ID: 1116888889

View in Genome Browser
Species Human (GRCh38)
Location 14:50248387-50248409
Sequence CTGCCCTCTAAGACTTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116888889 Original CRISPR CTGCCCTCTAAGACTTCAGC TGG Intronic
900653260 1:3741771-3741793 CTTCCCTGTAAGACCTCAGTTGG - Intergenic
900807244 1:4775587-4775609 CTCCCCTCTCTGACTGCAGCTGG - Intronic
901473885 1:9475811-9475833 CTCCCCTCTTAAACTTCAGAGGG - Intergenic
903005991 1:20299244-20299266 CTTCCCTCTTAACCTTCAGCTGG + Intronic
903260093 1:22126974-22126996 CTTCCCTCTCAGACCTCAGGAGG + Intronic
906177067 1:43783743-43783765 CTGCCCTCTAAGACTGCGGGGGG - Intronic
907047016 1:51305582-51305604 GTCCCCTCTAAGTCATCAGCTGG + Intronic
907518310 1:55007269-55007291 CTGCCCTCTAAGCACTCACCCGG - Exonic
907832440 1:58077825-58077847 CTGCCCTCTGAGACTTGAGGTGG - Intronic
909052061 1:70777986-70778008 CTGCTCTTTAAGAATTCAACAGG + Intergenic
909116397 1:71542493-71542515 ATGCCCTCTAAAATTTCATCAGG - Intronic
909931829 1:81505513-81505535 CTGCCCTCAAGGACAACAGCAGG + Intronic
913712456 1:121499294-121499316 CTGCCCACCAATACTTCACCAGG - Intergenic
917442995 1:175083343-175083365 CTGCCCTCTAAGACGACCTCAGG - Intronic
917728329 1:177848939-177848961 CTGCCCACCAGGACCTCAGCAGG + Intergenic
917841036 1:178978091-178978113 CTGGCCTCTAAGATTTCCACTGG - Intergenic
920856279 1:209665082-209665104 CTGAGCTCTGAGACTTCACCAGG + Intergenic
921890070 1:220344806-220344828 CAGCCATCTCAGGCTTCAGCTGG + Intergenic
924118537 1:240772179-240772201 TAGCCCTCTAAAACGTCAGCAGG - Intergenic
1066282832 10:33934495-33934517 ATGCCCTCTAAGGATTCAGAAGG + Intergenic
1069408187 10:68124619-68124641 CTGCCCTCAAGGAGGTCAGCAGG - Intronic
1070503346 10:77091637-77091659 CTGCGCTCTGAGACTTGGGCAGG + Intronic
1072096288 10:92184255-92184277 TTGACCTCTTTGACTTCAGCAGG + Intronic
1076454505 10:130580431-130580453 CTGCCCTCAGAGACTTGCGCAGG - Intergenic
1076495929 10:130897959-130897981 CTGCCCACTAGGACCCCAGCTGG - Intergenic
1076789920 10:132771508-132771530 CTCCCCTCTCAGACTGCCGCAGG + Intronic
1078424931 11:11241820-11241842 CTCCCCTCTAAGCCTCCAGAAGG + Intergenic
1078521340 11:12066345-12066367 CTCACCTCTAAGCATTCAGCAGG - Intergenic
1079943154 11:26707420-26707442 CTCTCCTCTGAGACTTCAACTGG + Intronic
1084046417 11:66570776-66570798 CTCTCCTCTCAGACCTCAGCTGG - Intergenic
1084800918 11:71543327-71543349 CTGACCTCTAGCACTTGAGCCGG + Intronic
1085310495 11:75513864-75513886 GTGCCCTCTAGGTCCTCAGCAGG - Intronic
1086594159 11:88551286-88551308 CTGCCTATTTAGACTTCAGCTGG + Intronic
1087077099 11:94135206-94135228 CTGCCCACTAAGAGGTCAGTGGG - Intronic
1087849320 11:103010170-103010192 TTTCCATCTGAGACTTCAGCAGG + Intergenic
1091538647 12:1438498-1438520 CTGCCTCTGAAGACTTCAGCAGG + Intronic
1092313541 12:7384602-7384624 CTGGCCTGTAAGATTTCTGCTGG - Intronic
1095518059 12:43029046-43029068 CTACCCTCTTAGACTCCTGCAGG - Intergenic
1096846305 12:54408944-54408966 CTCCCCTCACAGATTTCAGCTGG - Exonic
1101829511 12:108246444-108246466 CTGCCCTCTGATTCTCCAGCTGG + Intronic
1101830011 12:108249660-108249682 CTGCACTCCAAGGCTTCAGAGGG - Exonic
1112563525 13:100533668-100533690 CTGCCCTCTAAGACCTTGGAAGG - Exonic
1113672691 13:112185651-112185673 CTGCCAGCTAGGACTGCAGCTGG - Intergenic
1113979173 13:114258350-114258372 TTGCCTTCTTAGACTCCAGCTGG - Intronic
1116888889 14:50248387-50248409 CTGCCCTCTAAGACTTCAGCTGG + Intronic
1117394200 14:55292725-55292747 CTGCTATCTAAGACTTCATCAGG - Intronic
1119480611 14:74955589-74955611 CTCCCTTCTGAGACTGCAGCCGG + Exonic
1120687862 14:87559329-87559351 CTCACCTCTAAGATTTCAGCTGG - Intergenic
1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG + Intronic
1120905748 14:89619428-89619450 CTGCCTTCTAAGAGTTCAGTTGG - Intergenic
1122075715 14:99233378-99233400 CTTCCCTCTAGGGCTGCAGCTGG + Intronic
1122286672 14:100656421-100656443 CTGTCCTCCAAGACTCCAGCTGG - Intergenic
1123711191 15:22988990-22989012 CTGTCCTCAAAGCCCTCAGCTGG + Intronic
1123918584 15:25054985-25055007 CTGCCCTCTGACACCTCTGCTGG - Intergenic
1124846231 15:33293808-33293830 CTGCCTTCTATTCCTTCAGCAGG + Intergenic
1125197270 15:37061345-37061367 CTGCCCTTAAACACTTCTGCCGG - Intronic
1125714603 15:41812311-41812333 ATGCCTTCAAAGACTTCTGCAGG + Intronic
1128460007 15:67859857-67859879 CTGTCCTTTAAGACTCAAGCAGG - Intergenic
1129086283 15:73096046-73096068 GTGCCCCCAAAGAATTCAGCAGG + Intronic
1129295490 15:74597818-74597840 CTGCCCTCAAGGACAACAGCAGG + Exonic
1130909298 15:88260122-88260144 CTCCTTTCTAAGACTCCAGCTGG - Intergenic
1130960812 15:88657574-88657596 CTGCCCTCGAAGCTTTCAGGAGG - Intergenic
1133344361 16:5060118-5060140 CTGCCCTCTCCTACTCCAGCAGG - Intronic
1134757681 16:16682924-16682946 TTTCCCTTTAACACTTCAGCTGG - Intergenic
1134988388 16:18676242-18676264 TTTCCCTTTAACACTTCAGCTGG + Intergenic
1137584090 16:49653637-49653659 CTTCCCTCTAAGCCATCAGATGG - Intronic
1137893009 16:52181918-52181940 CTCCCCTCAAAGCCTCCAGCAGG - Intergenic
1141002098 16:80317791-80317813 CTGCCTTACAAGACTGCAGCAGG + Intergenic
1141842654 16:86584060-86584082 CTGCCCCCTCAGCCTGCAGCAGG + Intergenic
1144672176 17:17139030-17139052 TTGCCCTCTAAGACTTTGACTGG + Intronic
1144997325 17:19279205-19279227 CTGCCCTCCCAGACATAAGCTGG - Intronic
1147311653 17:39599271-39599293 CTGCCCTCCAAGACTGAGGCTGG + Intergenic
1151177408 17:72300206-72300228 CTTCCCTCCAAGCCTTCAGAAGG - Intergenic
1155064177 18:22254556-22254578 CTGCCCCATAAGACTCCAGGGGG - Intergenic
1156675375 18:39521739-39521761 CTCCCCTAAAAGACTTCTGCAGG - Intergenic
1157391610 18:47307948-47307970 GTGGCCTCTAAGACTTAAGGTGG - Intergenic
1158680467 18:59561980-59562002 CTCTCCCCTCAGACTTCAGCAGG + Intronic
1162795760 19:13086839-13086861 CTGTCCTCACAGATTTCAGCTGG - Intronic
1165100884 19:33438141-33438163 CTGCCCTCTGAGATCCCAGCTGG - Intronic
1168381873 19:55931003-55931025 CAGCCCTGTAACACCTCAGCAGG + Intronic
927841743 2:26449433-26449455 CTGCCCTCTGAACCTGCAGCTGG + Intronic
929567723 2:43000087-43000109 CTGCCCTCTAACACTGTACCAGG + Intergenic
930940629 2:57009954-57009976 TTGCCTTCTTGGACTTCAGCTGG + Intergenic
932285450 2:70528094-70528116 CTGCCCTCTCTGTTTTCAGCAGG - Intronic
932686051 2:73871180-73871202 ATGGCCTTTGAGACTTCAGCTGG + Intronic
934766787 2:96884272-96884294 CTGGGCTCTCAGCCTTCAGCAGG + Intronic
937292953 2:120793124-120793146 CTGCCCTCTGGGGCCTCAGCAGG - Intronic
939685584 2:145195078-145195100 CAGACCTCAGAGACTTCAGCAGG + Intergenic
946864434 2:224030248-224030270 CTGCCCACTGAGAGTGCAGCAGG + Intronic
948366563 2:237458843-237458865 CAGTCCCCTAAGACCTCAGCTGG + Intergenic
1168999446 20:2156865-2156887 TTGCCTTGTATGACTTCAGCTGG - Intronic
1169903398 20:10575470-10575492 CTGCCTTCTAAGACTTCACCTGG - Intronic
1170904375 20:20499539-20499561 CTGCCCTCCAAGAATTCACCAGG - Intronic
1175278775 20:57788763-57788785 CTGCCCTCTGTGACTTCACTCGG + Intergenic
1177774668 21:25554802-25554824 CTCGCCTCCAAGACTTCAGGTGG - Intergenic
1178937025 21:36872119-36872141 ATACCCTTTAATACTTCAGCTGG + Intronic
1179029914 21:37711687-37711709 CTGCTCTCTTACGCTTCAGCAGG - Intronic
1182431633 22:30302318-30302340 CTGCCCTCACAGAGTTCAGCAGG - Intronic
1183403161 22:37616748-37616770 CAGCCCTCTAAGGTTTCTGCAGG - Intronic
953497939 3:43404434-43404456 CTGCAATCTAAGATGTCAGCTGG - Intronic
955568570 3:60277092-60277114 CTGACCACCAGGACTTCAGCAGG - Intronic
955658960 3:61276381-61276403 CTACCATCTTTGACTTCAGCTGG + Intergenic
956632281 3:71328469-71328491 CTGCCCTCACTGACTCCAGCAGG - Intronic
958695342 3:97520544-97520566 CTGGCCTGTAAGGCTTCTGCTGG + Intronic
963077001 3:141356132-141356154 CTGCCCTTTGAGATTTCATCAGG - Intronic
963503115 3:146153185-146153207 CAGCGCTCTAAGACTTCCCCAGG + Intronic
971089067 4:23318626-23318648 CTGTCATCTAGGACTTCAGCTGG - Intergenic
971683995 4:29741062-29741084 CTGCACTCTTTGACTTTAGCTGG - Intergenic
972011255 4:34185155-34185177 CTGTCCCCTAAGCCTTCAACAGG + Intergenic
973581888 4:52352256-52352278 ATGTCCTCCAAGATTTCAGCTGG + Intergenic
979205954 4:118038251-118038273 CTGCCCTATATGACTTAAGGGGG - Intronic
982127851 4:152199862-152199884 CTGTCCTCTAACACTCCAACAGG - Intergenic
983566730 4:169160996-169161018 CTGCCCTCCAAGCCTTCTGCAGG + Intronic
985039323 4:185873134-185873156 CTGCTCTGTAAGTCTTCATCTGG - Intronic
985183304 4:187289143-187289165 CTGGCCTGGAAGACTTCAACAGG - Intergenic
987493525 5:18613484-18613506 CTTCCCTCACAGCCTTCAGCAGG - Intergenic
990349879 5:54905275-54905297 TTGCCCTCCCAGACTTCAGATGG + Intergenic
991494066 5:67210624-67210646 CTGCCTTCTCAGGCTTCAGCAGG + Intergenic
991928718 5:71730626-71730648 CTGCCTGCTAAGGCTTAAGCAGG - Intergenic
992610321 5:78502750-78502772 CTGCACCCAAAGACCTCAGCAGG - Intronic
993304638 5:86260859-86260881 ATGCTCTTTAATACTTCAGCTGG - Intergenic
994737338 5:103571616-103571638 CTGCCCTGCAAGTCTACAGCGGG - Intergenic
995600970 5:113795564-113795586 CTGACCTCCAAGAATCCAGCTGG - Intergenic
997857349 5:137384060-137384082 CTGCCCTCTGAGTCCCCAGCTGG + Intronic
998201873 5:140131204-140131226 CTGCCTTCTAGAACTTCAGGAGG + Intergenic
998679574 5:144452038-144452060 CTCCCATCTAAGCCTTTAGCTGG + Intronic
999094964 5:148969558-148969580 CTGCCCTGAAGGACATCAGCTGG + Intronic
1001038723 5:168316576-168316598 CTGCCCTCTACGTCTGCAGTAGG + Intronic
1004640292 6:17508605-17508627 CTGCCATCTAAGAGCTCAGAGGG - Intronic
1008697406 6:54055844-54055866 CTGCCCTCAAGGAGTTTAGCAGG - Intronic
1009044137 6:58217010-58217032 CTGCCATATAAGACTCCTGCTGG - Intergenic
1009219959 6:60971278-60971300 CTGCCATATAAGACTCCTGCTGG - Intergenic
1010332368 6:74638636-74638658 CTGCCCTTTGAAACTTCATCTGG + Intergenic
1015550839 6:134410855-134410877 GTGCCCTCTGAGACCTCATCAGG + Intergenic
1019622968 7:2001567-2001589 CTGCCCTCTGTGAATGCAGCAGG - Intronic
1020912943 7:14156033-14156055 CTGCCATTTAAGAGTGCAGCAGG + Intronic
1021769320 7:23983112-23983134 GTGCACTCTCAGACTCCAGCAGG + Intergenic
1022043969 7:26608554-26608576 CTGCTCTCAAAGACTTCCACAGG + Intergenic
1024063602 7:45716018-45716040 CTGCCCTCAAAGTCTCCAGTGGG - Exonic
1027340798 7:77206009-77206031 TTGCCTTCTTTGACTTCAGCTGG + Intronic
1027953567 7:84851247-84851269 CTGACCTCTGAAATTTCAGCTGG - Intergenic
1031133112 7:117856055-117856077 CCTCCCTCTTGGACTTCAGCAGG + Intronic
1033641595 7:143267360-143267382 CTGCTCTCTAAGATGTCCGCTGG + Intronic
1034052372 7:147997021-147997043 CTGCCATGAGAGACTTCAGCTGG + Intronic
1034265921 7:149780632-149780654 CTGACCTCTACCCCTTCAGCAGG + Intergenic
1035135946 7:156703368-156703390 CTGTCTCCTAAGACCTCAGCAGG + Intronic
1038403898 8:27307663-27307685 CTCTCATCTCAGACTTCAGCGGG - Intronic
1040867973 8:52070125-52070147 CTCCCTTCTACGACTGCAGCTGG - Intergenic
1049591518 8:143464996-143465018 CTGCCCTCCTGGGCTTCAGCAGG - Intronic
1053396967 9:37784435-37784457 CTGCCCTCTGAGACTCCAAACGG + Intronic
1055835888 9:80441279-80441301 CTGCTCCCAAATACTTCAGCAGG - Intergenic
1056273282 9:84968012-84968034 CAGCCCTCTAAGACATTAACAGG - Intronic
1058707540 9:107649867-107649889 CTGCCCTCCAAGACTTAACCTGG + Intergenic
1060744905 9:126124852-126124874 TTGGTCTCCAAGACTTCAGCTGG - Intergenic
1061397985 9:130353854-130353876 CTGCCCTCTCACACTTCACCGGG - Intronic
1061482084 9:130902363-130902385 CTGCCCTCTCGGTCCTCAGCTGG - Intergenic
1192587758 X:72333386-72333408 CTGCTCAAAAAGACTTCAGCAGG + Intronic
1198960524 X:142177554-142177576 CTGCCCTCACAGCCCTCAGCAGG - Intergenic
1200147249 X:153932677-153932699 CAGCCCCCTAAGACCCCAGCTGG + Intronic
1201509775 Y:14746260-14746282 CTTCCCTCCATCACTTCAGCTGG + Intronic