ID: 1116873565

View in Genome Browser
Species Human (GRCh38)
Location 14:50090430-50090452
Sequence TCCCTTGACCTCCCCCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 146}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116873556_1116873565 27 Left 1116873556 14:50090380-50090402 CCTAGAGATAATTCCTATTTCCC 0: 1
1: 0
2: 0
3: 22
4: 214
Right 1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG 0: 1
1: 0
2: 1
3: 17
4: 146
1116873560_1116873565 5 Left 1116873560 14:50090402-50090424 CCAACTTTGCTCTCCTTTCCCCT 0: 1
1: 0
2: 10
3: 106
4: 861
Right 1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG 0: 1
1: 0
2: 1
3: 17
4: 146
1116873557_1116873565 14 Left 1116873557 14:50090393-50090415 CCTATTTCCCCAACTTTGCTCTC 0: 1
1: 0
2: 3
3: 33
4: 343
Right 1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG 0: 1
1: 0
2: 1
3: 17
4: 146
1116873561_1116873565 -8 Left 1116873561 14:50090415-50090437 CCTTTCCCCTCGTTTTCCCTTGA 0: 1
1: 0
2: 1
3: 38
4: 412
Right 1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG 0: 1
1: 0
2: 1
3: 17
4: 146
1116873555_1116873565 28 Left 1116873555 14:50090379-50090401 CCCTAGAGATAATTCCTATTTCC 0: 1
1: 0
2: 4
3: 20
4: 245
Right 1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG 0: 1
1: 0
2: 1
3: 17
4: 146
1116873559_1116873565 6 Left 1116873559 14:50090401-50090423 CCCAACTTTGCTCTCCTTTCCCC 0: 1
1: 1
2: 4
3: 54
4: 504
Right 1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG 0: 1
1: 0
2: 1
3: 17
4: 146
1116873558_1116873565 7 Left 1116873558 14:50090400-50090422 CCCCAACTTTGCTCTCCTTTCCC 0: 1
1: 0
2: 6
3: 49
4: 583
Right 1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG 0: 1
1: 0
2: 1
3: 17
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116873565 Original CRISPR TCCCTTGACCTCCCCCAAAC AGG Intronic
900271377 1:1791017-1791039 TCCCTTGGCCTCCCCTCCACAGG + Intronic
901418497 1:9134342-9134364 TCCCCTGACCTCCTCCTAAGAGG + Intergenic
901868136 1:12121233-12121255 TCCAGTGACCTTCCCCAAAGAGG + Intronic
902476611 1:16691892-16691914 TCCCTTGACCTCAGCCAAGGAGG + Intergenic
903179850 1:21599682-21599704 TCCCTTGCCCTCCCCAACCCGGG + Intronic
905379041 1:37546747-37546769 TCCCTTGAACCCCTCCAATCAGG + Intronic
906705045 1:47888576-47888598 TCTCTTGATCACCTCCAAACTGG + Intronic
908991123 1:70090944-70090966 TCTCCTGACCTTCCCCAAAACGG - Intronic
912648551 1:111418153-111418175 TCCCTTAACCATCCCCAACCTGG + Intronic
916051197 1:161038291-161038313 TCTCTTGACCTCCCCAAATCTGG - Intronic
916058482 1:161083734-161083756 GCCCTTGGCCTCCCCCACCCTGG + Intronic
920957714 1:210634259-210634281 TGGCTTGGCCTCCCCCAAGCAGG - Intronic
922853544 1:228755163-228755185 TACCTGGACCTCCCTCAGACAGG - Intergenic
923468530 1:234269530-234269552 TCCCTTTACATTCCCAAAACTGG + Intronic
924917839 1:248592322-248592344 TCCCCTGACTTGCCCCAAGCAGG - Intergenic
1062911642 10:1215865-1215887 CCCCTAGACCTCCCCCACATTGG - Intronic
1063144059 10:3280477-3280499 TCCCATGGCCTCCCCCAATGTGG + Intergenic
1065043851 10:21727063-21727085 TCCATTCCCTTCCCCCAAACAGG - Intronic
1065123437 10:22550322-22550344 TCCCCTGGCCCCTCCCAAACTGG + Intronic
1068043173 10:51853004-51853026 TCCATTAAACTCCCTCAAACTGG + Intronic
1072162759 10:92783855-92783877 TCCCTTGACCTCTGCCACCCTGG + Intergenic
1072609820 10:97010761-97010783 TCTCATGCCCTCCACCAAACAGG + Intronic
1075026793 10:118991069-118991091 TCCTGTGACATCCACCAAACTGG - Intergenic
1075705198 10:124496462-124496484 TCGCTTGACCTCCGGCTAACGGG + Intronic
1076507063 10:130985116-130985138 TCCACTGACCTCTCCCAGACAGG + Intergenic
1076994826 11:292751-292773 TCCCAGGACCAGCCCCAAACAGG - Intronic
1077120248 11:904106-904128 CCCCTTGACCTCGCCCCAAGCGG + Intronic
1077309578 11:1882423-1882445 TCCCTTGTCCTCCTACAACCAGG + Intronic
1078835277 11:15022282-15022304 TCCCTTCACCTCCCCCTAACAGG - Intronic
1079367019 11:19818150-19818172 CCCCTACCCCTCCCCCAAACTGG - Intronic
1080821014 11:35806580-35806602 TTCCTTGACCTACCACAACCAGG - Exonic
1082839369 11:57676505-57676527 TCTCCTGACCTCCCCCAAAGAGG - Intronic
1083638609 11:64133507-64133529 TCCCTTGATCTCCTCCTAAAAGG + Intronic
1089519063 11:119051765-119051787 TCCCTTTACCTCTCCCAAGTAGG - Intronic
1093989533 12:25574343-25574365 ACCCTTGCCCTCCCCCATCCAGG + Intronic
1094133182 12:27097022-27097044 TGCCTTGACCTCCCAGAAACTGG - Intergenic
1094183004 12:27612233-27612255 TACCTTGACCTCCCAGAAACTGG - Intronic
1104603390 12:130169067-130169089 TCCCTTGGGCTCCCCCACACTGG - Intergenic
1112370443 13:98788564-98788586 TCCCTGGACCCCCCGCAGACTGG + Intergenic
1113419355 13:110158399-110158421 ACCCTGGTCTTCCCCCAAACAGG + Intronic
1114222439 14:20708933-20708955 TCCCTTGTTTTCCCCCAAGCAGG - Intergenic
1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG + Intronic
1118048913 14:62004915-62004937 TCCCTTGACATCACCTAAATGGG + Intronic
1119722265 14:76899219-76899241 TCCCTTTACCTGCCACAATCTGG - Intergenic
1121089524 14:91171483-91171505 TCCATTGGCCACCCCCAGACGGG + Intronic
1121386542 14:93532216-93532238 TGCCTTGACCTCCCTCCAAAAGG - Intronic
1121931211 14:97973997-97974019 TTGCTTTTCCTCCCCCAAACAGG - Intronic
1122155607 14:99748336-99748358 TCCCTTTTCCTCCCAGAAACCGG - Intronic
1124066909 15:26353430-26353452 GCCCCTGACCTCTCCCAAGCGGG - Intergenic
1126533550 15:49735398-49735420 TCCGTAGGCCTCCCTCAAACAGG - Intergenic
1126893658 15:53234798-53234820 TCCCTTTACCTGCACAAAACAGG - Intergenic
1126959161 15:53970672-53970694 TCCCTCTGCATCCCCCAAACAGG - Intergenic
1127375093 15:58376900-58376922 TTTCCTGACCTCCCCAAAACTGG - Intronic
1127683271 15:61317667-61317689 TCCCTTGGCCTCTCCCAAAGAGG + Intergenic
1127875671 15:63109260-63109282 TCCCTTGAGGACCCCCAATCTGG + Intergenic
1128115368 15:65101970-65101992 TCCCTTGACCTGCTCCCACCTGG - Intronic
1130148938 15:81296707-81296729 TCCCTTGACTTCCAGCAACCTGG - Intronic
1130402142 15:83567311-83567333 TCCCTTGCCCTGCACCACACTGG + Intronic
1130709750 15:86268192-86268214 ACCCTTCACCTCCCCCAAAGAGG - Intronic
1132400535 15:101502186-101502208 TCCCTTGAGCTCCCCCTGGCAGG - Intronic
1134300507 16:12986508-12986530 TCCCTTTACCACCACCACACAGG - Intronic
1135413306 16:22250909-22250931 TCCCTTGACCTCCCAACACCAGG - Intronic
1135645967 16:24162390-24162412 TCCCCTGCCCCCCACCAAACTGG + Intronic
1136032066 16:27510611-27510633 TCCCTTGACGTCCCTCAGAATGG - Intronic
1138791269 16:59906806-59906828 TTCCTTGACCTCCCAAAAGCTGG + Intergenic
1139309896 16:66019494-66019516 TCCCTTTAGTTCCCCCACACAGG + Intergenic
1142910268 17:3083275-3083297 TCCCTTGCCCTCCCTCAACATGG - Intergenic
1143316491 17:6037100-6037122 TCCTGTCACCTCCCCCAAATGGG + Intronic
1143649241 17:8253167-8253189 TCCCCTGACCTTCACCACACGGG + Intronic
1144327531 17:14196351-14196373 TCTCTTAACTTACCCCAAACTGG + Intronic
1144696180 17:17305346-17305368 TCCCTGGGCCTACCCCAAGCTGG + Intronic
1145212970 17:21028829-21028851 TCCTTTCAGTTCCCCCAAACAGG + Intronic
1145979111 17:29001393-29001415 TCCCTTGGCTTCCCCCATCCAGG - Intronic
1146481449 17:33208114-33208136 TCCCTTTACCTCCCCCAGTCAGG - Intronic
1146728939 17:35177473-35177495 ACCCTTGACCCCTCCCCAACAGG + Exonic
1148795387 17:50194447-50194469 TCCTGTGACTTCCCCCAACCAGG - Exonic
1151674796 17:75591894-75591916 TCCCTGGACCTGCCCCTAGCTGG + Intergenic
1159709582 18:71739748-71739770 TCCCTTGGCCTCCCAAAATCTGG + Intronic
1160853308 19:1205313-1205335 ACCCTTGACCTCGCCCCAAAGGG + Intronic
1161221552 19:3120339-3120361 TCCCTTGGCCTCCCCCCACCAGG - Intronic
1161456348 19:4371581-4371603 TCCCTTGCCCTCCCCCACGCTGG - Intronic
1161809876 19:6465441-6465463 CCCCTTCACCTCCCCCTAGCAGG - Intronic
1163432579 19:17277018-17277040 TGCCATGACCTACCCCAACCAGG - Intronic
1163534888 19:17871501-17871523 TGGCTTTACCACCCCCAAACTGG - Intergenic
1202710632 1_KI270714v1_random:17733-17755 TCCCTTGACCTCAGCCAAGGAGG + Intergenic
926537386 2:14129677-14129699 TTCCTTGCCCTTCCCCATACAGG - Intergenic
926735119 2:16067987-16068009 TCCCTCTACCTCCCCCACCCTGG - Intergenic
929857709 2:45650700-45650722 TCCCTTGCCCACCCCCACTCGGG - Intergenic
930838843 2:55824665-55824687 ACCCATGACCTCTCCCAACCGGG + Intergenic
930994550 2:57700494-57700516 CACCTTGGCCTCCCCAAAACTGG - Intergenic
931774604 2:65529828-65529850 TCCCTTGAAATCCCTAAAACTGG - Intergenic
932268723 2:70390434-70390456 GCCCTTGACCTCCCCTATCCTGG + Intergenic
932414702 2:71566605-71566627 TCCCCTGTCCTCCCCGAGACGGG - Intronic
932467712 2:71934182-71934204 TCCCTGTCCCTCCCCCAAGCTGG - Intergenic
933280236 2:80324787-80324809 TCCTTTGATCTCCCCCATGCGGG + Intronic
933730485 2:85452485-85452507 TCCCTTGACCCCTGCCACACTGG + Intergenic
937025188 2:118691824-118691846 TACCTTCACCTCCCTCCAACTGG - Intergenic
942874547 2:180778662-180778684 TGCCTTTTCCTCCTCCAAACCGG - Intergenic
948660063 2:239501558-239501580 TTCCTTGCCCGCCTCCAAACCGG - Intergenic
1171055684 20:21904093-21904115 CCCCTTCCCCTCCCCCAAAAAGG - Intergenic
1172446309 20:34995291-34995313 TACCTGGCCCTCCCCCAACCTGG + Intronic
1174543302 20:51306572-51306594 TCCCTTGGCCTCCCCACAGCTGG - Intergenic
1175310903 20:58011045-58011067 TCCCTTGACCTTCTCCCAACAGG + Intergenic
1177045019 21:16158356-16158378 TCCATTCACTTCCCCCAAAAGGG + Intergenic
1178107467 21:29336273-29336295 TCCCTTTACTTCCCGTAAACTGG + Intronic
1181801154 22:25348703-25348725 TCCCTTTACCTCCCTGTAACTGG - Intergenic
1182748947 22:32626603-32626625 TCTGTTGACCTGCCCCAACCGGG + Intronic
952085549 3:29816071-29816093 TCCCTATACATCCACCAAACTGG - Intronic
952731319 3:36639468-36639490 TCCCTTGGCCTCCCCAAAATGGG + Intergenic
952764318 3:36942046-36942068 TCACTTTACCTTCCCCAAACAGG + Intronic
954410135 3:50366917-50366939 TCCCTTGCTCTCCCCCAAAGTGG - Exonic
955330969 3:58046791-58046813 TCCCTTTCCCTTCCCCAACCAGG + Intronic
956538653 3:70308559-70308581 GCCCTTGACTTTCCCCAAATGGG - Intergenic
959630197 3:108499039-108499061 TACTTTGACCTGCCCCAATCTGG + Intronic
966681278 3:182644404-182644426 TCCCTATCCATCCCCCAAACAGG - Intergenic
967783535 3:193465647-193465669 TGCCATGACCTCACCAAAACTGG + Intronic
969588103 4:8106277-8106299 TCCCCTGACCCTCCCCAATCTGG + Intronic
980064185 4:128165646-128165668 TCCCTATACCTGCTCCAAACAGG + Intronic
980990403 4:139734633-139734655 CACCCTTACCTCCCCCAAACAGG + Intronic
981270706 4:142845516-142845538 TCTCTTGTCCTTCCCCAAAGAGG - Intronic
983118564 4:163851116-163851138 TCCCATTATCTTCCCCAAACAGG + Intronic
984727308 4:183034210-183034232 CCCCTTCCCCTACCCCAAACAGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
989400620 5:41004224-41004246 TTCCTTGGCCTGCCCCAGACAGG - Intronic
990821157 5:59841788-59841810 GTCCTTTACCTCCCCCAATCTGG - Intronic
1001058135 5:168465938-168465960 TCCCTTGCCTTCCTCCACACTGG - Intronic
1001206672 5:169769714-169769736 GCCCTTGACCTCTCTCAAATGGG + Intronic
1001389838 5:171369920-171369942 TCCCTAGACCTCACACAGACAGG + Intergenic
1002807263 6:589480-589502 TCCCTGGACTTCCCCTCAACCGG + Intronic
1003847030 6:10184107-10184129 TCTCTTTACCTCTCCCACACTGG + Intronic
1004319651 6:14622362-14622384 TCCCTTGCCATCCCCCACAGTGG - Intergenic
1007480379 6:42145777-42145799 TGCCGTGACCTCCCACACACTGG - Intergenic
1010260631 6:73811877-73811899 TCCCCTGACCTCCCTTAATCAGG - Intronic
1015213326 6:130721867-130721889 TCCCTTGTCCTTCCCCACCCTGG + Intergenic
1015886518 6:137923675-137923697 TTCCCTGACCTCCCCGAAACAGG - Intergenic
1019972728 7:4554603-4554625 TCCCCTCACCACCCCCCAACAGG + Intergenic
1021627753 7:22611224-22611246 TCCCTTGTCATCCACCAAATTGG - Intronic
1024393002 7:48836491-48836513 TGACTTGACCTCACCCAATCTGG + Intergenic
1029184984 7:98731890-98731912 TCCCAAGACCTCCCCCAGGCAGG + Intergenic
1032080761 7:128857344-128857366 TGGGTGGACCTCCCCCAAACTGG - Intronic
1032091492 7:128913816-128913838 TGGGTGGACCTCCCCCAAACCGG + Intergenic
1033113857 7:138607637-138607659 TTCCTTCACCTCCTCCAAGCTGG - Intronic
1034400055 7:150856333-150856355 CCCCTTGCCCTGCCCCAAGCTGG - Intronic
1034430952 7:151040909-151040931 TCCCCTTACCTCCGCCAGACTGG - Exonic
1035569167 8:660699-660721 TCCCTGGCCCTGGCCCAAACTGG + Intronic
1037319775 8:17631652-17631674 TCCCTTGACTTCCACCAAAACGG + Intronic
1038187974 8:25292870-25292892 TCTCTTCATCTCCCCCTAACCGG + Intronic
1039009294 8:33075325-33075347 TCCCATGACCTTTCTCAAACAGG - Intergenic
1044626161 8:94236260-94236282 TCCCTTGACCTCCAACCAATGGG + Intergenic
1046399975 8:113692091-113692113 TCCCTTTTCCTCCCTCAAGCAGG + Intergenic
1047098241 8:121647248-121647270 TCCCTTTGCCTCACGCAAACTGG - Intergenic
1047801133 8:128311527-128311549 TCCCTTGCACTCATCCAAACTGG + Intergenic
1047988538 8:130261756-130261778 TCCCTTGCCCCCCTCCACACAGG - Intronic
1048957330 8:139547863-139547885 TCACTTGTCCTCCCCCTACCTGG + Intergenic
1049783458 8:144439454-144439476 TCCCTGGAACACCCCCCAACAGG + Intronic
1052740773 9:32390897-32390919 TCCCCTCACCTCCCCCCACCAGG + Intronic
1053269833 9:36742463-36742485 TCCCTACCCCTCCCCCAAAGGGG + Intergenic
1053452232 9:38202775-38202797 CCCCGTGACTTCCACCAAACTGG - Intergenic
1060937993 9:127527034-127527056 GCCCCTCCCCTCCCCCAAACTGG - Intronic
1188261275 X:28027107-28027129 GCCCTTCTCCTCCCCCAAACTGG - Intergenic
1189229786 X:39443318-39443340 TTCCTTGCCCTTCCCCCAACAGG - Intergenic
1190740369 X:53284572-53284594 TGCCTTGACCCCACCCAAGCAGG + Intronic
1190777335 X:53563525-53563547 TCCCACCACCTCCCCCACACAGG + Intronic
1198317782 X:135486932-135486954 TGCCTTGACCTTACCCAAAAAGG - Intergenic
1198493528 X:137167268-137167290 TCCCATGACTTCCCACACACTGG - Intergenic