ID: 1116877033

View in Genome Browser
Species Human (GRCh38)
Location 14:50122304-50122326
Sequence CTTGCCAGTTATGATTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116877033 Original CRISPR CTTGCCAGTTATGATTTTGA GGG Intronic
901725693 1:11240302-11240324 CTTGGCAGCTTTGAATTTGAAGG - Exonic
903505959 1:23836015-23836037 CTTTTCAGTTATGATTTTCTGGG - Intronic
903606934 1:24581705-24581727 CTGGCCAGTTCTGATTTGCAAGG - Intronic
905194533 1:36265093-36265115 CTTCCCATATATGATTTGGATGG + Intronic
909840578 1:80316879-80316901 CTTCCCAATTATGCTTTTGGGGG - Intergenic
911347015 1:96709343-96709365 CTTGTCAGCTATGAGTGTGATGG + Intergenic
911421024 1:97640936-97640958 CTTGCCTGCTATGATTTTAATGG + Intronic
912895707 1:113586326-113586348 CATGCCAGGCATGTTTTTGATGG - Intronic
912990963 1:114485863-114485885 TTTGTCAGTTATGATTTTCCTGG - Intronic
914801599 1:150966476-150966498 CTTTCCAGTTATGAACTTGTGGG + Exonic
915069724 1:153256211-153256233 CTTGGCAGTTCAGATTTTTAAGG - Intergenic
917073910 1:171183446-171183468 CTAGGTAGTTATGATATTGATGG - Intergenic
917112260 1:171560573-171560595 CTTGCCAGTGGAGATGTTGATGG - Intronic
917466512 1:175282283-175282305 CTTGGCTGTGATGATTTTTAAGG - Intergenic
918357587 1:183720214-183720236 CTTTCCATTAATGATTTTTAAGG - Intronic
919262476 1:195215031-195215053 ATTCCCAGTTATCTTTTTGATGG - Intergenic
919265924 1:195265821-195265843 CTTGAGAGTTTTGATCTTGAAGG + Intergenic
919430351 1:197484660-197484682 CTTGTCAGCAATGATTTTCATGG - Intergenic
919648943 1:200126161-200126183 CTTCCAAATTATGATTTTAAAGG - Intronic
921720047 1:218461003-218461025 CATTCCAATAATGATTTTGATGG + Intergenic
924719880 1:246612588-246612610 CTGACCTGTTATGATTTTGGGGG - Intronic
1063741757 10:8830239-8830261 CTTGCCAGTAATGTTAATGATGG - Intergenic
1064936552 10:20684928-20684950 CCTGCCAGTTTTGGTTTTGTGGG - Intergenic
1065014230 10:21446953-21446975 TTTGCCAGTTGTTCTTTTGAGGG - Intergenic
1068639647 10:59388920-59388942 CCTGACAGTTATAATTTTAATGG - Intergenic
1069635973 10:69925147-69925169 TTTGCCAAAGATGATTTTGAGGG + Intronic
1071133146 10:82419002-82419024 CATCCCAGTTACAATTTTGAGGG - Intronic
1071265377 10:83960188-83960210 CTTGCCACTTATGGGATTGAAGG + Intergenic
1072557448 10:96531854-96531876 CTTCCCAGTAAGGATATTGATGG + Intronic
1074553150 10:114463880-114463902 CTTTAAAGTTATTATTTTGAAGG - Intronic
1077964962 11:7120090-7120112 TTTGCCAGATATAATTTTAAGGG + Intergenic
1078606043 11:12776429-12776451 TCTGCCAGTAATGTTTTTGATGG + Intronic
1078971252 11:16414137-16414159 ACTGCCAGTTATGATTTTGGAGG - Intronic
1079925948 11:26491222-26491244 CTGAGCAGTTATGATTTTAAGGG + Intronic
1080539922 11:33256325-33256347 CTTGCTAGTGAAGATTATGAAGG + Intergenic
1081220269 11:40451679-40451701 CCGGCCAGAAATGATTTTGAGGG + Intronic
1084720640 11:70903559-70903581 CTTGCCAATGATGAGTGTGATGG - Intronic
1086148319 11:83580308-83580330 ATTGCAAATTATGATTTTTATGG - Intronic
1086265730 11:84995550-84995572 GTTGCTAGTTGTGATTGTGATGG - Intronic
1086915455 11:92524931-92524953 CTTACCTGTTTTGATATTGATGG - Exonic
1092624265 12:10309503-10309525 CTTCACAGTTTTGATTTTTATGG - Intergenic
1094555810 12:31498607-31498629 CTTGGCAAATATGATTTGGAAGG + Intronic
1097340998 12:58438172-58438194 TTTGCCAGTTATTATTATAATGG - Intergenic
1098038312 12:66329109-66329131 TTTGACAGTTCTGATTTTCAAGG + Intronic
1099040125 12:77642386-77642408 CTTTCCTGTTATTATTTTAAAGG + Intergenic
1099292976 12:80794915-80794937 TTTTCCTGCTATGATTTTGAAGG - Exonic
1100481901 12:94987255-94987277 CTTGACAGTTATATTGTTGAAGG - Intronic
1101183545 12:102248553-102248575 CATCCCACTTTTGATTTTGAGGG - Intergenic
1102145259 12:110650502-110650524 CTTGTCAGTGATTATTTTTAAGG - Intronic
1102479669 12:113213134-113213156 CTTGCCAGTTTGGATTTGTAGGG - Intronic
1107381335 13:39859602-39859624 CTTACCATTTTTTATTTTGATGG + Intergenic
1107460669 13:40598789-40598811 CTTGTCAGTTCTGATTTAGTAGG - Intronic
1107796296 13:44055575-44055597 TTTTCCAGAGATGATTTTGAGGG + Intergenic
1108239942 13:48453686-48453708 TTCTCCAGTGATGATTTTGAGGG + Intronic
1111693117 13:91590278-91590300 CTTGCCATTTTTGATTATTACGG + Intronic
1112869887 13:103957392-103957414 CTAGCCAGTAACTATTTTGAAGG - Intergenic
1113275013 13:108718776-108718798 CTTTCCAGTTATGGATGTGATGG - Intronic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1114514463 14:23288940-23288962 TTTGCCAGATATTAGTTTGAAGG - Intronic
1116110531 14:40574889-40574911 CTTACCATTTCTGATTTTGTTGG - Intergenic
1116441005 14:44952713-44952735 GTTGCCATGTATAATTTTGAAGG - Intronic
1116877033 14:50122304-50122326 CTTGCCAGTTATGATTTTGAGGG + Intronic
1117200708 14:53387092-53387114 CTTGTCAGTGATAATTTTAAAGG + Intergenic
1117899606 14:60517813-60517835 CTTGCGATTTAAGATTTTAATGG - Intergenic
1118076799 14:62308359-62308381 CTTGCCGGGTTTGATTTTGAGGG - Intergenic
1118341779 14:64899889-64899911 TCTGCCACTTATGATCTTGAAGG + Intergenic
1118622375 14:67625309-67625331 TTTGTCACTTATGATTTTGATGG - Intronic
1120299690 14:82691137-82691159 CTTGCTAGTTATGATAGAGAGGG - Intergenic
1123913352 15:24993596-24993618 CTTGTGAGGTTTGATTTTGAGGG + Intergenic
1124465973 15:29940151-29940173 CTTTCTAGTTATGACTTTGTAGG - Intronic
1125328609 15:38562218-38562240 ATTACCAGTTATGCTTTTGAAGG - Intronic
1125394882 15:39235982-39236004 CTAGCCAATAATGACTTTGAGGG - Intergenic
1125864849 15:43036693-43036715 TTTGCCACTAAGGATTTTGAGGG - Intronic
1126504128 15:49383631-49383653 TTTGCCAGTTTTCATTTTGTGGG - Intronic
1126871828 15:52997306-52997328 CTTGGCAGGTATAGTTTTGATGG + Intergenic
1130809372 15:87360349-87360371 CTTGACAAATATGATTTTGGTGG - Intergenic
1131028425 15:89165226-89165248 CTTTCCAGTACTGATTTTAAGGG - Intronic
1131597228 15:93810751-93810773 CGTACCAGTTAGGATTTTGGAGG - Intergenic
1133523433 16:6580936-6580958 CTTTGCAATTATGATTTTGGGGG - Intronic
1135485767 16:22863364-22863386 CTGGCCAGGTAGGTTTTTGAGGG - Intronic
1144335896 17:14268623-14268645 CTTCTCAGTTATGATATTTATGG + Intergenic
1148916322 17:50982335-50982357 CTTGCCAGTTTTGACTGTGAGGG - Intronic
1149483122 17:57019343-57019365 CTGTCCAGTTATAATTTTGGGGG - Intergenic
1149915203 17:60601677-60601699 CTTGCCTTTTCTTATTTTGATGG - Intronic
1155396897 18:25395767-25395789 TTTGCCAGTTATGAGTTTATTGG + Intergenic
1155809348 18:30211966-30211988 CTTGGAAGTTATGAGTTTGCAGG - Intergenic
1157627080 18:49060154-49060176 ATTGCCAGTTCTGATTTGTATGG + Intronic
1158069684 18:53456214-53456236 TTTGCAAGTTAGGATTTTGAAGG + Intronic
1159306129 18:66644946-66644968 TTTGCCAATTAGGATTTTTAAGG - Intergenic
1162297864 19:9825864-9825886 TTTTCCAAATATGATTTTGAGGG - Intronic
1166537821 19:43586113-43586135 CATGCCTGTTCTGCTTTTGATGG + Exonic
924990002 2:306076-306098 CTTGCCTGTCATGAATATGAAGG - Intergenic
925485795 2:4329143-4329165 TTTGACAGTAATGAGTTTGAAGG + Intergenic
927016455 2:18967764-18967786 CTTGACAGTTATTATCATGAAGG + Intergenic
928995125 2:37281416-37281438 CTTGGGAGTTAAGATTTTTAAGG - Intronic
929774813 2:44922719-44922741 CTTGCCATTTATCATTTTCAGGG + Intergenic
930458367 2:51636005-51636027 CTTTACAATTCTGATTTTGAGGG + Intergenic
930614343 2:53578177-53578199 CTTCCCAGTGATCATCTTGAGGG + Intronic
933862617 2:86485022-86485044 CCTTCCAGGTATGATTATGAAGG + Exonic
935438046 2:103058001-103058023 ATTGCTGGTTTTGATTTTGAAGG - Intergenic
939427445 2:142057641-142057663 CTTGCCAAGTATTATTTTTATGG - Intronic
940634799 2:156285851-156285873 CTTGTGATTTATGATTTTTATGG - Intergenic
943795068 2:191982033-191982055 CTTACAATTTATCATTTTGATGG + Intronic
943882864 2:193170333-193170355 CCTGCCTGTTATGTTTCTGAAGG - Intergenic
944051762 2:195477991-195478013 TTTGCAAGCTATGAATTTGAAGG - Intergenic
945889715 2:215416650-215416672 CTTGTCAATCATGATTTTGAGGG + Intronic
1169567016 20:6865958-6865980 CTTGTCACATAGGATTTTGAAGG - Intergenic
1169854348 20:10087108-10087130 TTTGGCCCTTATGATTTTGAAGG - Intergenic
1171061461 20:21966887-21966909 CTTGCAATTTATGAGTTTAATGG + Intergenic
1171127761 20:22619131-22619153 CTTTCCAGTTTTCATTTTTAAGG + Intergenic
1173130109 20:40384377-40384399 CCTGCTAGTTATGATTCTCAAGG + Intergenic
1173260297 20:41428934-41428956 CTTGTGAGTTAGGAGTTTGAGGG - Intronic
1183274440 22:36884170-36884192 CTTTTCACTTCTGATTTTGACGG - Intergenic
1183625724 22:39000243-39000265 TTTGCCAGTTCTGTTGTTGATGG + Intergenic
951399996 3:22220438-22220460 ATTGCCAGTTGAGATTTGGATGG - Intronic
951788859 3:26457205-26457227 TTTGCCAAGTATGATTTTAAAGG + Intergenic
952134241 3:30399163-30399185 CCTGTCAGTAATAATTTTGAGGG - Intergenic
957845178 3:85722324-85722346 CCTGACATCTATGATTTTGATGG - Intronic
961507505 3:127380066-127380088 CTTGCCAATTATATTTTTTATGG - Intergenic
963398144 3:144758850-144758872 CTTGCCAGTCAAAATTTAGAAGG - Intergenic
965497128 3:169412487-169412509 TTTGTCTGGTATGATTTTGATGG - Intronic
965632892 3:170751575-170751597 CTTGCCAGTTTTGCACTTGATGG - Intronic
966035726 3:175412490-175412512 CTTGCCTGTTATTATTAGGATGG + Intronic
970044934 4:11841460-11841482 TTTGCAAGGTGTGATTTTGATGG + Intergenic
972578680 4:40375651-40375673 TTTTCCAGAGATGATTTTGAGGG - Intergenic
974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG + Exonic
975117744 4:70697903-70697925 CTTGCCAGTTATTATTGCAAAGG - Intergenic
975994267 4:80296242-80296264 CTTGTTAGTTATCATTTGGATGG + Intronic
978892168 4:113843103-113843125 TTTGTCTCTTATGATTTTGAAGG + Intergenic
979444583 4:120796177-120796199 CTAGCCATTAATGATTGTGATGG + Intronic
979634097 4:122937705-122937727 CTTGCAAGTTTTTATTTTAATGG + Intronic
981598711 4:146458748-146458770 CTAACCACTTTTGATTTTGAGGG + Intronic
985937673 5:3109277-3109299 TTTGCTACTAATGATTTTGAGGG + Intergenic
986529484 5:8721005-8721027 TGTGACAGTTATGATTTTAAAGG + Intergenic
988788733 5:34587884-34587906 CTGGCCAGTTCTTCTTTTGAAGG + Intergenic
991723141 5:69512584-69512606 AATGCCAGCTAGGATTTTGAAGG + Intronic
997572758 5:134944630-134944652 TTTGCCATAAATGATTTTGAGGG + Intronic
998303517 5:141050728-141050750 CTTGTCACTTATGATTATAATGG - Intergenic
1002332339 5:178452863-178452885 ATTAGCAGTTCTGATTTTGACGG - Intronic
1003515890 6:6818556-6818578 CTTGCCGCTCATGATTTGGAGGG - Intergenic
1004161326 6:13215978-13216000 CTTATCAGTTATAATTTTAAAGG - Intronic
1005326250 6:24703516-24703538 CATGCAAATTATGATTTGGAGGG + Exonic
1005523789 6:26625724-26625746 CTTACCAGTTATGTCTTTCATGG + Intergenic
1008045361 6:46846495-46846517 CATGCCAGATATGATTTTGTAGG + Intergenic
1008857646 6:56111255-56111277 CTTGTCTGTCATGACTTTGATGG - Intronic
1010130270 6:72484007-72484029 CTGGCATGTTATGATTTTGTGGG + Intergenic
1011181206 6:84622952-84622974 CTTCCCTGTCATGATTTTGTAGG - Intergenic
1011430034 6:87275491-87275513 CTTGACACTTAAGATTTGGATGG + Intergenic
1014299023 6:119657230-119657252 TTTGTGAGTTATGATTTTGTTGG - Intergenic
1015445686 6:133301812-133301834 TTTGCCAGTTTGCATTTTGAAGG + Intronic
1020674739 7:11168367-11168389 CTTGCCAGTAATGATTAAGGCGG - Intronic
1022133010 7:27421411-27421433 GTTGCCAGTGATGAATTTCAGGG - Intergenic
1023819219 7:43971084-43971106 TCTGCCAGACATGATTTTGAGGG - Intergenic
1024475124 7:49801382-49801404 CTTCCCAGTTTTGCTTCTGATGG + Intronic
1028049184 7:86160808-86160830 CTTCCCAGTTTAGATTTGGAGGG - Intergenic
1029744272 7:102508047-102508069 CTGCCCAGACATGATTTTGAGGG - Intronic
1029762263 7:102607209-102607231 CTGCCCAGACATGATTTTGAGGG - Intronic
1030103466 7:105966875-105966897 CTTGCCAGTTATGACCTAGCTGG + Intronic
1030629771 7:111883236-111883258 CTTGCCAGGGATGAGATTGAGGG - Intronic
1033756189 7:144399624-144399646 GTTGCCAGCTAAGATTTAGAGGG - Intronic
1037291577 8:17355480-17355502 TTTACCAGTTATGATTATTATGG - Intronic
1043652196 8:82610359-82610381 CTTGAGAGTTTTTATTTTGAAGG + Intergenic
1044639071 8:94359652-94359674 ATTGCCCGTTATGTTTTTTAAGG + Intergenic
1047070333 8:121336016-121336038 GTTGCCAGTTTAGATTTTAAAGG - Intergenic
1047162679 8:122398260-122398282 TTTGCCAATTGGGATTTTGAAGG - Intergenic
1047605090 8:126466700-126466722 CTGGCCAATTATGAATTTGGGGG - Intergenic
1050172076 9:2830700-2830722 CTTGAAATTTATGACTTTGATGG - Intronic
1050172157 9:2832132-2832154 CTTGAAATTTATGACTTTGATGG - Intronic
1051395103 9:16611683-16611705 CTTACAAGTTATTATTTTCATGG - Intronic
1051521369 9:17992424-17992446 TTCGCCAGTGATGGTTTTGAAGG + Intergenic
1051926787 9:22337463-22337485 CTTGCCAAGTATGAGCTTGATGG + Intergenic
1052417178 9:28191005-28191027 GGTGCCAGTTAGCATTTTGAAGG + Intronic
1052463968 9:28805967-28805989 ATTGTCAGTTATAATTTTCAAGG - Intergenic
1053652207 9:40180238-40180260 CATGCCAGATATGATTTTGTAGG - Intergenic
1053902599 9:42809552-42809574 CATGCCAGATATGATTTTGTAGG - Intergenic
1054532376 9:66195967-66195989 CAAGCCAGATATGATTTTGTAGG + Intergenic
1056946075 9:90998359-90998381 CTAGCCAGTTATGAAATTGCTGG - Intergenic
1058137730 9:101326113-101326135 CTTTCTAGTTCTGATTTTAAAGG + Intergenic
1059957972 9:119537876-119537898 CTAGGCAGTTATGGATTTGAAGG - Intergenic
1186553537 X:10532576-10532598 CTTGCCAGTTAAGAATTACATGG + Intronic
1186680854 X:11872046-11872068 TTTGCCAGCTATGAGTTTTATGG + Intergenic
1187687374 X:21829050-21829072 GTTGTCAGTTATGATTTGGATGG - Intergenic
1189522596 X:41785326-41785348 TTTGCCAGAAAAGATTTTGAAGG + Intronic
1194202001 X:90963657-90963679 ATAGCCAGTAATGAGTTTGATGG - Intergenic
1197136114 X:123061370-123061392 CTTGCCTTTTATGATTTTTCAGG + Intergenic
1200547838 Y:4539108-4539130 ATAGCCAGTAATGAGTTTGATGG - Intergenic