ID: 1116891132

View in Genome Browser
Species Human (GRCh38)
Location 14:50269641-50269663
Sequence CTGTTTATTAGGACCTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116891132 Original CRISPR CTGTTTATTAGGACCTAGCA GGG Intronic
905197230 1:36289743-36289765 CTTTTGATGAGGACCTCGCACGG + Exonic
906862199 1:49373423-49373445 CTCTTTCTTAGGACTTAGCTTGG - Intronic
909341441 1:74536004-74536026 CTGATTACTAGGAGCTACCATGG - Intronic
912391855 1:109308440-109308462 CTGTTTATTGGGGCCTTGGATGG + Intergenic
912868747 1:113283769-113283791 CTGTTTATTTGGACCTGGATGGG + Intergenic
913093208 1:115493970-115493992 CTGGTCAGTAGGCCCTAGCAGGG - Intergenic
916771342 1:167911874-167911896 CTGTTTATGATGACCAAACAAGG + Intronic
921417871 1:214911652-214911674 CTGTAAATTAGGATTTAGCAGGG + Intergenic
922080236 1:222288477-222288499 CTGCTTTTTAGGACCAAGCATGG - Intergenic
924880834 1:248160476-248160498 CTGTTTAGTAGAAAGTAGCAAGG - Intergenic
1062944255 10:1448753-1448775 CTGTTGATTTAGACCAAGCACGG - Intronic
1066093526 10:32050270-32050292 CTATTTATTGGGAGGTAGCAAGG - Intronic
1068913190 10:62400572-62400594 CTTTTGATTAGCACCCAGCATGG + Intronic
1070527679 10:77309412-77309434 CTGTTTATTAGAACCTTGCTTGG - Intronic
1075837358 10:125466098-125466120 CTTTTTAAAAGCACCTAGCACGG - Intergenic
1079718386 11:23778631-23778653 CTTTTTATAAGGCCCTAGAAAGG - Intergenic
1081832719 11:46127586-46127608 CTGTTTGTTAGGAACTAAAATGG + Intergenic
1082067577 11:47913340-47913362 TTATTTATTAGGAATTAGCAAGG - Intergenic
1089646847 11:119886224-119886246 CTGCTTATGAGGACCCTGCAGGG - Intergenic
1102260944 12:111442948-111442970 CTGGTTATGAGGACCTGGCAGGG + Intronic
1102846011 12:116183275-116183297 CTGTTTATTTGGCCACAGCATGG - Intronic
1104048100 12:125177605-125177627 CTGTTTATTAAGATCTTCCAAGG - Intergenic
1104739406 12:131162029-131162051 CTCTTTCTTAGGACCAAGCAAGG + Intergenic
1105453734 13:20522552-20522574 CTGTCTATTGGGACCACGCATGG + Intronic
1107792805 13:44018929-44018951 CTGTGTCTTAGGACTTGGCAGGG + Intergenic
1111744473 13:92249483-92249505 CTGCTTATCTGGACCAAGCAGGG - Intronic
1112263423 13:97899635-97899657 CTGTTTATTAGAAACTAGAATGG + Intergenic
1116891132 14:50269641-50269663 CTGTTTATTAGGACCTAGCAGGG + Intronic
1117184581 14:53227211-53227233 CTGTTTCTCAGGTCCTGGCATGG + Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1124235621 15:27987247-27987269 CTTTTTATTAGGATCCAGGATGG - Intronic
1125506148 15:40268759-40268781 CAGTTTTTTAGGAGCTTGCAGGG + Intronic
1133537063 16:6712626-6712648 ATGTTTATTAGGTCCTATCATGG + Intronic
1133637374 16:7681092-7681114 GTGTTTCTTAGAACCTAGTAAGG + Intronic
1138389628 16:56660921-56660943 CTGTTTATTAAGCCCGAGCCAGG - Intronic
1139841544 16:69885492-69885514 CTGTTTGTTAAGATCTAGCTTGG + Intronic
1142687528 17:1586266-1586288 CTGTTTCTTAGAAACAAGCAGGG - Intronic
1142735736 17:1898030-1898052 CTGTTTATTAAAACAAAGCAAGG - Exonic
1145957629 17:28865513-28865535 CTGTTTATCAGGAGCCAACACGG + Intergenic
1147496802 17:40924420-40924442 CTGTTTTTAAGGAATTAGCATGG - Intronic
1153255568 18:3166994-3167016 CTGTTAGCTAGGAGCTAGCATGG + Intronic
925522298 2:4760925-4760947 CTGATTATTAGGACCCTGCAGGG + Intergenic
931575095 2:63710463-63710485 CTGTTTACAAGGCCCGAGCAGGG - Intronic
931922200 2:67032834-67032856 CTGTTGATTAGGACTCAGAAGGG + Intergenic
933784600 2:85828533-85828555 CTGTATCTTAGTACCCAGCAGGG - Intergenic
940480631 2:154226067-154226089 CTGTTTATTATGACCCACCTTGG + Intronic
943774018 2:191745878-191745900 GTGATTCTTAGGACCTAGCAGGG + Intergenic
946145684 2:217729296-217729318 CTGTTTCTGAGGTCCTAGCATGG + Intronic
946212156 2:218155940-218155962 CTTTGTTTTAAGACCTAGCACGG + Intergenic
947427860 2:230000065-230000087 CTGATTATTAGGGCCTGGCACGG + Intronic
948861264 2:240753685-240753707 CTGTTTATTAGGACGTGCCCTGG - Intronic
1169149912 20:3281402-3281424 CTGTTTAATAGTACATAGTAAGG - Intronic
1175440708 20:58989207-58989229 CTGTGTTTTAGGATTTAGCAGGG + Intronic
1177908357 21:26999252-26999274 CTGTTCTTTAGGGACTAGCAAGG - Intergenic
1179429307 21:41308813-41308835 CTGTTTATTTGCACCTCGCCTGG - Intronic
951614548 3:24526898-24526920 CTGTTTATCCTGACCTGGCAAGG + Intergenic
959721163 3:109490951-109490973 CTGTTTACTGGGCACTAGCAGGG + Intergenic
960446895 3:117759978-117760000 CTATTGCATAGGACCTAGCAAGG - Intergenic
964025831 3:152072906-152072928 CTGGTTATTGGGAGCTAACATGG - Intergenic
965502748 3:169475830-169475852 CTGCTAGTTAGGAGCTAGCATGG + Intronic
973550270 4:52027745-52027767 ATGTTTATAAAAACCTAGCAGGG - Intronic
982074596 4:151726101-151726123 CTGATAATTAGGATATAGCATGG + Intronic
984482112 4:180318776-180318798 CTCTTTATTAGGAGCTATAATGG - Intergenic
985481784 5:116660-116682 GTGCTTTTTAGGACCTAGCCAGG - Intergenic
987369523 5:17180426-17180448 GTGGTTATTAGGAGCTACCACGG + Intronic
990696953 5:58429097-58429119 CTGTAAATTAAGACCTAGCATGG + Intergenic
991377952 5:65985882-65985904 CTGTTAATAAGGACTTAGAATGG - Intronic
995609474 5:113893683-113893705 CTGTGTTTTAGAACCTAGGATGG - Intergenic
999595855 5:153203381-153203403 CTGTGAACTAGGACCTAACATGG + Intergenic
1005152643 6:22770586-22770608 CTGATTATTAGGACCTATGCAGG - Intergenic
1009540345 6:64947415-64947437 CTAGTTATTAATACCTAGCATGG - Intronic
1012523551 6:100150059-100150081 CTTTTTATTAGGACTTGTCATGG - Intergenic
1013467189 6:110427960-110427982 CTGCTCCTTAGCACCTAGCAGGG + Intronic
1016444102 6:144115240-144115262 GTGATTATCAGGAACTAGCATGG - Intergenic
1021488386 7:21191836-21191858 CTGTTTATCAGGAAGTAACATGG - Intergenic
1027360603 7:77404834-77404856 CTGTCTAGTAGGACTGAGCATGG + Intronic
1028173492 7:87627954-87627976 CTGTTTATTAGCCCCTGGGAGGG + Intronic
1033655643 7:143372119-143372141 ATGTTTATCAGGACGTAGAAAGG + Intergenic
1035219759 7:157399342-157399364 CTGTTCTTTAGCACCAAGCAGGG - Intronic
1041254070 8:55964125-55964147 CTTTTTAAAAGGACCTAGGATGG + Intronic
1042724583 8:71860048-71860070 CTGTAGGTTAGAACCTAGCAAGG - Intronic
1043269681 8:78316212-78316234 CTTTTCATGAGGACCTAGAATGG + Intergenic
1057406088 9:94771930-94771952 CTGTTTGTTAAGACCTAGACTGG + Intronic
1059249849 9:112878711-112878733 CTGTATCTCAGCACCTAGCATGG + Intronic
1059690259 9:116677810-116677832 CTGCTTATTTGGCCCTAGAAAGG + Intronic
1061277572 9:129578315-129578337 ATGTTTATTAGGGCCAGGCATGG - Intergenic
1187915849 X:24151185-24151207 ATGTTTCTTAGCATCTAGCACGG - Intronic
1192432651 X:71122841-71122863 CTTTGGATTGGGACCTAGCAAGG + Exonic
1194427131 X:93753194-93753216 GTGTTTGCAAGGACCTAGCAAGG - Intergenic
1194659330 X:96612145-96612167 CTGTTCATTAGCACCTACAAAGG + Intergenic
1195596525 X:106697455-106697477 CTGATATTTAGGACCTAGCCTGG - Intronic
1197123227 X:122915248-122915270 CTGGTTATTAGAAACTAGGAAGG - Intergenic