ID: 1116894407

View in Genome Browser
Species Human (GRCh38)
Location 14:50301962-50301984
Sequence ATCACTAAGCAAATGCTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116894407 Original CRISPR ATCACTAAGCAAATGCTAGT TGG Intronic
906257729 1:44363252-44363274 GCCACTAAGCAAATGCTTCTTGG - Intergenic
906471810 1:46137203-46137225 CTCACTTAGCAAATGTTTGTTGG + Intronic
906489560 1:46257658-46257680 AACACTAAGAAAAAGCAAGTGGG - Intronic
907537464 1:55177991-55178013 ATCACTAGGCAAATGCCTGTTGG - Exonic
908533857 1:65059362-65059384 ATCATGAAGCAGAAGCTAGTGGG + Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910372184 1:86527980-86528002 GGCACTCAGCAAATGCTTGTTGG + Intergenic
912634224 1:111276832-111276854 ATCACTAACCAAAAGAAAGTAGG - Intergenic
916894178 1:169144509-169144531 ATCAGGAAGTAAATGCTAGGAGG - Intronic
918603320 1:186390353-186390375 ATCACTGAGCAACTCCTAGGTGG - Intronic
919714190 1:200758170-200758192 AGCAGTAAGTAAATGCTAGGTGG + Intronic
919913044 1:202123537-202123559 ATCACCAAGCAGAGGCTACTGGG + Exonic
920279917 1:204834985-204835007 ATCACCAAGCACCTGCTATTTGG + Intronic
920777617 1:208955263-208955285 TTCATTAAGCAAATGGTGGTGGG + Intergenic
922494729 1:226047568-226047590 TCCACTAAGCACATGCTTGTTGG - Intergenic
1065626315 10:27632739-27632761 AACACTAAACAAAAGCTAGCTGG + Intergenic
1070492946 10:76994466-76994488 ATTACTAAGAAATGGCTAGTTGG - Intronic
1074901388 10:117819028-117819050 TTCATTAAGCAAATGCTTATTGG + Intergenic
1081021065 11:37948114-37948136 ATCCCTAAGCAGCTGCAAGTAGG - Intergenic
1086019110 11:82204684-82204706 AACAATAAGCAAATGCTCCTAGG - Intergenic
1087279723 11:96196993-96197015 ATCAGGAAGCAAATGGCAGTAGG + Intronic
1090528382 11:127562352-127562374 ATCAATAAGCAAATCATAATTGG - Intergenic
1090562254 11:127945029-127945051 ATCAATATGCAAATTTTAGTGGG + Intergenic
1091979008 12:4850609-4850631 CTCACTAGGCAAATGCCAGCGGG + Intronic
1097732268 12:63141784-63141806 ATCTATAGGCAAATGATAGTAGG - Intergenic
1099043368 12:77684048-77684070 ATCACTCAGATATTGCTAGTGGG - Intergenic
1100065515 12:90639584-90639606 AAAACAAAACAAATGCTAGTTGG + Intergenic
1100132575 12:91514579-91514601 ATTACTAAGAAATTTCTAGTGGG + Intergenic
1107795817 13:44050565-44050587 ATCAGTCAGCGAATGCTTGTGGG - Intergenic
1110676301 13:78249738-78249760 ATCACTTTACAAATTCTAGTGGG - Intergenic
1111714164 13:91858170-91858192 AGTCCTAAGCAAATCCTAGTTGG - Intronic
1111847128 13:93525048-93525070 ATCCCTAAACAAATATTAGTAGG - Intronic
1112016380 13:95334812-95334834 ATCAATACCCAAATGCTAGCTGG + Intergenic
1114401416 14:22414449-22414471 AAAACTAAGCAAAAGGTAGTAGG + Intergenic
1116894407 14:50301962-50301984 ATCACTAAGCAAATGCTAGTTGG + Intronic
1117273382 14:54167713-54167735 TTCACCAAGCTAATGCTAGTAGG - Intergenic
1117384442 14:55196679-55196701 TTCAATAAGCAGTTGCTAGTTGG - Intergenic
1117566616 14:57000022-57000044 ACCACTAAGCAAATGGGGGTAGG + Intergenic
1123191874 14:106579273-106579295 ACAACTATGCAAATGCAAGTGGG - Intergenic
1124605892 15:31170212-31170234 ATCACTAAGCACAAGCAATTTGG + Intergenic
1124785678 15:32678010-32678032 ATTATTTAGCAAATGCTGGTGGG + Intronic
1130160888 15:81398721-81398743 ATCACTAACCAAATCCATGTAGG + Intergenic
1133717383 16:8462833-8462855 TTCTCTAAGCCAATGCCAGTGGG + Intergenic
1134179908 16:12039202-12039224 ATTATTAAGCAAATGCTGATTGG + Intronic
1134308570 16:13055898-13055920 ATCACTCAGCAAAGGCTTGTTGG - Intronic
1135247129 16:20866688-20866710 ATCAATCAGCAAATGCCAGAAGG + Intronic
1135306653 16:21372969-21372991 ATTATTAAGCAAATGCTGATTGG + Intergenic
1136303396 16:29352111-29352133 ATTATTAAGCAAATGCTGATTGG + Intergenic
1137999913 16:53266584-53266606 GTCACTAAACAAATGCTATTTGG - Intronic
1142474855 17:182615-182637 ATCACTAAACAAATCCCAGAGGG + Intergenic
1145085837 17:19938687-19938709 ATCCTTAAGCAAATGCTAAAGGG - Intronic
1149343633 17:55712565-55712587 AGCACCAGGCAAATGCTAATTGG + Intergenic
1149744221 17:59079358-59079380 ATCTCTAAGAAAATGCTGGCAGG + Intronic
1152369071 17:79874088-79874110 ATCACTCAGAAAATGCTACCGGG - Intergenic
1155333884 18:24745726-24745748 AACACTGAGCAAAAGCCAGTGGG - Intergenic
1158060282 18:53332592-53332614 ATCAATAAGTAAATATTAGTAGG + Intronic
1159692795 18:71511047-71511069 ATTACTGAGCAAATTCTATTTGG + Intergenic
1159998851 18:74996217-74996239 AAAACTAAGAAAATGCTTGTTGG - Intronic
925767429 2:7250105-7250127 ATCACAGAGCAGATGCAAGTGGG - Intergenic
928707220 2:33963235-33963257 AGCACAAAGCAAATGGAAGTTGG + Intergenic
933298795 2:80520240-80520262 ATCAATAAGCATATACTAGATGG + Intronic
934012700 2:87841150-87841172 ATCACCAAGGAAATGTTGGTAGG - Intergenic
936418367 2:112340748-112340770 AGCACTTAGCATATGCTATTAGG + Intergenic
938633438 2:133195494-133195516 ATCACTAGGCAAAAGGTATTTGG + Intronic
938967939 2:136404976-136404998 AAGACTTAGCAAATGCTGGTAGG + Intergenic
940084890 2:149848279-149848301 AGCACCAAGGAAATGCTGGTGGG - Intergenic
940334609 2:152512406-152512428 ATCACTAAGCCAATGATATGGGG + Intronic
941582581 2:167317944-167317966 ATAACTAAGCAAATGATCTTGGG - Intergenic
945519650 2:210809256-210809278 AACACTAAGCAAAAGAAAGTTGG - Intergenic
946752991 2:222912000-222912022 ATTTCATAGCAAATGCTAGTAGG - Intronic
1169511322 20:6267344-6267366 ATGCCTAAGCAAAGGCTGGTAGG + Intergenic
1172772592 20:37390233-37390255 ATCACACAGCAAATCCTTGTTGG + Intronic
1173261686 20:41442046-41442068 AAAACTAAGCCAATGCTAATGGG + Intronic
1175015069 20:55781307-55781329 ATCACCAATCAAAGGCTAGTTGG + Intergenic
1178256977 21:31062375-31062397 TTTACTATGCAAATGGTAGTGGG - Intergenic
949755724 3:7408685-7408707 AACACTGCGCAAATGCTAGCGGG + Intronic
952917451 3:38258921-38258943 AACACTAATCAAAAGATAGTAGG - Intergenic
956396875 3:68835162-68835184 CTTACTAAGCAGATGCTATTTGG - Intronic
961098551 3:124178148-124178170 AACACTAAGCAAGTGCTAAAAGG + Intronic
963204680 3:142620495-142620517 ATCTCTAAGCAAATGTTTATGGG + Intronic
966129406 3:176620331-176620353 AGCACAAAGCAAATGTCAGTTGG - Intergenic
974435040 4:61845881-61845903 ACTAGTAAGCAATTGCTAGTAGG - Intronic
975871041 4:78778470-78778492 GTCAATAATCAAATGCTAGGAGG + Intronic
976877691 4:89875186-89875208 ATCAGTAAGCATATGATTGTTGG - Intergenic
977269087 4:94892677-94892699 CTCACTAAACAAATGCTTGTGGG - Intronic
984213527 4:176879830-176879852 ATTAATAAGCTAATGCTAATAGG - Intergenic
984449609 4:179882506-179882528 ATCAGTAATCAAATGCTTGCAGG - Intergenic
987236809 5:15950812-15950834 ATCTGTAAGCAAATCCTATTTGG - Intergenic
991160391 5:63492291-63492313 ATCAATAAGAAAAAGCTAGGTGG - Intergenic
991660803 5:68949035-68949057 ATAACTCAGTAAATGTTAGTTGG - Intergenic
994216713 5:97145510-97145532 ATCACTTAGCAAATGCCCGCAGG + Intronic
995260737 5:110101471-110101493 ATCACTACAGAAATGCTATTTGG - Intergenic
997563163 5:134866385-134866407 ATTACAAAACAAATGCCAGTCGG + Intergenic
999966596 5:156816835-156816857 ATCTAGAAGCAAATCCTAGTTGG - Intergenic
1004781468 6:18913255-18913277 ATGACTTAGCAAAGGCTTGTTGG + Intergenic
1006482522 6:34308614-34308636 AACACTAATCAAATGCAAGCAGG + Intronic
1007868054 6:44996340-44996362 ATCAGTAAGAACATTCTAGTAGG - Intronic
1009572932 6:65412349-65412371 ATGACCCAGCAAATCCTAGTAGG - Intronic
1012661247 6:101896449-101896471 TTCTGTAATCAAATGCTAGTTGG + Intronic
1015852212 6:137585813-137585835 ATCAATAACCAAAAGATAGTTGG - Intergenic
1016290247 6:142520902-142520924 ATCACTATGTAAATGTTAGTTGG + Intergenic
1020570006 7:9847400-9847422 ATTAGTAAGGAAATTCTAGTAGG + Intergenic
1020938803 7:14504508-14504530 ATCACAAAGCAAAAGCTATAGGG - Intronic
1023616414 7:42024753-42024775 ATAACTAACCTAAGGCTAGTTGG - Intronic
1026549119 7:71351987-71352009 ATCACTAGGCACACCCTAGTCGG - Intronic
1029024142 7:97397430-97397452 ATCACAAAGCAAATGAGAGAAGG - Intergenic
1029289500 7:99491423-99491445 ATCACTAAGGAAATTCCAATGGG - Intronic
1029837387 7:103327141-103327163 ATCACTAAGCAAATTAATGTAGG - Intronic
1030315883 7:108114092-108114114 AACAGTAAGCAAATGCCAGTGGG + Intronic
1032115313 7:129111755-129111777 CACACATAGCAAATGCTAGTGGG - Intergenic
1032617221 7:133486563-133486585 GTCATTAAGCAAATTCTAGAAGG - Intronic
1033190698 7:139276212-139276234 ATCATTTATTAAATGCTAGTTGG + Intronic
1034906919 7:154957449-154957471 ATCACTAGGACAATGCAAGTGGG + Intronic
1037470123 8:19200302-19200324 ATGACTAAGTAAATGCTCCTTGG + Intergenic
1037596398 8:20357924-20357946 AGCATTCAGCAAATGCTTGTTGG - Intergenic
1041212306 8:55564628-55564650 ATCACCAAGGTAATGCTATTTGG + Intergenic
1047343480 8:124005037-124005059 ATCACTGAGCAGATGCAGGTAGG - Intronic
1047853049 8:128879704-128879726 ATAACTAAGAAAATGCTAGATGG + Intergenic
1050066554 9:1765846-1765868 ATCGCTCAACAATTGCTAGTGGG - Intergenic
1050796443 9:9550970-9550992 ATCACTCATGAATTGCTAGTAGG + Intronic
1055578011 9:77679248-77679270 ATCACTAAGCAATGGCTGTTGGG + Intergenic
1056065452 9:82929092-82929114 TTGAATAAGCAAATGCCAGTGGG + Intergenic
1059260313 9:112969929-112969951 GTCACTCAGCAAAGACTAGTTGG - Intergenic
1059384476 9:113953661-113953683 ATCACTAAACAAATGTATGTGGG + Intronic
1059722867 9:116978262-116978284 ACCTCTAGGGAAATGCTAGTAGG + Intronic
1062236348 9:135510859-135510881 ATCACTCAGAAAATCCCAGTTGG + Intergenic
1186053038 X:5620303-5620325 ATTACTAAGTAAATGCTATCAGG - Intergenic
1189165390 X:38856027-38856049 AACAGTAAGCAAATGATAGTTGG - Intergenic
1191818583 X:65276007-65276029 ATCACTGAGGAATTGCTATTTGG - Intergenic
1194565152 X:95477477-95477499 ATCACAAAGAATATGCTACTGGG + Intergenic
1195258575 X:103111914-103111936 CTCATTAAGCAAATGCTTCTGGG + Intergenic
1196327316 X:114422133-114422155 ATCACTAGGCAGTTGCTATTTGG + Intergenic
1196743210 X:119043724-119043746 AGCACAAAACAAATGCTAGGAGG + Intergenic
1197151964 X:123229969-123229991 ATCACTAATCAAATGCTGAGGGG + Intronic
1199131776 X:144197338-144197360 ATCACCAAGGAAATGTTGGTAGG + Intergenic
1199480621 X:148294717-148294739 ATCATTAAGTAAATTCTAGATGG - Intergenic