601 CATAGCATGGAAAATTAAAAAGG + Intronic
999930180 5:156423736-156423758 CAAAGCATGGAGAAGAACCCAGG - Intronic
1000864436 5:166495123-166495145 CAGAGTATGGAGCATTCTACAGG - Intergenic
1003041905 6:2696115-2696137 CAGTGGATGTAGAATGACACAGG + Intronic
1003840827 6:10117633-10117655 GAGAGTAAGGAGAAATACACAGG - Intronic
1003891076 6:10564305-10564327 CAGAGCATGTAGAATTTGAGGGG - Intronic
1004287282 6:14333271-14333293 CAGACCTTGGAGCATCACACTGG + Intergenic
1006062238 6:31432329-31432351 CAGATCTTGGAGAATGACAGTGG + Intergenic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1009296440 6:61956655-61956677 CAGAGAATGGAGAATTTACCTGG - Intronic
1010643853 6:78363761-78363783 CAGGGCATGGAAAATTTCAGAGG - Intergenic
1010942747 6:81938138-81938160 CAGGGCAAGGAGAATTGCAAAGG + Intergenic
1014416879 6:121194503-121194525 CAGATCTTGGAGAATGACACTGG + Intronic
1018666182 6:166140593-166140615 CAGAGCATGGAGAGTAAAAAGGG - Intergenic
1018694079 6:166376727-166376749 CAGAGCAAGGAAAATTACCAGGG - Intronic
1020764349 7:12301927-12301949 AAGATAATGGAGAATTACAATGG + Intergenic
1021112899 7:16715587-16715609 CAGAGAATAGAGAGTAACACAGG + Intergenic
1022068195 7:26882956-26882978 CAGAAAAGAGAGAATTACACAGG + Intronic
1022514719 7:30968306-30968328 GAGAGCAAGGAGAATGACACAGG + Intronic
1024865988 7:53905472-53905494 CAGATCTTGGAGAATGACAGTGG + Intergenic
1031052167 7:116954777-116954799 CAGAGTATGGAGATTAACAAGGG - Intronic
1031549112 7:123086214-123086236 AGGAGAATGGAGAATTGCACAGG + Intergenic
1033060350 7:138100535-138100557 CAGAGCAATGAGTATTACATGGG + Intronic
1033266847 7:139894325-139894347 CAGGGCATGGAGAATCACAGTGG + Intronic
1034532558 7:151705725-151705747 CAGAGCCTGGAGAGTTAAGCAGG - Intronic
1034670003 7:152850554-152850576 CAGAGCAGGAAGAATGAAACGGG - Intronic
1034767325 7:153737125-153737147 CAGAGCAAGAAAAATTACAAGGG + Intergenic
1034919212 7:155065578-155065600 CAGAGGATGGAAACTTACAAAGG + Intergenic
1037526655 8:19730990-19731012 CAGAGAATGGAGAATTAACCAGG + Intronic
1039474094 8:37830322-37830344 CGGAGTAGGGAGAATAACACTGG - Intronic
1046337016 8:112803852-112803874 CCGGGCATGGAGATTTGCACAGG + Intronic
1047793082 8:128225264-128225286 CAGAAGATGGATAATTAAACAGG - Intergenic
1048190132 8:132280870-132280892 CTGAGCATAGAGAGCTACACTGG + Intronic
1049201852 8:141344141-141344163 CAGAACATGGAAAATTAAATAGG + Intergenic
1049392089 8:142376903-142376925 CAGAGCAGGGAGAGCCACACAGG + Intronic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1050387921 9:5110732-5110754 CAGAGCAAAGAAAATAACACGGG - Intronic
1051410459 9:16784976-16784998 CAGAGAATGGACACTTACAGAGG + Intronic
1052310294 9:27060131-27060153 CACAGCTTGTGGAATTACACAGG + Intronic
1052763558 9:32617615-32617637 TAGAGCACAGAGAATTCCACAGG + Intergenic
1053306055 9:36985672-36985694 CAGAGCATGGGGATACACACAGG + Intronic
1055744148 9:79424295-79424317 CAGAACATGGAAAATTCCCCAGG - Intergenic
1055980539 9:81995839-81995861 GGCAGCATGGAGAAATACACAGG - Intergenic
1056127057 9:83544455-83544477 CAGAGAATGGTGTATTCCACAGG + Intergenic
1056974458 9:91238473-91238495 CATAGCATAGAGAATAAAACTGG + Intronic
1057508406 9:95656186-95656208 CAGAGCATGGAGAATTCTTAGGG - Intergenic
1057750023 9:97785121-97785143 CAGAACATGGAAAATTCTACAGG + Intergenic
1059875687 9:118631975-118631997 CAGTGCAAGGAGATTTACTCAGG + Intergenic
1187076384 X:15939346-15939368 AAGAGGATGGAGAATTACATGGG + Intergenic
1187719963 X:22139882-22139904 TAGAGCATGGAAAATCACTCCGG - Intronic
1188632505 X:32383051-32383073 CAGAGCATAGAGAAATAAAAAGG + Intronic
1189751636 X:44228465-44228487 AAGAGCAGAGACAATTACACAGG - Intronic
1193038215 X:76976579-76976601 CAGAACATGGAGAAACAAACTGG + Intergenic
1194115550 X:89892383-89892405 CAGAGCTTGGAGATGTACAAGGG - Intergenic
1194557515 X:95379240-95379262 CTGAGCATGGAAACTGACACTGG - Intergenic
1194845164 X:98797653-98797675 CAGAGCATGGAAAATAATTCAGG + Intergenic
1195822349 X:108959543-108959565 CAGATGATGCTGAATTACACAGG + Intergenic
1199862510 X:151814557-151814579 AAGAGCATGGACAAATACTCTGG + Intergenic
1200468344 Y:3549518-3549540 CAGAGCTTGGAGATGTACAAGGG - Intergenic