ID: 1116869755

View in Genome Browser
Species Human (GRCh38)
Location 14:50059963-50059985
Sequence CCATGCACTCCAGGCACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116869741_1116869755 9 Left 1116869741 14:50059931-50059953 CCTACCCCTGCCAACCACCCATT No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869745_1116869755 4 Left 1116869745 14:50059936-50059958 CCCTGCCAACCACCCATTGGGTC No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869749_1116869755 -8 Left 1116869749 14:50059948-50059970 CCCATTGGGTCAGACCCATGCAC No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869748_1116869755 -5 Left 1116869748 14:50059945-50059967 CCACCCATTGGGTCAGACCCATG No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869738_1116869755 21 Left 1116869738 14:50059919-50059941 CCAACTCCCACTCCTACCCCTGC No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869736_1116869755 25 Left 1116869736 14:50059915-50059937 CCTCCCAACTCCCACTCCTACCC No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869746_1116869755 3 Left 1116869746 14:50059937-50059959 CCTGCCAACCACCCATTGGGTCA No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869740_1116869755 14 Left 1116869740 14:50059926-50059948 CCACTCCTACCCCTGCCAACCAC No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869750_1116869755 -9 Left 1116869750 14:50059949-50059971 CCATTGGGTCAGACCCATGCACT No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869747_1116869755 -1 Left 1116869747 14:50059941-50059963 CCAACCACCCATTGGGTCAGACC No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869739_1116869755 15 Left 1116869739 14:50059925-50059947 CCCACTCCTACCCCTGCCAACCA No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869737_1116869755 22 Left 1116869737 14:50059918-50059940 CCCAACTCCCACTCCTACCCCTG No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data
1116869744_1116869755 5 Left 1116869744 14:50059935-50059957 CCCCTGCCAACCACCCATTGGGT No data
Right 1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116869755 Original CRISPR CCATGCACTCCAGGCACTGA GGG Intergenic
No off target data available for this crispr