ID: 1116899450

View in Genome Browser
Species Human (GRCh38)
Location 14:50347839-50347861
Sequence ACAGAGGAGCAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1700
Summary {0: 1, 1: 0, 2: 16, 3: 215, 4: 1468}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116899440_1116899450 24 Left 1116899440 14:50347792-50347814 CCAGCTAAAGAAGAGGAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG 0: 1
1: 0
2: 16
3: 215
4: 1468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116899450 Original CRISPR ACAGAGGAGCAGAAAGAGGA AGG Intronic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900424722 1:2571228-2571250 TCAGAGAAACAGAAAGAGGCAGG + Intergenic
900427624 1:2587645-2587667 ACAGAGGGTCGGAAGGAGGAGGG + Intronic
900439369 1:2645705-2645727 ACAGAGAAGCAGGAAGGGGCAGG - Intronic
900540636 1:3200965-3200987 GAAGAGGAGGAGGAAGAGGAGGG + Intronic
900788491 1:4664604-4664626 ACACAGGTGAAGAAAGAGAATGG + Intronic
900853260 1:5160621-5160643 AGAGAGGAGAGGAAAGAGGCAGG + Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900900175 1:5510705-5510727 GCAGATGAGCAGACTGAGGAAGG + Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901631374 1:10649790-10649812 AAAGAAGCGCAGAAGGAGGAGGG + Intronic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
901755980 1:11441857-11441879 AGAGAGGAGGAGGAAGATGAGGG + Intergenic
901773219 1:11541581-11541603 ACAGGGTAACAGAAAGAGGCCGG + Intergenic
901909871 1:12447964-12447986 TCAGTGGGGGAGAAAGAGGAGGG + Intronic
902199790 1:14824788-14824810 ACAGAGAACCAGATAGAAGAAGG - Intronic
902228734 1:15013815-15013837 ACTGAGGAGCTGAAGGAGGCAGG + Intronic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902614909 1:17618489-17618511 ACAGAGGAGGAGGAGGAGGAGGG - Intronic
902755352 1:18545774-18545796 ACAGAGGAGGAGAGGGAGGCTGG - Intergenic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
903411898 1:23151509-23151531 ATAGAGGAGCAGAAAGAACATGG + Intronic
903610865 1:24611319-24611341 ACAGAGTAGGAGGAAAAGGAGGG - Intergenic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903856712 1:26342181-26342203 ACAGAGCAGCAGAGACAAGATGG - Intronic
904001193 1:27339733-27339755 ACAGGAGAGCAGAGAAAGGAAGG + Intergenic
904030731 1:27532088-27532110 ACGGAGGGGCAGCAAGAGAATGG - Intergenic
904052348 1:27647202-27647224 CCAGAGGAGCAAAAGAAGGAAGG + Intergenic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904276534 1:29388384-29388406 ACTGAGGAGCAGACAGAGAAGGG + Intergenic
904447812 1:30588816-30588838 ACAGAGCAGGGGAAAGAGGAGGG + Intergenic
904584416 1:31572008-31572030 ACAGAGGAGCAGGAAGGGGCTGG - Intergenic
904619573 1:31767090-31767112 ACAGAGGCCCAGAAAGCTGAAGG - Intergenic
904788652 1:33001154-33001176 ACATAGGAGGAGAAACAGGGAGG + Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904883666 1:33719617-33719639 ACATAGGAGCAGAAAGAGCAGGG + Intronic
904991773 1:34598931-34598953 ACAGAGGAACAGCAAGAGGAGGG - Intergenic
905313073 1:37064091-37064113 AGAGAGGAGCAGAAGGGCGAGGG + Intergenic
905521321 1:38602862-38602884 AAACAGGAGCAGAAACAGAAAGG + Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905675280 1:39820414-39820436 GCAGATGTGCAGAAAGAGGGTGG - Intergenic
905844197 1:41213442-41213464 ACAGAGGAGGAGATGGAGGAAGG - Intronic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906192113 1:43905280-43905302 GAAGAGGAGCAGAAGGAGGCAGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192290 1:43905932-43905954 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192433 1:43906438-43906460 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192456 1:43906509-43906531 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906192485 1:43906638-43906660 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906403393 1:45521955-45521977 CCGGAGGAGGAGAGAGAGGAGGG + Intronic
906492595 1:46279709-46279731 ATAGAGGCCCAAAAAGAGGAAGG + Intronic
906612792 1:47214827-47214849 TGAGAGGAGCAGTATGAGGAAGG - Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906646301 1:47477988-47478010 ACTGAGGGTCAGAAAGGGGAAGG - Intergenic
906646480 1:47478844-47478866 AGAGAGGAGGAGCAAGAGGAGGG - Intergenic
906685802 1:47762463-47762485 ACAGTGGATCCCAAAGAGGAGGG - Exonic
906728498 1:48061416-48061438 AAAGAGCAGCAGAAAAAGCAAGG + Intergenic
906833765 1:49061070-49061092 GCAAAGGAGAAGAATGAGGAGGG + Intronic
906859300 1:49341871-49341893 AGAGAGGAGGAGAAAGGGGAGGG - Intronic
907068398 1:51510636-51510658 ACAGTGGAGCCGGAAGAGGGAGG + Intronic
907467720 1:54650525-54650547 AAAGAGGAGAGGGAAGAGGAAGG - Intronic
907495490 1:54841467-54841489 ACCAAGGACCAGAGAGAGGAGGG - Intronic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
907885347 1:58587849-58587871 ACAGATGAGCAAATAGAGGCAGG - Intergenic
908074364 1:60497807-60497829 CCAAAGGAGAAGAAAGAGAAAGG + Intergenic
908107993 1:60865625-60865647 GCAGAGTGGCAGAGAGAGGATGG - Intronic
908354661 1:63318235-63318257 AAAGAGGAAGAGAGAGAGGATGG - Intergenic
908766485 1:67559149-67559171 ACAGAGGAGAGGAATGAGTAAGG + Intergenic
908845795 1:68323137-68323159 ACTGAGGGGCAGAAAAGGGATGG - Intergenic
909292798 1:73905259-73905281 ACTGAAGAGGAGAAAGAGGAAGG + Intergenic
909320083 1:74274287-74274309 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
909615041 1:77598370-77598392 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
909686546 1:78355211-78355233 AAGGAGGAGGAGAAAGGGGAGGG - Intronic
910107436 1:83646642-83646664 ACAGAAGAGGAGGAAGAGGTTGG - Intergenic
910262718 1:85307645-85307667 ACAGAGGAGGAGAGAGGAGAGGG - Intergenic
910341294 1:86191016-86191038 ACAGAGTAGGGGAAAGAGGTGGG - Intergenic
910392930 1:86763000-86763022 AAACAGGAGGAGAAAGAGAAAGG - Intergenic
910540486 1:88350489-88350511 AAAGAGGGAAAGAAAGAGGAGGG + Intergenic
910892069 1:92028872-92028894 GCTGAGGAGGAGAAAGAAGAAGG - Intergenic
911104626 1:94119999-94120021 CTAAAGGAGCTGAAAGAGGAAGG - Intronic
911664064 1:100534424-100534446 ACAGAGATGGAGAAAGATGAAGG - Intergenic
911812763 1:102304618-102304640 GCAGAGGAGAAGGAAGAGGAGGG - Intergenic
911854469 1:102859360-102859382 ACTGAGGGGCAGAAAGCAGAAGG - Intergenic
912039672 1:105372730-105372752 AAGGAGGAGAAGAAATAGGAAGG + Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912489307 1:110052991-110053013 ACAGAGGAGGAGAATGAAAAAGG - Intronic
912520861 1:110243713-110243735 GCAGAGGAGGGGAAGGAGGAGGG + Intronic
912662372 1:111543720-111543742 AAAGAGGAGGAGGAAGAGGAGGG + Intronic
912746388 1:112248942-112248964 ACAGAGGAGGGGATGGAGGACGG - Intergenic
912883514 1:113444280-113444302 ACAGAGGTGCAGAGAGAGGATGG + Intronic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913446083 1:118952063-118952085 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
913484466 1:119321167-119321189 ATAGGGGAGCAGAAAGAGACTGG - Intergenic
914421959 1:147537431-147537453 ACAGGGCAGTAGAAAGAGAAGGG - Intergenic
914989162 1:152483392-152483414 AAAGAGGAGGAGAAAGAGCTGGG - Intergenic
915201236 1:154230885-154230907 ACAGATGTGCATACAGAGGAGGG + Intronic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915645074 1:157264745-157264767 AGAGATGAACAGAATGAGGACGG + Intergenic
915842652 1:159228042-159228064 ATAGAGGAAGAGAAAGAGGAGGG - Intergenic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
915949890 1:160182071-160182093 ACGGGGGAGCATACAGAGGAAGG + Intronic
915973291 1:160368560-160368582 ACAGAGGTGGAGGAAGAGGCTGG + Intronic
916240836 1:162637980-162638002 AAAAAGGAGGAAAAAGAGGATGG - Intronic
916726861 1:167531432-167531454 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
916755941 1:167770454-167770476 ACTGAGGAGTGGAAAGAGAAAGG + Intronic
917176070 1:172236923-172236945 ATAGAGGAAGAGGAAGAGGAAGG - Intronic
917470782 1:175324173-175324195 ACAGAGTAGAAGCCAGAGGAAGG - Intronic
917484528 1:175443701-175443723 AGAGATGGGAAGAAAGAGGAGGG + Intronic
917513931 1:175691317-175691339 TAAGAGGAGGAGGAAGAGGAAGG + Intronic
917533182 1:175855279-175855301 ACTGAGGAGAAGTAAGAGAATGG + Intergenic
917574323 1:176304955-176304977 AGAAAGGGGAAGAAAGAGGAAGG - Intergenic
917584161 1:176408485-176408507 ACAGGAGAGAAGAAAGAGGGTGG - Intergenic
918236669 1:182586918-182586940 ACAGAGCAGCAGTATGAAGAAGG + Exonic
919057245 1:192586389-192586411 CCACAGGAGCAGAAGGAGAAGGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919463547 1:197906419-197906441 AGAAAGGACCAGAGAGAGGAAGG - Intronic
919513140 1:198491159-198491181 AGAGAGCAGCAGGAAGAAGATGG + Intergenic
919513573 1:198494774-198494796 ACAGAGGAACAGGCAGAGAAGGG - Intergenic
919563384 1:199152865-199152887 AGAAAGGAGGAGAAGGAGGAAGG + Intergenic
919632830 1:199975629-199975651 ATAGAGGAGGAGTTAGAGGAAGG + Intergenic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
919780190 1:201216419-201216441 AGAGAGGAGCGGGAAGAGGAGGG - Intronic
919869672 1:201810865-201810887 ACAGAAGAGAAGAAAGATGAAGG - Intronic
919975345 1:202607140-202607162 CCTGAGGAGCAGAAAGAGCTTGG - Intronic
920089548 1:203442511-203442533 AGAGAGGAATAGAAGGAGGAAGG - Intergenic
920131201 1:203733153-203733175 AGAGAGGTGAAGAAAGAGGAAGG - Intronic
920264795 1:204713697-204713719 ACAGAGGAGGGGAGAGAGGAAGG + Intergenic
920306730 1:205023180-205023202 CAAGCGGTGCAGAAAGAGGAGGG - Intergenic
920533517 1:206722582-206722604 GAAGAGGAGGAGGAAGAGGAAGG + Intronic
920694568 1:208172439-208172461 GCAGAGGAGATGGAAGAGGAGGG - Intronic
920697812 1:208195059-208195081 AGAGTGGAGCAGGAAGAGGTAGG + Intronic
920812802 1:209302999-209303021 ACAGAGGAGAGGAAGGAGGGAGG + Intergenic
921262620 1:213397256-213397278 AGAAAGGAGAAGAAAGAGTAAGG - Intergenic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
921374536 1:214460148-214460170 ACATAGGAACAGCAAGAGTAGGG + Intronic
921405016 1:214769204-214769226 ACTGATGACCAGAAACAGGAGGG - Intergenic
921422726 1:214967107-214967129 AGAGAGGGGTAGCAAGAGGAAGG + Intergenic
921458167 1:215396582-215396604 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
921723642 1:218501024-218501046 AGAGAGGGGAAGAGAGAGGAGGG - Intergenic
922026418 1:221753832-221753854 ACTGAGGCTCAGAAAGAGTAAGG - Intergenic
922182828 1:223248915-223248937 ACAGAGGAGCACACAGGTGAGGG + Intronic
922209497 1:223476717-223476739 AGAGAAGAGGAGAAGGAGGAGGG + Intergenic
922724032 1:227914364-227914386 AAAGAGGAGGAGGGAGAGGAGGG - Intergenic
923272326 1:232368920-232368942 AAAGAGGAGGAGCAAGAGGAAGG - Intergenic
923345898 1:233052497-233052519 TCAATGGAGGAGAAAGAGGAAGG - Intronic
923432469 1:233936571-233936593 GAAGAGGAGGAGGAAGAGGAAGG - Intronic
923746844 1:236709152-236709174 TGAGAGGAGAAGAAAGAGGCCGG - Intronic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
924508540 1:244709490-244709512 CCAGTGGAGGAGAAAGGGGAAGG - Intergenic
924557454 1:245130071-245130093 AAAGAGAAGCAGAAAGAAAATGG + Intergenic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
924927105 1:248693692-248693714 AGAGTGGAGAAGACAGAGGATGG - Intergenic
1062990559 10:1810562-1810584 AGAGAGGAGAAAAAAGAGGGAGG + Intergenic
1063421146 10:5913329-5913351 ACCGAGGCTCAGAAAGAGGCTGG + Intronic
1063614809 10:7592491-7592513 AGAGAGAAACAGAAAGAGTAGGG + Intronic
1063881338 10:10535788-10535810 CCACAGGAGCAGAATGGGGAGGG + Intergenic
1064496121 10:15912100-15912122 ACAAAGGAGGAGGAGGAGGAAGG + Intergenic
1064543619 10:16429643-16429665 ACAGATGAACAAAGAGAGGAAGG + Intergenic
1064724940 10:18269747-18269769 AGGGAGGAGCAGAGAGAGGGAGG - Intronic
1064735588 10:18378873-18378895 AGTTGGGAGCAGAAAGAGGAAGG - Intronic
1065182362 10:23139394-23139416 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1065691397 10:28337443-28337465 AGAGAGGAGAAGGAAAAGGAAGG + Intergenic
1065876289 10:30000210-30000232 AAAGAGGAGCAGAGAGAGGGAGG - Intergenic
1065966995 10:30778761-30778783 CAAGAGGAGGAGGAAGAGGAAGG + Intergenic
1066034255 10:31465907-31465929 ACAGATAAGATGAAAGAGGAAGG + Intronic
1066045934 10:31595455-31595477 ACAGAGGAAGAGAGAGAGAAAGG + Intergenic
1066148401 10:32587395-32587417 AGAGAGCAACAGAGAGAGGAAGG + Intronic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066237118 10:33496246-33496268 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1067083093 10:43222626-43222648 ACAGATGAACAGTAAGAGGAAGG - Intronic
1067157497 10:43794420-43794442 ACAGGGGTGCAGAATGAGGGAGG - Intergenic
1067288511 10:44924590-44924612 ACAGAGCAGGGGACAGAGGAGGG + Intronic
1067451043 10:46382093-46382115 ACAGAGCAGCAGAGAGATCAAGG - Intronic
1067512887 10:46910385-46910407 ACAGAGGAAGAGAGAGAGGTGGG - Intergenic
1067554371 10:47257991-47258013 ACAGCACAGAAGAAAGAGGAAGG + Intergenic
1067586200 10:47477658-47477680 ACAGAGCAGCAGAGAGATCAAGG + Intronic
1067649358 10:48141437-48141459 ACAGAGGAAGAGAGAGAGGTGGG + Intergenic
1067742354 10:48905241-48905263 ATAGAGGGGCAGGTAGAGGAGGG + Intronic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1068147026 10:53084869-53084891 ACAGAAAAGTAAAAAGAGGAAGG - Intergenic
1068435735 10:56989022-56989044 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1068496365 10:57789408-57789430 AGAGAGGACCAGAAAGAGAAGGG - Intergenic
1068766094 10:60765422-60765444 AAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1068781905 10:60928636-60928658 AAAGGGGAGTAGAAAGGGGATGG + Intronic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1069272022 10:66540640-66540662 AGAAAGGAAGAGAAAGAGGAAGG - Intronic
1069390926 10:67934166-67934188 ACAGGGGAGTAGAAAGTGAATGG - Intronic
1069574518 10:69517181-69517203 ACACAGGAGCAGCGAGAGGAAGG - Intergenic
1069807087 10:71132801-71132823 ACAGGGGAGAAGAGGGAGGATGG - Intergenic
1069960183 10:72074932-72074954 GCCCAGGAGCAGACAGAGGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070342996 10:75514668-75514690 ACAAAGGAGCAAGAGGAGGAGGG - Intronic
1070703931 10:78623568-78623590 ACAGAGGAAAAGAAAAAAGAAGG + Intergenic
1070819689 10:79347657-79347679 CCGGAGGAGGAGGAAGAGGACGG - Exonic
1070837958 10:79462938-79462960 CCACAGGAGCAGAGAGGGGAGGG + Intergenic
1071276165 10:84057461-84057483 ACACAGCAGCACAAAGAAGAGGG - Intergenic
1071433778 10:85627665-85627687 ACAGTGCAGCAGAAAAAGCAGGG + Intronic
1072049780 10:91691744-91691766 ACAGAGGTGCGGAAAGGTGAAGG - Intergenic
1072178958 10:92960667-92960689 ACAAAGGAGAGGAATGAGGAAGG - Intronic
1072686983 10:97543301-97543323 GCCGAGGAGGAGGAAGAGGAAGG + Intronic
1072749786 10:97969437-97969459 AGAGAGGAGGAGAAAGAGAAAGG - Intronic
1072958987 10:99912684-99912706 AGAGAGGAAGAGAAAGAGGAGGG - Intronic
1073200632 10:101732294-101732316 ACAGAGGCTCAGAAAGATTAAGG - Intergenic
1073349713 10:102810911-102810933 AGAAAGGAAAAGAAAGAGGAAGG - Intronic
1073371663 10:102995202-102995224 AAAAAGGAGGAGGAAGAGGAAGG - Intronic
1073679702 10:105689332-105689354 ATAGAGGGAGAGAAAGAGGAAGG - Intergenic
1073775169 10:106777087-106777109 AAAGTGGAAGAGAAAGAGGATGG + Intronic
1074007573 10:109443691-109443713 ATAGAGGAGTAGAAAGAAGTAGG + Intergenic
1074110847 10:110421827-110421849 AAAGAGGTGGAGAAAGAGGGAGG + Intergenic
1074204451 10:111270736-111270758 GAAGAGGAGGAGAAAAAGGAAGG - Intergenic
1074369285 10:112886624-112886646 GCAGAGGAGGAGGAGGAGGAGGG - Intergenic
1074529130 10:114285002-114285024 ACTGGGGAGCAAGAAGAGGACGG + Intronic
1074609905 10:115011654-115011676 AGAGAGGAGGAAAAAAAGGAAGG + Intergenic
1074644979 10:115439193-115439215 ACTGAGGATGAGGAAGAGGAGGG + Intronic
1074719459 10:116251864-116251886 GCAGAGGAGCAGAAATGGGCAGG + Intronic
1074866577 10:117547461-117547483 ACAGGTGAGCAGGAAGGGGATGG - Intronic
1074866766 10:117548505-117548527 AGAGAGAAGGAGAAAGAGGGAGG + Exonic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1075163890 10:120049064-120049086 AAAGTGGAGGAGGAAGAGGATGG + Intergenic
1075182902 10:120227932-120227954 GCAGAGGGGCATAAACAGGATGG + Intergenic
1075197978 10:120377779-120377801 AGAGAGGAGCAGAAGGGGAAGGG - Intergenic
1075263834 10:120984277-120984299 ACAGAGCAGCAGAACGGGGTTGG - Intergenic
1075347466 10:121694203-121694225 ACAGAGGAGAAGAAGGAAAAAGG - Intergenic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1075807575 10:125201291-125201313 ACAGAGTGAGAGAAAGAGGAAGG + Intergenic
1076003584 10:126930919-126930941 AAAGGGGAGCTGATAGAGGACGG + Intronic
1076068092 10:127464700-127464722 TCATAGGAGCAGGAGGAGGATGG + Intergenic
1076161050 10:128244538-128244560 GCAGTGGAGGAGAAAGAGGAGGG - Intergenic
1076198574 10:128540005-128540027 AGAGAGGCGGAGAAAGAGCAGGG - Intergenic
1076272409 10:129165934-129165956 AAAGAAGAGAAGAAGGAGGAAGG + Intergenic
1076294370 10:129373342-129373364 ACAGATGAGCAGCCAGAGTACGG + Intergenic
1076390943 10:130101420-130101442 ACTGAGGAGCAGAGAGAGGGTGG + Intergenic
1076425085 10:130361978-130362000 AAAGAGGAGGAGAAAGAGAGAGG + Intergenic
1076550389 10:131274104-131274126 ACAGCAGAGCAGGAAAAGGAAGG - Intronic
1076623676 10:131808847-131808869 ACAGAGGCACAGATAGAGGGAGG - Intergenic
1076656123 10:132024796-132024818 AAACAGGAGAAGAAATAGGAGGG - Intergenic
1076714362 10:132355826-132355848 CCAGAGGATGAGGAAGAGGAAGG + Exonic
1076812324 10:132893804-132893826 ACTGAGGAGCATAAAGCAGAAGG - Intronic
1076851415 10:133095274-133095296 ACAGAGGGGCAGAGTGAGGGTGG + Intronic
1077048166 11:555248-555270 GGAGAGGAGGAGAACGAGGAGGG + Intronic
1077300631 11:1845322-1845344 ACAGAGAAGCAGAGAGACAAAGG + Intergenic
1077816021 11:5686046-5686068 CCAGAAGAGAAGAGAGAGGAAGG - Intronic
1078063313 11:8061953-8061975 ACAGAGGAGGAGGAGCAGGAAGG - Intronic
1078313474 11:10270491-10270513 GCTGAGGAGGAGGAAGAGGAAGG + Intronic
1078378600 11:10818702-10818724 ACAGTGGAGAAAGAAGAGGAGGG - Intronic
1078434402 11:11312515-11312537 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1078857551 11:15219031-15219053 ACAGGGGAGCAGACAGACAAAGG + Intronic
1078883189 11:15473643-15473665 ACTGAGGACCAGAAATAAGAAGG + Intergenic
1079120528 11:17680935-17680957 ACAGGGGAGAGGAGAGAGGATGG - Intergenic
1079279119 11:19072312-19072334 ACAGAGGAGCAGGAACAGAAGGG - Intergenic
1079804500 11:24912148-24912170 AAAGAGGAGGAAAGAGAGGAAGG - Intronic
1080187100 11:29503072-29503094 AGAGAGGAAGAGAGAGAGGAAGG + Intergenic
1080357958 11:31473379-31473401 ACTGAGGAGCAGAGAGATGAAGG + Intronic
1080652828 11:34236162-34236184 ACAGGGCTGGAGAAAGAGGAGGG + Intronic
1080659506 11:34284669-34284691 AGAGAGGTGGAGAAAGCGGAGGG + Intronic
1080870371 11:36231495-36231517 CCAGAGCACCAGAAAGAAGAAGG - Exonic
1080876131 11:36276006-36276028 ACAAAGGAGGATAAAGGGGATGG + Intronic
1081279449 11:41190236-41190258 ACGGAGGACAAGAGAGAGGAAGG + Intronic
1081462525 11:43285014-43285036 ACAGGGGGGAAGAAAGAGGCAGG - Intergenic
1081471236 11:43372941-43372963 ACAGAGGAATAGAGAGAGGAAGG + Intronic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1082663949 11:55950365-55950387 AAAGAGGAGGAAAAAGAAGAAGG - Intergenic
1082740591 11:56906720-56906742 ACAGAGGAGGAAAAATGGGATGG - Intergenic
1082762088 11:57136891-57136913 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082899281 11:58228216-58228238 GCAGATGAGCAGGAAGGGGATGG + Exonic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1082939385 11:58687933-58687955 ATAGAGCAGTAGAAAGAGAAGGG + Intronic
1083079874 11:60080177-60080199 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1083156742 11:60828047-60828069 ACAGGGGAGCCGAGGGAGGAGGG + Intergenic
1083263258 11:61534504-61534526 CCAGAGGGGCAGGGAGAGGATGG + Intronic
1083546725 11:63554302-63554324 CCAGAGGAGAAGACTGAGGATGG + Intronic
1083874784 11:65516251-65516273 AGAGAGGAGAGGAGAGAGGAGGG + Intergenic
1084026666 11:66454787-66454809 AGGGAAGAGCAGACAGAGGAGGG - Intronic
1084174469 11:67416141-67416163 ACAGAGGGACAGAGAGACGAAGG - Exonic
1084495974 11:69503695-69503717 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1084535343 11:69753152-69753174 AGAGAGGAGCAAACAGAGGCTGG - Intergenic
1084958546 11:72704093-72704115 ACAGGGCAGCAGAAAGACGGGGG + Intronic
1085018256 11:73189343-73189365 ACAGAGGAGGAGAAAAGGGCCGG + Intergenic
1085170193 11:74443283-74443305 ACATAGGAGCAGCCACAGGAGGG - Intergenic
1085810888 11:79680071-79680093 AAGGAGGAGAAGAAAGAGAAAGG - Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086370222 11:86148865-86148887 ACAAGGGAGCAGGGAGAGGAAGG + Intergenic
1086758612 11:90597669-90597691 ACAGAGGAACAGAAATAAAAAGG + Intergenic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1086998907 11:93392948-93392970 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087070735 11:94077784-94077806 AGAGAGGAACAGAATGTGGATGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087198832 11:95325439-95325461 AAAGATGAGCAGAAAAAGAAAGG - Intergenic
1087250216 11:95890537-95890559 AAAGGGGAGCAGAAACAGCAGGG + Intronic
1087402692 11:97687433-97687455 AAAGGGGAGAAGGAAGAGGATGG - Intergenic
1087496498 11:98896946-98896968 GGAGAGGAGGAGACAGAGGAGGG + Intergenic
1087526752 11:99323922-99323944 ACAGAGGAAGAGACAGAGGGAGG + Intronic
1087676504 11:101168764-101168786 CCAGAGGACCAGAACAAGGAAGG - Intergenic
1087875287 11:103348444-103348466 ATAGGGCAGAAGAAAGAGGAGGG - Intronic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088392926 11:109335128-109335150 ACAGACGGGCAGAGACAGGAGGG + Intergenic
1088879295 11:113961005-113961027 CCAGAGGAGGAGGAAGAAGAGGG + Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1088952351 11:114584625-114584647 ACAGAAGAGGAGAAAAATGAAGG + Intronic
1089562718 11:119352956-119352978 ACGGAGGCCCAGAAAGAGGGAGG + Intergenic
1089576470 11:119447867-119447889 GCAGAGGAGCAGAGAAAGGTGGG - Intergenic
1089597612 11:119591130-119591152 ACAGAGAAGAAGGAAGAGAATGG + Intergenic
1089632447 11:119792162-119792184 ACTGAGGAGCCGACAGAGCAAGG - Intergenic
1089657105 11:119956718-119956740 ACGGAGGAGGAGGACGAGGAGGG + Intergenic
1089753993 11:120673062-120673084 GCAGAGGAGGGGATAGAGGATGG - Intronic
1089778424 11:120855929-120855951 AAAGAGGAAGAGAAAGAGGAAGG + Intronic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090186134 11:124740203-124740225 ACCTAGGAGCAGAAAGAAAAGGG + Intronic
1090260102 11:125313246-125313268 AGAAAGGAGCAGACAGAGGGTGG + Intronic
1090269615 11:125376962-125376984 ATAGAGGCCCAGAAAGAGGAGGG - Intronic
1090500498 11:127256216-127256238 TCAAAGGAGGAGAAAGAGAAAGG - Intergenic
1091154566 11:133361349-133361371 ACAGAGCAGGAAGAAGAGGAAGG + Intronic
1091178402 11:133581552-133581574 ACAGAGGAGCAGGAGGCTGAGGG + Intergenic
1091205650 11:133819071-133819093 AGACAGGTGCAGCAAGAGGAGGG - Intergenic
1091214585 11:133892966-133892988 TCAGAGGAGCAGTGTGAGGAGGG - Intergenic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091636285 12:2199334-2199356 ACTGAGGAGGAGGAAGGGGAGGG - Intronic
1091680211 12:2521627-2521649 GCACAGGAGAGGAAAGAGGAAGG - Intronic
1091702698 12:2674352-2674374 ACAGAGGAAGGGGAAGAGGAAGG + Intronic
1091812086 12:3408207-3408229 AGAGAGGATAGGAAAGAGGAAGG - Intronic
1091988664 12:4936415-4936437 AGAGATGAGGAGGAAGAGGATGG - Intergenic
1092210670 12:6644392-6644414 GAAGAGGAACAGGAAGAGGAGGG - Exonic
1092266648 12:6986231-6986253 AAGGAGGAGGAGAAAGAGAAAGG - Intronic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092909639 12:13135582-13135604 ACAGAGGAAAAGAAATTGGAAGG - Intronic
1093007460 12:14065770-14065792 AGAGAGAAGCAGAAAGAGTTAGG - Intergenic
1093090837 12:14918461-14918483 ACAGAGGAGAAGAAAAAGAGGGG + Intronic
1093570742 12:20663323-20663345 ACAGTGGAGCTGTAAGAAGAGGG + Intronic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1094234393 12:28146899-28146921 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1094698214 12:32842600-32842622 GAAGAGGGGCAGAAAGAGAAGGG + Intronic
1094825371 12:34265461-34265483 AGAGAGGAAGAGGAAGAGGAAGG - Intergenic
1095085186 12:38052642-38052664 AGAGAGGAAGAGGAAGAGGAAGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095290377 12:40472817-40472839 AGGGAGGAGGAGGAAGAGGAGGG - Intronic
1095407212 12:41880161-41880183 TCAGAGGAGCAGAAAAGAGAGGG + Intergenic
1095441901 12:42246199-42246221 ACAGAGGAGAAGAGCAAGGAAGG - Intronic
1095466899 12:42497194-42497216 AAGGAGGAGGAGAAAGATGAGGG + Intronic
1095624695 12:44301174-44301196 ACAGAGTAGAAGCATGAGGATGG - Intronic
1095714053 12:45322344-45322366 GCAAAGGAGTAGAGAGAGGAAGG + Intronic
1096152844 12:49325470-49325492 AAAGAGGAGAAGGAAAAGGAAGG - Intronic
1096196882 12:49654319-49654341 CCAGAGAAGCAGCAACAGGAAGG + Intronic
1096383379 12:51177851-51177873 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1096515688 12:52153944-52153966 ACTGAGGTCCAGAGAGAGGAAGG - Intergenic
1096682164 12:53263188-53263210 AATGAGGAGGAGGAAGAGGAAGG + Intergenic
1096814527 12:54193519-54193541 AGAGAGGAGCAGGAATAGGCTGG + Intergenic
1096899484 12:54860164-54860186 ACAGAGGAGTAGAAACGGTAGGG - Intergenic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1097260396 12:57716528-57716550 TCAGAGGAGCAGGATGGGGATGG + Intronic
1097271305 12:57776183-57776205 AAAGAGGCACAGAAAGAGGGAGG - Intronic
1097368249 12:58743302-58743324 ACATGGCAGCAGAAAGAAGAAGG - Intronic
1097541269 12:60946513-60946535 ACAGATGAACAGATAGATGAAGG - Intergenic
1097548070 12:61029857-61029879 AAAGAGGAGGAGGAAGAGGAAGG - Intergenic
1098061041 12:66563001-66563023 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
1098506093 12:71252252-71252274 TCAGAGGAGCAAAAAGAAAAAGG + Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1099491056 12:83288548-83288570 GCTGAAGAGAAGAAAGAGGAGGG - Intergenic
1099726067 12:86429959-86429981 TCAGTGGAGCAGAAAGATAAAGG - Intronic
1099734229 12:86547311-86547333 AAGGAAGAGCAGGAAGAGGAAGG - Intronic
1099805927 12:87518470-87518492 ACAGATGAGCATAAACAGAAGGG - Intergenic
1099811500 12:87588067-87588089 GAAGAGGAGGAGAAAAAGGAAGG + Intergenic
1099999391 12:89814747-89814769 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1100003139 12:89861366-89861388 GAAGAGGAGGAGAAAGAGGAGGG + Intergenic
1100214410 12:92432998-92433020 CCAGAGCAGGAGAAAGAGAAGGG + Intergenic
1100580958 12:95940126-95940148 AGAGTGGGCCAGAAAGAGGAAGG - Intronic
1100604889 12:96143529-96143551 AGGGCAGAGCAGAAAGAGGAAGG + Intergenic
1100698584 12:97121997-97122019 ACAGAGAAGTATAAAGAAGAAGG + Intergenic
1100766744 12:97874600-97874622 GCTGAGGAGGAGAAAGAGGAAGG - Intergenic
1100959926 12:99951345-99951367 ATAGAGGACAAGAAAAAGGAAGG - Intronic
1100997483 12:100318250-100318272 AGAAAGAAGCAGAAAGATGAAGG - Intronic
1101008890 12:100429942-100429964 AGAGAGCAGAAGAAAGAGAAGGG - Intergenic
1101025141 12:100595937-100595959 AAAGAAGAGAAGAAGGAGGAGGG - Intronic
1101214202 12:102564290-102564312 ACAGCTGTGTAGAAAGAGGATGG - Intergenic
1101408750 12:104452417-104452439 ACTGAGGAGCAGCAAGAGGCAGG + Intergenic
1101670497 12:106867376-106867398 ACAGAGGAGCAGAGACAAGGTGG + Intronic
1101736021 12:107463940-107463962 ACAGAGGCCCAGAGAGATGAGGG - Intronic
1101836204 12:108297155-108297177 GCTGAGGAACAGGAAGAGGAGGG - Intronic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101931253 12:109015912-109015934 AAAGAGGAGCAGGTGGAGGACGG + Intronic
1102230337 12:111257516-111257538 AAAGAGGAGGAGAAGGAGGGAGG - Intronic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102426182 12:112846076-112846098 ACAGAGGGGCAGGTAAAGGACGG + Intronic
1102558043 12:113741883-113741905 ACAGAGGAAGAGAGAGAGGGAGG + Intergenic
1102822966 12:115923847-115923869 ACAGAAGAGGAGAAGGAGAAGGG - Intergenic
1103022988 12:117551309-117551331 AAAGAGGAGAAGGAAGAGGCAGG - Intronic
1103044840 12:117727459-117727481 GAAGAGGAGGAGAAAGAAGAAGG + Intronic
1103056040 12:117821336-117821358 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
1103149592 12:118625425-118625447 CCAGAGGAACAGAGAGGGGATGG + Intergenic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103257294 12:119552885-119552907 ACCAAGGAGGAGATAGAGGAGGG - Intergenic
1103923435 12:124411198-124411220 ACAGAGAAATAGAAAGAGGGAGG + Intronic
1105498455 13:20951067-20951089 ACAGAGGAGCACACTGAGGTGGG + Intergenic
1105848951 13:24317828-24317850 ACAGGGGAGCAGCCAGTGGAGGG + Intronic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1106161896 13:27208661-27208683 AAAGAGGAGGAGAAAGAGAAAGG + Intergenic
1106220020 13:27738685-27738707 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106243111 13:27925574-27925596 AAAGAGGAGGAGGAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106798788 13:33234369-33234391 ACAGAGTTACAGGAAGAGGAAGG - Intronic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1106951883 13:34893440-34893462 ACAGAGGAGTAGAAAGTGAATGG + Intergenic
1107043488 13:35972861-35972883 ACAGAGGAGATGAGAGAGAAAGG - Intronic
1107167711 13:37301830-37301852 ACAGAGAAGGAGAAAAAAGATGG - Intergenic
1107250693 13:38357846-38357868 ACTGAGGAGAAGGAAGAGGAAGG + Intronic
1107362612 13:39636671-39636693 ACAAAGGAGAAGGAGGAGGAGGG - Intergenic
1108000438 13:45901099-45901121 ACAGAGGGACACAAAGATGAGGG + Intergenic
1108392090 13:49956508-49956530 AGAAAGAAGAAGAAAGAGGAAGG - Intergenic
1108705721 13:52983960-52983982 ACAGAAGACAAGAATGAGGAAGG - Intergenic
1108828043 13:54440201-54440223 GAAGAGGAGGAGAAAGAGGGAGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109154541 13:58889980-58890002 GCAGAGAAGAAGAAAGTGGAGGG + Intergenic
1109481882 13:62965486-62965508 ACAGAGGTGGAAAAAGAGAAAGG + Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1109781445 13:67115415-67115437 ACCCAGGAGCAGAAGGATGAAGG + Intronic
1110279460 13:73675937-73675959 ACAGAGGGGCAGAGAGTGGCAGG + Intergenic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1110350716 13:74504110-74504132 AGAGAGGAGCAGTAAGCAGATGG + Intergenic
1110441033 13:75525324-75525346 ACAGGGAAGGGGAAAGAGGAAGG + Intronic
1110640819 13:77821761-77821783 AGAGAGGAGCTGAAAGAACAAGG - Intergenic
1111447079 13:88360848-88360870 ACAGGAGAGCAGAGTGAGGAGGG - Intergenic
1111518868 13:89373060-89373082 TCAGAGGGGAAGAAAGAGAATGG + Intergenic
1111802470 13:92997348-92997370 ACAGAGGAGGGGAAACAGGAAGG - Intergenic
1111956121 13:94760478-94760500 AAAGAGGAAGAGAAGGAGGAAGG - Intergenic
1112109984 13:96285864-96285886 AGAGAGGAAAAGAGAGAGGAAGG - Intronic
1112112829 13:96321692-96321714 ACAGAGGAGCAGGAACATCAAGG - Intronic
1112284645 13:98093554-98093576 GCAGAGGAGCAGAAAGAAGGAGG - Intergenic
1112568978 13:100576770-100576792 ACAAAGGGGCAGAATGAGGGAGG + Intronic
1112584511 13:100706311-100706333 AAAGAGAAGAAGAAAGAGAAGGG - Intergenic
1113438215 13:110308918-110308940 AGACAGGAGCTGAAAGCGGAGGG + Intronic
1113565587 13:111317822-111317844 ACAGAGGTGAAGAAGGAGCAAGG - Intronic
1113673939 13:112195655-112195677 AAAGAGGAAGGGAAAGAGGAAGG - Intergenic
1113983488 13:114295583-114295605 TCAGAGACGCAGGAAGAGGAGGG - Intronic
1114045458 14:18871745-18871767 ACAGAGAAAGAGAAAGAGAAAGG + Intergenic
1114118754 14:19647723-19647745 ACAGAGAAAGAGAAAGAGAAAGG - Intergenic
1114127288 14:19743704-19743726 ACAGAGGAGCAGGAAGGGGAGGG - Intronic
1114231326 14:20785644-20785666 AAAAAGGAGGAGGAAGAGGAGGG + Intergenic
1114253948 14:20985824-20985846 AAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114441135 14:22748921-22748943 ACGGAGGGGCACCAAGAGGAGGG + Intergenic
1114522671 14:23348729-23348751 AGAGAGAAGAAGAAAGAGGGAGG + Intronic
1114632252 14:24166664-24166686 GCAGAGGAGAGGAAAGAGGCTGG - Exonic
1115345835 14:32342587-32342609 AAAGAGCAGCAGAAAGATCATGG - Intronic
1115794368 14:36916871-36916893 ACAGAGGAGCAGATTTAGGGTGG - Intronic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117033700 14:51704629-51704651 AGGGAGGAGCAGAAACAGAAGGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117334126 14:54742321-54742343 ATAGAGGAGGAGAAATAGAATGG + Intronic
1117471920 14:56054882-56054904 ACAGAGGAGAAGGCAGAGAAAGG - Intergenic
1117661564 14:58011201-58011223 ACTGAGAAGCAGAAATAGTAAGG + Intronic
1117828583 14:59727719-59727741 ACAGATGGACAGAGAGAGGAGGG + Intronic
1117960998 14:61161419-61161441 AAAGAGGAAAAGAAAGAGGCAGG + Intergenic
1118388175 14:65274076-65274098 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1118459571 14:65976093-65976115 GAAGAGGAGGAGAAGGAGGAAGG + Intronic
1118465097 14:66023668-66023690 ACAGAGGAGAAGGAAGATGGAGG - Intergenic
1118468645 14:66054683-66054705 TCAGAGCAGCAGGAAGAGAAAGG - Intergenic
1118656387 14:67954499-67954521 CCAGAGGAGAAGACAGATGAAGG + Intronic
1118767750 14:68921559-68921581 AAAGAGGAGGAGGAAGAGGAAGG + Intronic
1118821204 14:69347255-69347277 ACAGAGGAGGAGAATGAGTAGGG - Intronic
1118896194 14:69947645-69947667 CAAGAGGAGAAGAGAGAGGAGGG - Intronic
1119017698 14:71076515-71076537 CCAGAAGATCAGAAAGAGGAAGG - Intronic
1119346025 14:73925269-73925291 AAAATGGAGGAGAAAGAGGAAGG - Intronic
1119420735 14:74506394-74506416 ACAGAAGTGCACAAAGAGGAAGG + Intronic
1119483955 14:74976297-74976319 AGAGAGGAGGAGCAAGGGGAAGG - Intergenic
1119573757 14:75699721-75699743 AAAGAGGAAAGGAAAGAGGAAGG - Intronic
1119629162 14:76211187-76211209 ACAGAGGAACAAAGAGAGAAAGG + Exonic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1119967819 14:78936518-78936540 CTAGAGGAGCAGGGAGAGGAAGG + Intronic
1120067712 14:80063386-80063408 GGAGAAGAGAAGAAAGAGGAAGG - Intergenic
1120169458 14:81234339-81234361 ACAAAGGTGCAGACAGAGGCAGG - Intergenic
1120179191 14:81325839-81325861 ACAGAGGGGCAGACTGAGAAGGG + Intronic
1120707904 14:87763320-87763342 CCAGAGCAGGAGAAAGAGGTGGG + Intergenic
1120708026 14:87764724-87764746 CCAGAGCAGGAGCAAGAGGAAGG + Intergenic
1121118052 14:91357532-91357554 ACAGTGGAGGAGCAAAAGGAGGG - Intronic
1121118063 14:91357580-91357602 ACAGTGGAGGAGCAAAAGGAGGG - Intronic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121301725 14:92877184-92877206 AGAAAGGAAAAGAAAGAGGATGG - Intergenic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121542968 14:94742294-94742316 ACAAAGGAGTAGGAAGAGGAGGG + Intergenic
1121550097 14:94792834-94792856 AGAGAGAAAGAGAAAGAGGAAGG + Intergenic
1121662108 14:95642805-95642827 TCAGAGCAGGAGAAAGAGGCAGG - Intergenic
1121729584 14:96176949-96176971 ACAGAGGAGCAGGAGGAAGAGGG + Intergenic
1121919087 14:97863930-97863952 ACTGAGGAGGAGAATCAGGATGG + Intergenic
1122123778 14:99568421-99568443 ACAGAGGTTCTGAGAGAGGAAGG - Intronic
1122181228 14:99956188-99956210 ACAGAGGCTCAGGGAGAGGAAGG + Intergenic
1122322220 14:100861970-100861992 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1122448133 14:101782873-101782895 GCAGAGGGGGAGAAAGAGGGAGG - Intronic
1122861747 14:104585633-104585655 AGAGAGAATCAGAGAGAGGAAGG + Intronic
1123434989 15:20248040-20248062 ACAGAGGGGAGGGAAGAGGAGGG + Intergenic
1123570744 15:21605343-21605365 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123606857 15:22040696-22040718 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123776728 15:23588045-23588067 AATGAGGAGCAAACAGAGGAGGG - Intronic
1124153108 15:27199976-27199998 AGAGAGGAGTAGAGGGAGGAAGG - Intronic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124465111 15:29931249-29931271 GCAGAGGAGGAGGAAGAGGAGGG + Intronic
1124654742 15:31499126-31499148 ACAGAGGAGGAGGAAGTGGGTGG + Intronic
1124701147 15:31913355-31913377 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1125152370 15:36547252-36547274 AGAGAGGAGCAGAAAAAAGAAGG + Intergenic
1125202547 15:37112644-37112666 ACAGAGGAGCAGACAGATTGGGG + Intergenic
1125581218 15:40787408-40787430 ACTGAGGAGCAGAAGGAAGTAGG + Intronic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126292589 15:47099375-47099397 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1126362794 15:47863557-47863579 AAAGAGGAGAAGGAAGAGGAGGG + Intergenic
1126419743 15:48459028-48459050 ACAGAGGCCCAGAGAGGGGAAGG - Intronic
1126547116 15:49885887-49885909 GCAGATGAGAAGTAAGAGGATGG - Intronic
1126718789 15:51553604-51553626 AGAGAGGAGGAAGAAGAGGAGGG - Intronic
1126915111 15:53457716-53457738 GCTGAGGAGGTGAAAGAGGAAGG + Intergenic
1126951240 15:53884198-53884220 ACTGTGGAGCAGGAAGACGAAGG + Intergenic
1126963314 15:54023192-54023214 TCAGAGGAGCAAAACAAGGAAGG + Intronic
1127031554 15:54870032-54870054 TCAGAGGAGCTGAAAAAAGAGGG + Intergenic
1127205969 15:56719378-56719400 AGAGAGGAAGCGAAAGAGGAGGG - Intronic
1127265452 15:57357210-57357232 GCTGAGGAGGAGAAAGAAGAGGG - Intergenic
1127423064 15:58827404-58827426 AAAGAGGAGAAGGAAGAGAAGGG - Intronic
1127596213 15:60485103-60485125 TCAGAGGAGTAGAGAGAGAATGG + Intergenic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128095569 15:64951535-64951557 AAAGAAGAGAAGAAAGAAGAGGG - Intronic
1128112418 15:65085136-65085158 ACAGAGCAGCAGCAAAAGGTGGG + Intergenic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1128304164 15:66587049-66587071 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1128304189 15:66587127-66587149 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1128449136 15:67792004-67792026 ACAGAGCACCAGGCAGAGGAGGG + Intronic
1128629821 15:69253216-69253238 ACAGAGCATGAGAAAGACGAAGG + Intronic
1128706470 15:69840712-69840734 ACAGAGGTTCAGAAAGATTAAGG - Intergenic
1128799651 15:70489463-70489485 ACAGGGGAGAAGAAAGAGAGGGG - Intergenic
1128918981 15:71593559-71593581 ACAGAAGAGCAGGAACAGGTAGG - Intronic
1128935872 15:71746097-71746119 ACAGAGCAGATGACAGAGGAGGG + Intronic
1129525005 15:76208261-76208283 GCAGAGGAGCAGCCAGAGGGAGG + Intronic
1129595353 15:76959575-76959597 ACAGAGGAGGAAAGAGATGAGGG - Intergenic
1130018096 15:80202672-80202694 ACAGAGGAATAGACTGAGGAGGG + Intergenic
1130572687 15:85062559-85062581 ACAGAGGTGCAGACAAAGAAGGG - Intronic
1130773090 15:86944583-86944605 ACAGTAGAACTGAAAGAGGAAGG + Intronic
1130921574 15:88350214-88350236 AGAGAGGAAAAGAAAGAGGGTGG + Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130997332 15:88911275-88911297 ACACAGGAGAAGGAACAGGAGGG + Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131014203 15:89043697-89043719 GGAGAGGAGGAGGAAGAGGAGGG + Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131135514 15:89931906-89931928 GCCGAGGAGGAGGAAGAGGAGGG + Intergenic
1131312583 15:91304412-91304434 AGAGAGGGAGAGAAAGAGGAAGG + Intergenic
1131457810 15:92597058-92597080 AAAGAGGAGCAGACAAAGGCAGG - Intergenic
1131646316 15:94348964-94348986 ACAGACAAGCAGATAGAGGTAGG - Intronic
1131651048 15:94400092-94400114 AGAGAGGAGGAGTAAGAGGGAGG - Intronic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1131901113 15:97088690-97088712 AAGGAGGAGGAGGAAGAGGAAGG - Intergenic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1202979097 15_KI270727v1_random:332466-332488 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1132635199 16:941148-941170 ACAAATGAGTTGAAAGAGGAAGG - Intronic
1132682110 16:1146632-1146654 ACAAAGGCTCAGAAAGAGGGAGG - Intergenic
1132845685 16:1999879-1999901 ACACAGGAGGAGGAGGAGGACGG - Exonic
1133169742 16:3974843-3974865 ACAGATGTGAAGAAAGAGGTGGG - Intronic
1133190243 16:4128369-4128391 ACAGAGGCACAGAAGGAAGATGG + Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133304454 16:4800801-4800823 AAAGAGGTGAAGAAAGGGGAAGG + Intronic
1133712471 16:8414597-8414619 GAAGAGGAGCAGACAGAGAAGGG - Intergenic
1133778066 16:8913440-8913462 ACAGATGAACAGAAAGAGTAAGG + Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133926935 16:10200862-10200884 ACTGAGGAGCAGCCAGAGGAGGG + Intergenic
1134008947 16:10836925-10836947 ACAGAGAAGAAGCAAGAGTAGGG - Intergenic
1134105585 16:11483969-11483991 ACAGAGGAGAAGCAGGAGGAAGG + Intronic
1134289234 16:12890419-12890441 AAAGAGGAGCAGAAAGAGTTGGG - Intergenic
1134467978 16:14495811-14495833 ACAGAGGCACAGAAGGAGGGAGG + Intronic
1134615891 16:15650687-15650709 AAGGAAGAGGAGAAAGAGGATGG - Intronic
1134907437 16:17992790-17992812 ACAGAGAAGAAGAAACAAGAAGG + Intergenic
1135100654 16:19602500-19602522 AGAGAGGAGGAGAGAGAGGGAGG - Intronic
1135109258 16:19677973-19677995 ACTGGGGTGCAGAAAGATGAAGG + Intronic
1135133619 16:19872105-19872127 CCAGATGAGCACAGAGAGGAAGG + Exonic
1135147753 16:19977813-19977835 ACTGAGGAGGAGGAAGAGGAGGG - Intergenic
1135287984 16:21210470-21210492 ACAGTGGAGCAGATGGAGGCAGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135462777 16:22659612-22659634 ACAGAGCAGGACAAGGAGGAAGG + Intergenic
1135516880 16:23143555-23143577 ACAGAGAAGGAGAAAGAGAGAGG + Intronic
1135521512 16:23182183-23182205 AAAGAGGAAAAGAAAGAAGAAGG + Intergenic
1135600572 16:23779943-23779965 ACAGAGGAGCACAGAAAGGTAGG - Intergenic
1135682555 16:24470556-24470578 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1135932172 16:26747565-26747587 AAAGAGTAGTAGAAAGAGCAGGG - Intergenic
1136134993 16:28250488-28250510 AAAGTGGAGCAAGAAGAGGATGG - Intergenic
1136375592 16:29863314-29863336 GCAGAGGAGGAGAGGGAGGAAGG + Exonic
1136458241 16:30394663-30394685 TCCGAGGAGCAGTAAGAGGCTGG - Intronic
1136556883 16:31012116-31012138 ACGGAGGTGCAGAAAGATGCAGG - Intergenic
1136849630 16:33602944-33602966 ACAGAGGGGAGGGAAGAGGAGGG - Intergenic
1136849647 16:33602994-33603016 ACAGAGGGGAGGGAAGAGGAGGG - Intergenic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1137367489 16:47873402-47873424 ACAGAGAGAAAGAAAGAGGAAGG - Intergenic
1137378996 16:47980586-47980608 AGAGAGGAGCAGAGTTAGGAAGG - Intergenic
1137400295 16:48147604-48147626 ACAAAGGCCCAGAGAGAGGAAGG + Intronic
1137404084 16:48176430-48176452 AAAGAGGAGGAGACAGAGGCTGG + Intronic
1137468227 16:48730584-48730606 AAAGAGCAGCAGAAAGAGGGCGG - Intergenic
1137521214 16:49196882-49196904 ACTGAGGAGCAGAGAGGGAAAGG - Intergenic
1137977285 16:53042398-53042420 ACAGAGGAAGAGAGGGAGGAGGG - Intergenic
1138208876 16:55146199-55146221 TCAGAGAAGAAGAGAGAGGAGGG - Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1138541602 16:57691055-57691077 AAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1138547109 16:57726444-57726466 TCAGAGGAGCTCAAAGAGAAGGG - Intronic
1138633797 16:58320400-58320422 AGAGAGGAAAAGCAAGAGGAGGG + Intronic
1138890450 16:61137691-61137713 GCTGAGGAGTAGGAAGAGGAGGG - Intergenic
1139160767 16:64506192-64506214 AAAGATGAGCAGCAAGAGAAAGG - Intergenic
1139312734 16:66040916-66040938 AAAGGGGAGGAGAAAGAGAAGGG + Intergenic
1139325560 16:66150198-66150220 AGACAGGAGCAGGGAGAGGAGGG - Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139478925 16:67217577-67217599 ACAGATGAGTAAAAAGAGGCTGG - Intronic
1139597476 16:67966808-67966830 TAAGAGGAGGAGAAAGAGGAAGG + Intronic
1139799542 16:69510601-69510623 ACAGAGGAACAGGAAAAGGGTGG + Intergenic
1139868125 16:70080073-70080095 ACTGGGGAGAAGAAAGAGAAGGG - Intergenic
1140387210 16:74551780-74551802 ACTGGGGAGAAGAAAGAGAAGGG + Intronic
1140889169 16:79270506-79270528 TCAGAGGAGCAGAGAGATGATGG - Intergenic
1141000229 16:80300860-80300882 AAAGAGGAGAAGGAAGAGGAGGG - Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141235431 16:82211517-82211539 CCAGAGCAGGAGAAAGAGGTGGG + Intergenic
1141263677 16:82476242-82476264 GCAGAGGAGGAGAAGGAGGGAGG - Intergenic
1141713982 16:85716517-85716539 ACAGGGGAGAAGGAAGAGGAGGG + Intronic
1141835267 16:86534529-86534551 ATAGAGGTGTAGAAAGAGGTTGG - Intronic
1141845101 16:86603311-86603333 AAAGAGGAGGAGGAAGAAGAGGG - Intergenic
1141891752 16:86930858-86930880 GAAGAGGAGGAGAAGGAGGAGGG - Intergenic
1141991244 16:87611632-87611654 ATAGAGCAGCAGACAGAGGCGGG - Intronic
1142243857 16:88959492-88959514 ACAGAGGTGCAGGCAGAGGCAGG + Intronic
1142626252 17:1194059-1194081 TCAGTAGAGGAGAAAGAGGATGG - Intronic
1142875303 17:2848894-2848916 ACAGAGGAGGGGGAAGAGGGAGG - Intronic
1142899577 17:3003828-3003850 AGAGAGGCGCACAATGAGGATGG + Intronic
1143124204 17:4631357-4631379 AAAGAGGAAGAGAGAGAGGAAGG + Exonic
1143224206 17:5286850-5286872 ACAGAGCAGGAGAAAGGGAAGGG + Intronic
1143250066 17:5516814-5516836 ACAGTGTAGTGGAAAGAGGATGG - Intronic
1143278560 17:5732679-5732701 AGAGAGGAAAAGAGAGAGGAAGG - Intergenic
1143297314 17:5880970-5880992 ACCAGGGAGCAGAAAGAAGACGG - Intronic
1143337117 17:6179668-6179690 ACAGATTCCCAGAAAGAGGATGG + Intergenic
1143369741 17:6431597-6431619 ATAGAGTAGCAGACAGAAGACGG + Intronic
1143391302 17:6560845-6560867 AAAGAGGAGGAGGAAAAGGAGGG - Intergenic
1143391407 17:6561209-6561231 GGAGAGGAGGAGGAAGAGGAGGG - Intergenic
1143409967 17:6702886-6702908 GCAGAGGAGCAGAGAGAGGTGGG + Intronic
1143564539 17:7713620-7713642 ACAGAGGAACAGCAAGTGCACGG + Intergenic
1143767585 17:9147757-9147779 ACAGAGGATAAGACAGGGGATGG - Intronic
1143830798 17:9648836-9648858 AAAGAGAAACAGAAAGAGAAAGG - Intronic
1143902630 17:10185508-10185530 ACAGATGAACAGCCAGAGGAAGG - Intronic
1143963451 17:10739084-10739106 ACAGAGGAACGGAGAGAGGAAGG - Intergenic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144409297 17:14985002-14985024 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1144580459 17:16456149-16456171 GGAGAGGAGGAGGAAGAGGAGGG + Intronic
1145279652 17:21458086-21458108 ACTGAGGAGAAGACAGAGCAGGG + Intergenic
1145398226 17:22512396-22512418 ACTGAGGAGAAGATAGAGCAGGG - Intergenic
1146144495 17:30401271-30401293 AAAGAGGAGGAGAAGGAAGAAGG - Intronic
1146178137 17:30679669-30679691 ACAGAGGAGCAGGAAGGAGGGGG + Intergenic
1146515474 17:33485924-33485946 ACAGTGGACCAGACAGAGCAGGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146579372 17:34023236-34023258 GAAGAGGAGAAGAAAGAGAAAGG - Intronic
1146637284 17:34515733-34515755 AAAGAGAAGCTGAAAGAGAAAGG - Intergenic
1146669695 17:34728475-34728497 AGAGAGGAGGGGAGAGAGGAGGG + Intergenic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1147155938 17:38544538-38544560 ACAGAGAATCAGAGACAGGAAGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147307041 17:39571171-39571193 ACTGAGGGGCTGAAACAGGAAGG - Intergenic
1147424250 17:40338290-40338312 ACAGAGGAGGAGGAGGAAGAAGG - Intronic
1147515533 17:41114272-41114294 AAAGCGGAGCTGAAAAAGGATGG - Intergenic
1147524433 17:41207361-41207383 GAAGAGGAGGAGGAAGAGGAGGG + Intronic
1147526651 17:41231167-41231189 GCAGAGCAGCAGACAGAGAAAGG - Intronic
1147791205 17:43015284-43015306 ACAGGGGAGGAGAAGGAGGTGGG + Exonic
1148189337 17:45667729-45667751 ACAGAGGTAGAGAAGGAGGATGG - Intergenic
1148804299 17:50256581-50256603 GAAGAGGAGGAGAAAGAAGAAGG + Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1148862220 17:50610321-50610343 TGAGAGGAGCAGAGAGGGGAAGG + Intronic
1149068003 17:52503344-52503366 ACAGAGGAGAAGAAAGACAAAGG + Intergenic
1149107088 17:52982606-52982628 AAAGGGGAGGAGAAGGAGGAGGG - Intergenic
1149530315 17:57389882-57389904 ACAGAAGAGCAGAAGGAGCCTGG - Intronic
1149630107 17:58115492-58115514 ACAGAGGAGCATAGAGAGGAAGG - Intergenic
1150015356 17:61551682-61551704 AGAGAGGGAAAGAAAGAGGAAGG - Intergenic
1150705049 17:67478924-67478946 ACAGAGGAGAACAGAGAGGCTGG - Intronic
1150833291 17:68542182-68542204 AGAGAGGAGGAGTAAGTGGAGGG + Intronic
1151023902 17:70654805-70654827 ACAGATGTGCAGAGAGAGAAAGG - Intergenic
1151351383 17:73534080-73534102 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1151355771 17:73557636-73557658 AGAGAGGAGGAGGAGGAGGATGG - Intronic
1151430763 17:74060970-74060992 AGAGGAGAGCAGAAAGAAGAAGG - Intergenic
1151507190 17:74537130-74537152 CAAGAGGAGGAGGAAGAGGAAGG + Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151815876 17:76471167-76471189 AGGTAGGAGGAGAAAGAGGAAGG + Exonic
1151871704 17:76841207-76841229 ACAGAGAGGCAGAGAGAGGTGGG - Intergenic
1152052003 17:77986794-77986816 ACAAATGAGCAGAGACAGGAAGG + Intergenic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152630323 17:81408083-81408105 ACACAGGGGCAGCAGGAGGAAGG - Intronic
1152785689 17:82246783-82246805 TGAGAGGAGCAGAAAGAACAGGG + Intronic
1153285226 18:3450211-3450233 ACAAAGGAGCGGAGAGGGGAGGG + Intronic
1153299890 18:3583229-3583251 ACAGAGGGACAGAGAGAGAAAGG - Intronic
1153610021 18:6874855-6874877 ACAGAGCAGCCCAAAGAGGCTGG + Intronic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1153951710 18:10063047-10063069 ACAGAGGGAGAGAGAGAGGAGGG - Intergenic
1154213012 18:12396026-12396048 AGAGAGGTCCAGAAAGATGAGGG + Intergenic
1155076779 18:22364306-22364328 GCAGAAGAGGAGGAAGAGGAGGG - Intergenic
1155354980 18:24943287-24943309 AGGGAGGAAAAGAAAGAGGAAGG + Intergenic
1155365836 18:25048157-25048179 ATAGAGGAGCTGGAGGAGGATGG + Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155618707 18:27750989-27751011 ACAGGCGAGCAAAAATAGGAAGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155706712 18:28824362-28824384 ACAGAGGAACAGACTCAGGATGG - Intergenic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1155896682 18:31337880-31337902 AAGGAGGAGCAGAAACAGGGGGG + Intronic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156117088 18:33798547-33798569 ACAGAGGACCAGAGAAATGAAGG + Intergenic
1156368509 18:36451604-36451626 CCGGAGGAGAAGGAAGAGGAGGG - Intronic
1156486267 18:37467561-37467583 ACAGGGGAGCAGGCAGAGGAGGG + Intronic
1156625582 18:38903663-38903685 GCTGAGGAGCAGGCAGAGGATGG - Intergenic
1156659341 18:39328221-39328243 TAAGAGGAGATGAAAGAGGAAGG - Intergenic
1156670028 18:39457524-39457546 ATATAGGAACAAAAAGAGGAAGG + Intergenic
1156966188 18:43096089-43096111 ACATTGGAGTAGAAAAAGGAAGG + Intronic
1157445418 18:47742971-47742993 ACAGGGGAGGAGATGGAGGAAGG + Intergenic
1157445520 18:47743760-47743782 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
1157579344 18:48764438-48764460 ACAGAGGTGCAGAAAGTAGAGGG - Intronic
1157957228 18:52111991-52112013 CCAGAGCAGGAGCAAGAGGATGG + Intergenic
1158442133 18:57485690-57485712 ACAAAGAAGCAAAGAGAGGAAGG + Exonic
1158450443 18:57559258-57559280 AGAAAGGAGGATAAAGAGGAAGG + Intronic
1158669935 18:59465327-59465349 AGAGAGAAGAAGAAAGAGAAAGG - Intronic
1158761152 18:60388681-60388703 AAAGAAGGGAAGAAAGAGGAGGG - Intergenic
1158848586 18:61470858-61470880 AAAGAGGAGAAGATAGAAGAAGG - Intronic
1159079793 18:63724254-63724276 ACAGAGGAGGAGGAGGAGGAAGG - Intronic
1159541485 18:69782885-69782907 ACAGAGAGGGAAAAAGAGGATGG - Intronic
1159633969 18:70782907-70782929 AGAGAGGAAGAAAAAGAGGAAGG - Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160521128 18:79508758-79508780 ACAGAGAAACAGAGCGAGGAAGG - Intronic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1160701824 19:511237-511259 AGGGAGGAGGAGGAAGAGGAAGG - Intronic
1160822562 19:1065312-1065334 ACCGAAGAGCAGAAGGAGGCAGG + Exonic
1160996379 19:1883983-1884005 GCAGAGGAGCAGAGGCAGGAAGG - Intronic
1161042009 19:2115326-2115348 CAAGAGGAGGAAAAAGAGGAAGG - Exonic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1161865971 19:6832474-6832496 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
1161902846 19:7132327-7132349 AGAGAGGAGGAGAAGGAGGGTGG + Intronic
1161918733 19:7250327-7250349 AGAGAGAAAAAGAAAGAGGAGGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162108873 19:8389499-8389521 AAAGAATAGCAGAAAGTGGACGG + Intronic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162722714 19:12672065-12672087 GCAGAGGAGGAGGAAGAGGAGGG + Intronic
1163092996 19:15034291-15034313 ACAAAGGATCAAAAGGAGGAAGG + Intergenic
1163163912 19:15482321-15482343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1163229974 19:15994869-15994891 ACATGGCAGCAGCAAGAGGAAGG - Intergenic
1163351107 19:16777311-16777333 AAAGGGGAGGGGAAAGAGGAGGG + Intronic
1163381051 19:16969022-16969044 ACAGAGTAAAAGGAAGAGGAGGG + Intronic
1163445879 19:17346253-17346275 GGAAAGGAGGAGAAAGAGGAGGG + Intergenic
1163538627 19:17893433-17893455 GCAGAGAAGCAGAGAAAGGAGGG + Intronic
1163640342 19:18458448-18458470 ACAGAGGAGAGGAAAGAGGATGG + Intronic
1163712028 19:18852646-18852668 AGGGAGGGACAGAAAGAGGAGGG - Intronic
1163712036 19:18852670-18852692 AGGGAGGGACAGAAAGAGGAGGG - Intronic
1163776981 19:19224627-19224649 AAAGAGGATCAGAGAGAGGAAGG - Intronic
1164234901 19:23323370-23323392 AGAGAGTAGGAGGAAGAGGAAGG - Intronic
1164324770 19:24181446-24181468 ACAGAGGAGAAAAAGGGGGAGGG + Intergenic
1164496999 19:28775179-28775201 ACAGAAGACCAAAAAGAGCAGGG + Intergenic
1164546283 19:29166392-29166414 ACAGAGCAGAGGAAAGAGCATGG + Intergenic
1164718454 19:30412667-30412689 AAAGAGGAGAAGAAGGAGAAGGG - Intronic
1164921892 19:32094470-32094492 GAAGAGGAAGAGAAAGAGGAAGG + Intergenic
1165069753 19:33248494-33248516 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166139126 19:40796556-40796578 ACAGGTGAGCTGAAAGAGAAGGG - Exonic
1166209945 19:41300032-41300054 ACAGAGGAGCAGGCTGAGGCTGG + Intronic
1166228700 19:41413066-41413088 ACAGTGAAGCAGAGAAAGGATGG - Intronic
1166516883 19:43453868-43453890 ACTGAGGCACAGAAAGATGATGG + Intergenic
1166635995 19:44452402-44452424 AGAGAGGAGCAGGAGGAGCACGG + Intergenic
1166668169 19:44694088-44694110 AATGAGGTGCAGAGAGAGGAAGG + Intergenic
1166672452 19:44719035-44719057 GAAGAGGAGAAGAAAGAGGAAGG + Intergenic
1166797506 19:45436160-45436182 ACTGAGGCTCAGAGAGAGGATGG - Intronic
1166913628 19:46179058-46179080 GGAGAGGAGGAGAAAGAGGCAGG + Intergenic
1166962179 19:46504152-46504174 AGAGAGGAGCAGAAAGACAACGG - Intronic
1166963044 19:46511106-46511128 ACACAGGAGCAGAGAGCAGAAGG + Intronic
1167084597 19:47300660-47300682 ACAGAGAAAGAGAGAGAGGAGGG - Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167151936 19:47715268-47715290 ACACAGGGGCACAAAGAGGAGGG - Intronic
1167203138 19:48081421-48081443 TCAGAGATTCAGAAAGAGGAGGG + Intronic
1167259703 19:48451386-48451408 ACTGAGGCTCAGCAAGAGGAAGG + Intronic
1167295217 19:48645672-48645694 ACAGAGGAGCTGAGAGAGGGGGG - Exonic
1167631080 19:50626581-50626603 ACAGAGGCCCAGAAAGAGAGGGG + Intronic
1167639601 19:50673380-50673402 ACAGAGGAGAAGGAAGAGGTGGG - Intronic
1167690232 19:50980568-50980590 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167690240 19:50980594-50980616 ACAGAGACACAGAGAGAGGAGGG + Intronic
1167690267 19:50980710-50980732 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167690281 19:50980762-50980784 ACAGAGACACAGAGAGAGGAGGG + Intronic
1167752699 19:51390424-51390446 ACAGAGACCCAGAGAGAGGAGGG - Intronic
1167980810 19:53273223-53273245 ACAGGGGAGATGAAGGAGGAGGG + Intergenic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
1168473712 19:56661096-56661118 AGAGAGCAGCAGAAAGAGCTGGG - Intergenic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925034941 2:677607-677629 ACAGAGGAGCAGGCGGAGGCGGG + Intergenic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925189490 2:1871371-1871393 ACTGAGGAGCAGAGATAGGAGGG - Intronic
925381705 2:3432336-3432358 ATAGAGGAGCAGACAGCTGATGG - Intronic
925404065 2:3594752-3594774 TCAAAAGAGCATAAAGAGGAGGG - Intergenic
925443338 2:3907142-3907164 AAAGAGGAGAAGAAAGAGTAAGG - Intergenic
925607618 2:5674384-5674406 ACAGAGAAGCAGAAAAGGAATGG - Intergenic
925645014 2:6027040-6027062 ACAGAAAGGCAGAAAGAGAAAGG - Intergenic
925651427 2:6093687-6093709 GAAGAGGAGAAGAAAGAGGTTGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
926269255 2:11352823-11352845 ACAGGTGGTCAGAAAGAGGATGG + Intergenic
926546892 2:14252676-14252698 AAGGAGGAGGAGTAAGAGGAAGG - Intergenic
926629268 2:15122081-15122103 AAAGAGGAGGTGGAAGAGGATGG + Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
927681079 2:25139437-25139459 ACAGAGGGGCAGGAAGTGGAGGG - Intronic
927803572 2:26123961-26123983 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
928347269 2:30511813-30511835 CCAGAGGTGCAGAGAGAGAAGGG + Intronic
928374206 2:30761851-30761873 ACAGATGGGTAGAGAGAGGAAGG + Intronic
929066710 2:37983072-37983094 AAAGAAGAGAAGGAAGAGGAGGG - Intronic
929161422 2:38836321-38836343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
929284011 2:40115310-40115332 CCATAGGAGCACAAAGAGGCAGG + Exonic
929456744 2:42071581-42071603 ACAGAGAAGAAGAAAGGAGAGGG - Intergenic
929931348 2:46258509-46258531 AGAGAGAAGGAGGAAGAGGAGGG + Intergenic
929961585 2:46500450-46500472 AGAAAGGAGGAGAAAGAGGGAGG + Intronic
930057926 2:47266108-47266130 ACAAAGGAGAAGGAAGTGGATGG + Intergenic
930417797 2:51110936-51110958 AAAGAAGACCAGAGAGAGGAAGG - Intergenic
930517351 2:52424604-52424626 AGAGATGAGGAGGAAGAGGAGGG + Intergenic
930909618 2:56616248-56616270 AAAGAGGGGATGAAAGAGGAAGG - Intergenic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931078007 2:58737929-58737951 AGAGAGGAAGAGAAAGAGAAAGG + Intergenic
931125973 2:59276644-59276666 ACCCAGGAGCAGGAAGAGGGAGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931513152 2:63022297-63022319 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
931627453 2:64269832-64269854 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
931903659 2:66819925-66819947 GCGGAGGAGGAGGAAGAGGAGGG + Intergenic
931928743 2:67105066-67105088 AAAGAAGAGCAGATATAGGAAGG + Intergenic
932170001 2:69545959-69545981 ACTGAGCACCAGAAAGAGGAAGG + Intronic
932323196 2:70837042-70837064 AAAGAGGAGAGGAAAGAGGGAGG + Intergenic
932336975 2:70937231-70937253 ACAGAGGAACAGAGGGAGGTGGG - Intronic
932909327 2:75789323-75789345 AGAGAGGAAGAGAAAGAAGAAGG - Intergenic
933338319 2:80988227-80988249 ACAGAGGAGACAAAAGAGAAAGG + Intergenic
933368082 2:81380135-81380157 AGAGAGCAGCAGAGAGAGAATGG + Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
934104005 2:88679696-88679718 GCAGAAGAGGAGAAAGATGAAGG - Intergenic
934128044 2:88917526-88917548 AAAGAGTAGAAGACAGAGGATGG - Intergenic
934478019 2:94605755-94605777 CCAGAGGAGGAGACAGAGCAGGG + Intergenic
934605578 2:95692706-95692728 ACAGAGGAGAAGAAACAGGCAGG + Intergenic
934885467 2:98020807-98020829 ACAGACACGCAGAAAGAAGATGG - Intergenic
935951131 2:108329892-108329914 ATAGAGTAACAGAAAGAGCATGG - Intergenic
936039750 2:109141236-109141258 ACAGAGGGGAAGAGTGAGGAAGG - Intronic
936485369 2:112920908-112920930 ACAGACTAGCAGAAAGGAGATGG + Intergenic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936539043 2:113335246-113335268 ACAGAGGAGAAGAAACAGGCAGG + Intergenic
936666716 2:114605347-114605369 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
936832824 2:116669801-116669823 GAAGAGGAGGAGAAGGAGGAAGG - Intergenic
936874925 2:117177084-117177106 ACAAAGGAGAAGAGAGAGGAAGG - Intergenic
936995070 2:118404781-118404803 TCTGAGGAGCAGAGAAAGGATGG + Intergenic
937141056 2:119600818-119600840 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
937217705 2:120323311-120323333 ACAGAGGAGGAGGAGGAGGGGGG - Intergenic
937680720 2:124641260-124641282 ACAGAGGAGGAGACTGAGGCTGG + Intronic
937720186 2:125085976-125085998 AGAAAGGAACAGAAAGAAGAAGG + Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
937953717 2:127407900-127407922 AGACAGGAGCAGAAGGAGGGAGG - Intergenic
938950951 2:136253977-136253999 ACAGAAGACCTGGAAGAGGAAGG - Intergenic
938995057 2:136669634-136669656 ACAGAAGAGCAGAAGCAGTATGG - Intergenic
939018676 2:136932701-136932723 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
939116085 2:138062418-138062440 CCACAGGAGCAGTAAGTGGAAGG + Intergenic
939274304 2:139980390-139980412 ACTGAGGAGGAGAGAGATGAGGG + Intergenic
939298220 2:140297538-140297560 AAAGAGGGGAAGAGAGAGGAAGG + Intronic
939430585 2:142100899-142100921 ACAGAGGAACTCAAAGATGAAGG + Intronic
939635484 2:144576679-144576701 ACAGAGGAGGTGAGAGATGATGG + Intergenic
939853363 2:147326637-147326659 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
939861543 2:147426950-147426972 AAAGAGGAGTAGAAACAGGAAGG + Intergenic
940078935 2:149778164-149778186 ACAATGGAGCAGACAGAGGAAGG + Intergenic
940092845 2:149940818-149940840 AAGGAAGAGAAGAAAGAGGAAGG - Intergenic
940409357 2:153342678-153342700 GAAGAGGAGCAGGAAGAGGAGGG - Intergenic
941109640 2:161404872-161404894 ACAGAAGAGCAGAAAGGCAAGGG - Intronic
941144342 2:161824930-161824952 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
941885831 2:170526178-170526200 ACTGAGGTTCAGAGAGAGGAAGG - Intronic
942074043 2:172340540-172340562 TCAGAGGAACAGAAAGTAGAAGG + Intergenic
942115505 2:172725623-172725645 TCAGAGGAGAAGTCAGAGGAGGG - Intergenic
942232564 2:173873825-173873847 GAAGAGGAGAAGGAAGAGGAGGG + Intergenic
942350780 2:175050699-175050721 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
942406671 2:175663263-175663285 ACATAGGAGGAGAAAGAAAAAGG + Intergenic
942523243 2:176826553-176826575 ACAGAAGAACAAAAAGAGGAGGG + Intergenic
942524809 2:176841808-176841830 AGAGAGGAGGAGGAGGAGGAAGG - Intergenic
942604055 2:177671960-177671982 AGAGAAGAGCAGAAAGGGAATGG - Intronic
942686458 2:178537701-178537723 ACAGAGGAACAGGAAGATGAAGG - Exonic
942867790 2:180697368-180697390 AAATAAGAGAAGAAAGAGGAGGG + Intergenic
942930968 2:181491779-181491801 ACAGAGGAGCAGGAATGGTAAGG - Intronic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943270528 2:185796755-185796777 ACAGAGGATCTGACAGAGGTGGG - Exonic
943439830 2:187915214-187915236 GCAGAGGAGGAGGAAGAGGAGGG + Intergenic
943576691 2:189638748-189638770 ACAGAGATGCAGAAAAGGGATGG - Intergenic
943713868 2:191128357-191128379 ATAGAGGGGAAGGAAGAGGAGGG + Intronic
943806218 2:192130281-192130303 ACAGAGGAGAAGGAGGAGGAAGG - Intronic
944016925 2:195051726-195051748 AGAGAGGAGCTGAAAGAGTAGGG - Intergenic
944844280 2:203653475-203653497 AAAGAAGAGCAGAATGAGGCCGG + Intergenic
944891633 2:204123232-204123254 ACAAAGGAACAAAAAGAGCAGGG - Intergenic
945028615 2:205642976-205642998 AAAAAGGAGCAAAAATAGGAGGG - Intergenic
945188438 2:207163405-207163427 GCAGAGGAGCAGGGGGAGGAGGG + Intronic
945482845 2:210363286-210363308 AGAGAGGAGCAAAAAGGGCAGGG - Intergenic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
945913839 2:215681809-215681831 ACAAAGGAAGAGGAAGAGGACGG + Intergenic
946238948 2:218342162-218342184 AGAGAGGAGCTGGGAGAGGAGGG + Intronic
946587923 2:221211186-221211208 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
946830726 2:223725774-223725796 TCAGAGGAGTAGGAAGAGAATGG + Intergenic
947356342 2:229299951-229299973 AAAGAGTAGGAGAAAGATGAAGG - Intergenic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947818529 2:233054524-233054546 TCAGAGGAGCAGAACAGGGAAGG + Intergenic
948044922 2:234936276-234936298 ACAGAGGGGCAGAGGGCGGAGGG - Intergenic
948062522 2:235052183-235052205 ACAGAGAGGCAGAGAGAAGAAGG - Intronic
948495625 2:238346764-238346786 GCAGAAGAGCAGAAAGCGCATGG - Intronic
948512269 2:238476517-238476539 AGAGAGGAGCAAAATGAGGCCGG + Intergenic
948583943 2:239006812-239006834 ACAGTGGAGCAGAGAGTGGAAGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1169026343 20:2374801-2374823 ACAGAGGCCCAGAGAGGGGAAGG + Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169515762 20:6314444-6314466 ACAGAGAACGAGAAAGAGTAAGG + Intergenic
1169525989 20:6426259-6426281 AGAGAGAAGAAGAAAGAGAAGGG - Intergenic
1169936719 20:10891600-10891622 AAAAAGGAAAAGAAAGAGGAAGG - Intergenic
1170024268 20:11872005-11872027 AAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1170115602 20:12855692-12855714 ATAGAGGACCAGAAATAAGACGG + Intergenic
1170314074 20:15024374-15024396 AAAGAGGAGGAAGAAGAGGAAGG + Intronic
1170534551 20:17327013-17327035 ACAGATGAGGAGACAGAAGAAGG - Intronic
1170662755 20:18358890-18358912 ACGGATGAGCAGAGAAAGGATGG + Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1170966671 20:21078917-21078939 AAAGAGGAAAAGAAAGAGGATGG - Intergenic
1171341048 20:24430084-24430106 CCAGAGAACAAGAAAGAGGATGG + Intergenic
1171490997 20:25517104-25517126 ACAGAGGACGGGAAAGCGGAAGG - Intronic
1171536778 20:25899218-25899240 ACAGGGCAGAAGACAGAGGAGGG + Intergenic
1171804330 20:29661939-29661961 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1171839720 20:30194483-30194505 ACAGGGCAGAAGACAGAGGAGGG + Intergenic
1171933538 20:31250933-31250955 GCTGAGGAGGAGAAAAAGGAGGG - Intergenic
1171941201 20:31331462-31331484 AAAATGGAGCAGAAAGAGGAAGG + Intergenic
1171950980 20:31421752-31421774 ACAGAGGACCAGACAGAAGAAGG + Intergenic
1172135512 20:32684092-32684114 ACAGAGGAGAACAAAAATGATGG - Intergenic
1172193257 20:33074981-33075003 ACAGAGGAAGGGAAGGAGGAAGG - Intergenic
1172210958 20:33198225-33198247 ACAGAGGAGAACAAAGAGGCCGG - Intergenic
1172227040 20:33311966-33311988 ATAAAGGAGCAGAGAGAAGAAGG - Intergenic
1172603456 20:36199234-36199256 ACCGAGACCCAGAAAGAGGAAGG + Intronic
1172740722 20:37164366-37164388 AGAGAGGAAGAGAAGGAGGAGGG - Intronic
1172872265 20:38143142-38143164 AGAGAGGAGAGGAAAGAGGGAGG + Intronic
1173113464 20:40217951-40217973 AGAGAGGGGGAGAAAGAGAAAGG + Intergenic
1173134202 20:40424905-40424927 GAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1173619535 20:44426206-44426228 ACAGAGAAACAGAAAGAAGCGGG + Intronic
1173687862 20:44936750-44936772 ACTGTGGAGCAAGAAGAGGAGGG + Intronic
1173694899 20:45001320-45001342 GCAGAGGATGAGGAAGAGGAAGG + Exonic
1173914926 20:46700304-46700326 ACAGTGGAGCAGGCAGAGCAGGG + Intergenic
1174102294 20:48136959-48136981 ACAGCAGAGCTGAAAGAGCATGG + Intergenic
1174112456 20:48205862-48205884 ACAGAGGAGGAGACAAGGGAAGG - Intergenic
1174212536 20:48891236-48891258 AAAGAGGAAGAGGAAGAGGAAGG + Intergenic
1174379631 20:50148348-50148370 ACAGATGAGCAGACTGAGGTGGG + Intronic
1174423477 20:50415874-50415896 GCAGAGGAGGAGAGAGAGAAAGG + Intergenic
1174555775 20:51394416-51394438 CCAGAGGAGCAGCGTGAGGAAGG - Intronic
1175345388 20:58269170-58269192 GCAGGGGAGCAAAAAAAGGAGGG + Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176072959 20:63236283-63236305 ACAGAGGAGGAAGAGGAGGAGGG + Exonic
1176582286 21:8543071-8543093 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1176677401 21:9792204-9792226 ACAGAAGAAGAGAAAAAGGAAGG + Intergenic
1176870456 21:14079623-14079645 GCAGATGAGCTGAAAAAGGAGGG - Intergenic
1177969762 21:27775656-27775678 AAGGAAGAGCAGGAAGAGGAAGG - Intergenic
1178166875 21:29988568-29988590 TCAGAGCAGCAGGAATAGGAGGG + Intergenic
1178375539 21:32064598-32064620 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1178505266 21:33157439-33157461 AAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178729905 21:35091801-35091823 ACAGAGGGGAATAAACAGGAAGG - Intronic
1178822859 21:35991336-35991358 ACAGAGCAGGAGAGTGAGGAGGG + Intronic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179520662 21:41942251-41942273 ACAGAGGGGCAGCATGAGGAGGG + Intronic
1179728332 21:43353446-43353468 CCAGAGGCGCAGAGAGAGGCCGG + Intergenic
1179976333 21:44869734-44869756 TCAGAGGCGCAGAAAGTTGAAGG - Intronic
1180014191 21:45072305-45072327 CCAGAGCAGCAGAGAGCGGATGG - Intergenic
1180059990 21:45379816-45379838 ACAGAGGAAATGGAAGAGGAAGG - Intergenic
1180265121 22:10520119-10520141 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1180463989 22:15594362-15594384 ACAGAGAAAGAGAAAGAGAAAGG + Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181440632 22:22933653-22933675 ACTGAAGGGCAGAGAGAGGACGG + Intergenic
1181535018 22:23537296-23537318 AAAGAGGAGCAGAGAGAAGGAGG + Intergenic
1181544523 22:23594072-23594094 GCAAAGGAGAAGAGAGAGGAAGG + Intergenic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181729226 22:24832474-24832496 ACCGAGGGGCAGAAAGATTAAGG - Intronic
1182396938 22:30042990-30043012 ACAGAGGAGCATTAAACGGAAGG - Intergenic
1182512936 22:30832007-30832029 AAAGAGGAGCAGGAGGAGAAAGG - Intronic
1182567489 22:31211146-31211168 CCAAATGACCAGAAAGAGGATGG - Intergenic
1183101616 22:35587688-35587710 ACAGAGCAGAAGGAAGAGGATGG + Intergenic
1183121008 22:35730206-35730228 ACAGAAAGGCAGAAAGAAGAGGG - Intergenic
1183273766 22:36878325-36878347 ACAGAGCAGCAGAGACAGGAAGG - Intergenic
1183324061 22:37182006-37182028 AGAGAGGAGCAGAAATAGGCTGG + Exonic
1183367911 22:37416976-37416998 AGAGAGGAGGAGACAGAGAAAGG - Intronic
1183539740 22:38423141-38423163 TCAGAGGAGCGGCACGAGGAGGG + Intergenic
1183645452 22:39123766-39123788 GCAGAGGAGCACAAGGAGGAAGG + Intronic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1184029420 22:41883086-41883108 AGAGATGAACAGATAGAGGATGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184380209 22:44140646-44140668 GATGAGGAGCAGAGAGAGGAAGG - Intronic
1184456010 22:44609766-44609788 ACAGTGGAGCTCAAAGAGGAAGG + Intergenic
1184570624 22:45322091-45322113 ACACAGGAGCAGATGAAGGATGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184955981 22:47886207-47886229 AGATGGGAGCAGAGAGAGGAGGG + Intergenic
1185109555 22:48893500-48893522 GCAGAGGAGAGGAAACAGGAGGG + Intergenic
1185330489 22:50250028-50250050 ACGGAGGAGCAGCCAGGGGAAGG + Intronic
949108639 3:231292-231314 AGAGAGGAGAGGAAGGAGGAAGG - Intronic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949754977 3:7398881-7398903 TCAGAGAAGTAGAAAGAGGGAGG - Intronic
949758638 3:7443030-7443052 AAAGAGGAGGAGGAGGAGGATGG - Intronic
949954051 3:9252734-9252756 ACAGAGGAGGAGTCACAGGAGGG - Intronic
950098134 3:10342033-10342055 ACAGAGGCCCAGAGAGGGGAAGG - Intronic
950130054 3:10536466-10536488 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
950252184 3:11475080-11475102 ATAGAGGAGTAGAAATAAGAAGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950437460 3:12988942-12988964 ACTGAGGATCAGAGACAGGAAGG + Intronic
950571787 3:13804915-13804937 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
950582730 3:13873159-13873181 ACAGAGGCCCAGAGAGAGAATGG - Intronic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
950900159 3:16490381-16490403 TCAGAGAAGCAGAGAAAGGAGGG + Intronic
950995471 3:17491873-17491895 TCAGAGGTGCAGAAAGAAGCTGG - Intronic
951274009 3:20663157-20663179 AAAGAGGATGAGAAAGAGGGTGG - Intergenic
951289421 3:20856347-20856369 AGAGAGGGAAAGAAAGAGGAAGG - Intergenic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
951742688 3:25941795-25941817 AGAGAGGGGCAGAAAGAGAAAGG - Intergenic
952620450 3:35333255-35333277 AAAGAGGAAGAGAAAGAGGTAGG - Intergenic
952865676 3:37853737-37853759 CCAGGGGAGCTGAAAGAGGAGGG + Intergenic
953234155 3:41091572-41091594 ACTGAGGACCAGAGAAAGGAAGG - Intergenic
953323615 3:41993874-41993896 TCATAGGAGAAGGAAGAGGATGG - Intergenic
953557861 3:43961012-43961034 ACGGCAGAGCAGAAAGAGCAGGG - Intergenic
953866295 3:46586012-46586034 AAGGAGGAGAAGGAAGAGGAGGG + Intronic
953866399 3:46586887-46586909 CCTGAGGACCAGATAGAGGAAGG + Intronic
954046527 3:47936092-47936114 AAAGAAGGGGAGAAAGAGGAGGG + Intronic
954660780 3:52225774-52225796 AGAGGGGAGTGGAAAGAGGAAGG - Exonic
954808981 3:53236400-53236422 ACAGAAGAGCAGTATGAGGCAGG - Intronic
954940174 3:54364774-54364796 GCAAAGAAGCGGAAAGAGGAAGG + Intronic
955382549 3:58451463-58451485 GCTGAGGAGGAGGAAGAGGAAGG + Intergenic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955748887 3:62167944-62167966 ACAGAGGACCAGAGAGGGGAGGG - Intronic
955848165 3:63190678-63190700 AGAGAGAAGGAGAAAGAGGGAGG + Intergenic
955855516 3:63268663-63268685 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
956376503 3:68618927-68618949 ACAAAGCAGCAGAAAGATGAAGG - Intergenic
956606739 3:71080729-71080751 ACAAATGAAGAGAAAGAGGAAGG - Intronic
956733069 3:72214561-72214583 CCAGAGGAGCTGAAAGATTATGG - Intergenic
956906084 3:73766797-73766819 TCAGAGGAGAAAAAAGAGAAAGG - Intergenic
956989308 3:74745077-74745099 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
956992487 3:74783371-74783393 ACAGAGGAACAAGAAGAAGAAGG + Intergenic
957060572 3:75478147-75478169 AGAGAGGTGGAGAAAGAGAAAGG - Intergenic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958106866 3:89085705-89085727 ACAGACCAGCAGAAAAAGTAAGG + Intergenic
958135808 3:89489263-89489285 GGAGGGGAGGAGAAAGAGGAAGG + Intergenic
958683265 3:97357924-97357946 GCTGAGGAGAAGAAAGAAGAGGG + Intronic
958731632 3:97966284-97966306 ACATAGGAGGAGAAAGAGAGGGG - Intronic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
958867658 3:99519684-99519706 AAAGAGGAGGAAAAGGAGGAGGG + Intergenic
958936430 3:100260890-100260912 CCAGAGGGGAAGAAAGAGGGAGG - Intergenic
959110004 3:102111576-102111598 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
959505793 3:107155356-107155378 ACTGAGGAGCAGAAAAGGAAAGG + Intergenic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959933073 3:112003356-112003378 GCAGAGAAGCAGGAAGAGGGAGG + Intronic
960090102 3:113630325-113630347 ACCGTGGAGCATAAAGAGGTGGG - Intergenic
960270886 3:115673232-115673254 AGAGAGAAAGAGAAAGAGGAGGG + Intronic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960525482 3:118705086-118705108 AGAGAGGAGCAGATAGAAGCAGG + Intergenic
960775306 3:121244360-121244382 TCAGAGGAACAAAAAGAAGAGGG + Intronic
960865459 3:122194948-122194970 AGAAAGGAGGAGGAAGAGGAAGG - Intronic
961076154 3:123984462-123984484 ACACAGGAGTAGAAATAGAAAGG - Intronic
961239440 3:125397622-125397644 GGAGAGCAGCAGGAAGAGGAAGG + Intergenic
961292809 3:125861249-125861271 AGAGAGGTGGAGAAAGAGAAAGG + Intergenic
961387290 3:126529899-126529921 ACAGAGGAGCAGACAGAACAGGG - Intronic
962030270 3:131592298-131592320 ACTGAGGCACAGAAAGATGAAGG + Intronic
962174434 3:133138203-133138225 AAAGAGGAACAGAAAGTGGGAGG + Intronic
962236471 3:133711593-133711615 CTAGAGGAGCACAAAGGGGAGGG - Intergenic
962449349 3:135499106-135499128 ATATAAGGGCAGAAAGAGGATGG + Intergenic
962708880 3:138069139-138069161 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
962794541 3:138838972-138838994 ACAGAGAAACATAGAGAGGAGGG + Intergenic
962825488 3:139096623-139096645 ACTGGGGCCCAGAAAGAGGAAGG - Intronic
963229834 3:142898469-142898491 AGGGAGGAGCAGAGAGAGGGAGG - Intergenic
963600949 3:147378431-147378453 AAAGAGGAGGAGGAGGAGGATGG + Intergenic
964023647 3:152044983-152045005 GAAGAGGAAGAGAAAGAGGAAGG + Intergenic
964071980 3:152646292-152646314 GCAGAGGAGCATAAGGAGCAAGG + Intergenic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
964453937 3:156839947-156839969 ACACAGGTGGAGAAAGTGGAAGG - Intronic
965629268 3:170714308-170714330 ACAGAGAAGCAGTCAGCGGATGG - Intronic
965686971 3:171314460-171314482 ACAGAGAGGCAGAAATGGGATGG - Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966416509 3:179694831-179694853 AGAAAAGAGGAGAAAGAGGAAGG + Intronic
966748147 3:183297663-183297685 ACAGAGAGAAAGAAAGAGGAAGG - Intronic
966831719 3:184016139-184016161 GCACAGGAGCAGAGAGAGGCAGG + Intronic
967192662 3:186998508-186998530 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
967319134 3:188178279-188178301 AAAGAGGAGAAGCATGAGGAGGG - Intronic
967328443 3:188266138-188266160 AAAGAGGAGGAGGAAGAGAAAGG - Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967877278 3:194275890-194275912 AGTGGGGAGCGGAAAGAGGAGGG - Intergenic
967978418 3:195048559-195048581 ACAGCAGAGCAGCACGAGGATGG - Intergenic
968383612 4:116496-116518 AAAGGAGAGGAGAAAGAGGAGGG - Intergenic
968391398 4:195982-196004 AAAGAGAAGCAGAGAGAGAAAGG - Intergenic
968607188 4:1541101-1541123 AGAGAGCAGCAGACAGAGCAGGG + Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968708465 4:2095206-2095228 GGAGAGGAGCAGAAACAGGAAGG + Intronic
969004470 4:4008218-4008240 AGAGAGGTGGAGAAAGAGAAAGG - Intergenic
969042170 4:4307616-4307638 ACAGGAGAGGAGAAAGCGGATGG - Intronic
969258317 4:6017965-6017987 ACAGAGCAGAAGAAGGAGGGCGG + Intergenic
969324442 4:6432895-6432917 GCTGAGGAGAAGGAAGAGGACGG - Intronic
969349296 4:6589016-6589038 ACCGAGGAGAAGAATGAGGCTGG - Intronic
969501207 4:7554412-7554434 ACATGGGAGCAGGAAGAGGAAGG - Intronic
969520009 4:7671659-7671681 GCTGAGGAGCAGAAAGAATAAGG + Intronic
969809427 4:9636489-9636511 AGAGAGGTGGAGAAAGAGAAAGG + Intergenic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970231461 4:13915488-13915510 GCAAAGGACCAGAAAGAGGAGGG - Intergenic
970539968 4:17067836-17067858 ACAGAGGAGCTTAATGAAGAGGG - Intergenic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971025233 4:22582833-22582855 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
971086722 4:23286313-23286335 GAAAAGGAGGAGAAAGAGGAGGG + Intergenic
971124567 4:23739283-23739305 ACAGAGAAGAATAAAAAGGAAGG + Intergenic
971216795 4:24669708-24669730 GCAGAAGAGAAGAAGGAGGAAGG - Intergenic
971375171 4:26050399-26050421 TCAGAGGGGTAGAAAGAGGAAGG - Intergenic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
971865670 4:32168299-32168321 AAAGAGGAGGAGAAAGAAGAAGG - Intergenic
972142100 4:35973409-35973431 AGAGAGGAGAAGGAAGAGTAAGG + Intronic
972166858 4:36297139-36297161 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
972184310 4:36510248-36510270 TCATAGGAGCAGAAAGACTATGG - Intergenic
972362687 4:38342998-38343020 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
973255108 4:48102993-48103015 AGAGAGGACCAAAAAGATGAAGG + Intronic
973267582 4:48226449-48226471 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
973318629 4:48787163-48787185 ACAGAGAAGCAGAAAAACAAAGG + Intergenic
973794708 4:54412888-54412910 CCAGGGGAGGAGAAAGAGGGTGG - Intergenic
973978731 4:56288210-56288232 AAAGAAGAGCAGGAGGAGGAAGG - Intronic
974332859 4:60502888-60502910 AAAAAGGAGGAGAAAAAGGAGGG - Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
975112312 4:70641828-70641850 AGAGAGAACCAGAAAGAGTATGG + Intronic
975334631 4:73161749-73161771 ACAGAGACACAGAAAGAGAAGGG + Intronic
975393264 4:73845491-73845513 AAAAAGGAGGAGAAAGATGAAGG + Intronic
975493628 4:75014608-75014630 TCAGAGGAGCAGGGAGAGGGAGG - Intronic
975631437 4:76407815-76407837 AGAGAAAAGAAGAAAGAGGAAGG + Intronic
975663048 4:76706530-76706552 GCTGAGGAGGAGTAAGAGGATGG + Intronic
975694619 4:76999442-76999464 ACAAATGGGCAGTAAGAGGAAGG - Intronic
975986443 4:80204968-80204990 AGGGAAGAGTAGAAAGAGGAGGG - Intergenic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
976777188 4:88719602-88719624 AAGGAGGAGGAGAAAGAGAAGGG - Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977115751 4:93025143-93025165 AGAGAGGGAGAGAAAGAGGAAGG + Intronic
977401864 4:96542497-96542519 AAAGAGGATCAGAGAGAGGCAGG + Intergenic
977523588 4:98117513-98117535 GAAGCGGAGGAGAAAGAGGAAGG - Intronic
977695814 4:99964339-99964361 ACAGAGGAGGAGAAAGAAAAAGG + Intergenic
977837603 4:101663459-101663481 ACAGAGGAGTAGAAAGATATAGG + Intronic
978311957 4:107394521-107394543 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
978501793 4:109417746-109417768 AGAGGGGAGGGGAAAGAGGAGGG + Intergenic
978843942 4:113249554-113249576 ACAGAGAACAAGAAAGAGAAAGG - Intronic
978989070 4:115055336-115055358 ACAGACGAGAGGTAAGAGGATGG - Intronic
979046984 4:115879605-115879627 ACAGAGGCAGAGAAAGAGCAGGG + Intergenic
979068488 4:116169587-116169609 CCATAGGAGAAGAAAGAGAAAGG - Intergenic
979188335 4:117826840-117826862 ATAGGGGAACAGAAACAGGAAGG + Intergenic
979722051 4:123911833-123911855 ACAGACGATCAAAGAGAGGAGGG - Intergenic
980018917 4:127684624-127684646 AAGGAGGAGGAGGAAGAGGAAGG - Intronic
980457632 4:133066156-133066178 CCAGAAGAGGAGAAAGATGAAGG - Intergenic
980487524 4:133478526-133478548 GCTGAGGAGAAGGAAGAGGAGGG - Intergenic
981048909 4:140292045-140292067 ACAGAGGAGCAGGAGGCAGAGGG - Intronic
981252170 4:142616374-142616396 AAAGAGGATCAGAGAGAGGGAGG + Intronic
981288656 4:143048494-143048516 TGAGAGGAGGAGAAGGAGGAAGG - Intergenic
981390003 4:144178333-144178355 ACAGAGAGACAGAAAGAGGCTGG - Intergenic
981637967 4:146902159-146902181 TCAGAGGAGGGAAAAGAGGAAGG - Intronic
981673187 4:147311156-147311178 GGAGAGAAACAGAAAGAGGAGGG + Intergenic
981906777 4:149930031-149930053 AAAGAGGACTAGAAAGTGGAAGG + Intergenic
981989963 4:150906812-150906834 ACAGTGGAGCAAACAGAGTAAGG + Intronic
982093862 4:151902995-151903017 AAAGATGAGGAGAAAGAGAAAGG - Intergenic
982425428 4:155253132-155253154 GCAGAGGAGGAGGAAGAGAAGGG + Intergenic
982521668 4:156425007-156425029 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
982946446 4:161630119-161630141 ACGGAGGGGCAGGAAGGGGAGGG - Intronic
983099957 4:163613043-163613065 ACAGAGCAGCAGGCAAAGGATGG + Intronic
983351246 4:166592904-166592926 AGAGAGGAAAAGAAAGAGGAGGG - Intergenic
983672455 4:170254171-170254193 AGAAAGGAGGAGAAAGAGGCTGG + Intergenic
983981658 4:174005016-174005038 CCAGAGGAGCAGATAGCAGAGGG + Intergenic
984014052 4:174405075-174405097 AGAGAGGGGGAGGAAGAGGAGGG - Intergenic
984218399 4:176943177-176943199 AAAGAGGAGAAAAAGGAGGAGGG - Intergenic
984375742 4:178926637-178926659 GCAGAGGAGGAGGAAGAGGAGGG + Intergenic
984613249 4:181865559-181865581 ACAGAGGATGGCAAAGAGGAGGG + Intergenic
984761234 4:183364598-183364620 GAAGAGGAAGAGAAAGAGGATGG - Intergenic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985085884 4:186312025-186312047 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
985177285 4:187215238-187215260 GGAGAGGAGGAGAAGGAGGAAGG - Intergenic
985243925 4:187960353-187960375 ACAGGCCATCAGAAAGAGGAGGG + Intergenic
985398133 4:189566577-189566599 ACAGAAGAAGAGAAAAAGGAAGG - Intergenic
985420760 4:189783031-189783053 ACAGAGGAGCAAAGTGAGAAGGG + Intergenic
985472484 5:54333-54355 ACCCAGGAGGAGGAAGAGGAAGG + Intergenic
985581444 5:697459-697481 ACGGAGGACCAGAGAGAGGATGG + Intergenic
985756639 5:1723396-1723418 ACAGAGGAAGAGACAGAGGCAGG - Intergenic
985884340 5:2664981-2665003 AGAGAGGAGCAGAAGAAGGCTGG + Intergenic
986206192 5:5627469-5627491 ACGGAGGGGCAGGAACAGGAGGG + Intergenic
986613878 5:9597110-9597132 ACAGAGGAGGAGGAAGGGGAAGG - Intergenic
986810475 5:11353263-11353285 ACAGAAGAGCAGTGACAGGACGG + Intronic
986822507 5:11482916-11482938 AAAGGGGAGGAGAAAGAAGACGG + Intronic
986964552 5:13254664-13254686 ACAGAGGAGTAGAGAAAGGTGGG - Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987505030 5:18757681-18757703 TCTGAGGAGGAGGAAGAGGAGGG + Intergenic
987678358 5:21104775-21104797 ATAGAGGAGCAGGAAGATGAAGG + Intergenic
988253342 5:28789493-28789515 AGAGAAGAACAGAAAAAGGAAGG + Intergenic
988442173 5:31245397-31245419 ACAGAGGAAAAGAGAGAGAAAGG - Intronic
988442176 5:31245425-31245447 ACAGAGGAAAAGAGAGAGAAAGG - Intronic
989043342 5:37250524-37250546 ATAGAGGAGGAGGAAGAGGAGGG - Intergenic
989051708 5:37326953-37326975 GCTGAGGAGTAGGAAGAGGAAGG - Intronic
989122895 5:38021760-38021782 ATAGAGGAGAAGGAAGGGGAAGG - Intergenic
989410138 5:41110847-41110869 AAAGAGGAGAAGGAAGAGGAAGG - Intergenic
989455451 5:41638316-41638338 AAAAAGGAAAAGAAAGAGGAAGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989499779 5:42152018-42152040 ACAGAAGAACAGATAGAGCAAGG - Intergenic
989665212 5:43846254-43846276 AGAGAGGAGGGGAAAGAGGGAGG - Intergenic
990470077 5:56107350-56107372 GCAGAATAGCAGAAAGGGGAAGG - Intronic
991220702 5:64212257-64212279 AGTGAGGAGCAGTAAGAGGTTGG - Intronic
991473408 5:66994119-66994141 AGTGAGGAGCACCAAGAGGAAGG + Intronic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
991651725 5:68862459-68862481 AAACAGCAGTAGAAAGAGGATGG - Intergenic
991959512 5:72030444-72030466 GAAGAGGAGGAGGAAGAGGAAGG - Intergenic
992002046 5:72445303-72445325 ACTGAGGAGGAGCAACAGGAAGG + Intronic
992214909 5:74516431-74516453 AAAGAGGAGGAGGAGGAGGATGG - Intergenic
992270978 5:75062615-75062637 ACAGATGGGCAAAGAGAGGAGGG + Intergenic
992317154 5:75567812-75567834 ACAGAGGAACAGCCTGAGGAAGG + Intronic
992407470 5:76473444-76473466 AGAGAGAAGGAGAAAGAGGGAGG - Intronic
992516506 5:77499299-77499321 ACTGTGGTGCAGAAAGAGAAAGG + Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993163644 5:84321725-84321747 ACAGAGGTGCAGAAAAATGATGG + Intronic
993249547 5:85501132-85501154 CTAGAGCAGCAGGAAGAGGATGG - Intergenic
993261850 5:85667672-85667694 GAAGAGGAGGAGAAAGGGGAGGG - Intergenic
993330509 5:86594491-86594513 AGAGAGAAAAAGAAAGAGGAAGG + Intergenic
993811261 5:92479499-92479521 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
993835301 5:92812476-92812498 AAAGAGGAGCAAAAGGAAGAAGG + Intergenic
993929730 5:93923074-93923096 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
994099877 5:95880738-95880760 ACAGGGGCAGAGAAAGAGGAGGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994721962 5:103390820-103390842 ATTGTGGAGTAGAAAGAGGAAGG - Intergenic
995214729 5:109582345-109582367 GAAGAGGAGAAGGAAGAGGAGGG + Intergenic
995407143 5:111811186-111811208 ACAGAGGAACAAAGAGAGTAAGG - Intronic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
995548209 5:113253575-113253597 GCAGATGAGCACAAGGAGGAGGG + Intronic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
997136134 5:131328491-131328513 ACAGAGTTCCAGAAAGAGGGAGG - Intronic
997136940 5:131336954-131336976 ACTGACGAGCTGACAGAGGAAGG - Intronic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
997471195 5:134117867-134117889 ACACAGGAGGAGGAAAAGGACGG + Intronic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
997611939 5:135221579-135221601 ACAGAGGAGTTGAAAGAACATGG + Intronic
997771763 5:136561613-136561635 AGAGAGGAAGAGAAAGAGGAAGG - Intergenic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
998182106 5:139953045-139953067 AGAGAGAAGAAGAAAGAGCAAGG + Intronic
998205296 5:140153280-140153302 GCAGAGAAGCAGTGAGAGGAAGG + Intergenic
998221897 5:140289517-140289539 GCACTGGAGAAGAAAGAGGAAGG - Intronic
998384664 5:141749885-141749907 TCACAGGAGCAGAAAGAAGAAGG - Intergenic
998519884 5:142790652-142790674 ACAGTGAGGTAGAAAGAGGAAGG - Intronic
999242232 5:150134565-150134587 ACTCAGGCGCAGAGAGAGGATGG - Intronic
999249670 5:150175082-150175104 ACAAAGAAGCTGAAAGAGGCAGG - Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999284464 5:150386002-150386024 ACTGAGGATCAGAAAGTTGAGGG + Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999803988 5:155065052-155065074 ACAGAGGAAGAGAATGAGGCTGG + Intergenic
999835728 5:155368833-155368855 AGAGAGTAACAGAAAGGGGAGGG - Intergenic
999891282 5:155981067-155981089 ACAGTGCAGCAGATGGAGGAGGG + Intronic
999993882 5:157073311-157073333 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000143860 5:158433755-158433777 AGAAAGGAGAAGAAAGAGAAAGG - Intergenic
1000152148 5:158513834-158513856 AACGAGGAGGAGAAACAGGAGGG + Intergenic
1000239831 5:159399162-159399184 AGAGAAGAGAAGAAAGAGGCGGG + Intergenic
1000578502 5:163006798-163006820 ACAGACCAGAAGAATGAGGATGG + Intergenic
1000990682 5:167908469-167908491 AGAGAGGAGAAGAGAGGGGAGGG - Intronic
1000990699 5:167908516-167908538 AGAGAGGAGAAGAGAGGGGAGGG - Intronic
1001068143 5:168556586-168556608 ATAGAGGTGCAGTTAGAGGACGG - Exonic
1001396944 5:171424471-171424493 ACCGAGGCACAGAATGAGGAAGG + Intronic
1001542928 5:172551744-172551766 AGAGAAGAAAAGAAAGAGGAAGG - Intergenic
1001794619 5:174491645-174491667 AAAGAGGAGCAGAAAGAACCGGG - Intergenic
1002140587 5:177134845-177134867 ACAGAGGAGGAAAAAGAGACGGG + Intronic
1002177919 5:177412608-177412630 ACAGAAACACAGAAAGAGGAGGG + Intronic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1003079674 6:3011403-3011425 ACAGAGGAGAAAAAAGAAAAAGG + Intronic
1003293406 6:4802774-4802796 AAAGAAGAACAGAAAAAGGATGG - Intronic
1003333901 6:5152756-5152778 ACAGAGGAGGCCCAAGAGGAAGG - Intronic
1003406748 6:5832545-5832567 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1003536352 6:6978851-6978873 TCAGTAGAGCACAAAGAGGAAGG + Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003604820 6:7549748-7549770 AAAGAAGAGGAGAGAGAGGAAGG + Intronic
1003688741 6:8330796-8330818 ACTGTGGAGCAGAACCAGGAGGG - Intergenic
1003775165 6:9352280-9352302 CCAGAGCAGGAGAAAGAGGAGGG - Intergenic
1003893839 6:10588119-10588141 AGAGAGGGACAGAAAGAGGATGG + Intronic
1004539844 6:16539483-16539505 AGAGAGGAGCAGAGAGATAAAGG + Intronic
1004722700 6:18281763-18281785 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1004772334 6:18797839-18797861 GCAGATGAGCTGAAACAGGAAGG + Intergenic
1005058119 6:21749688-21749710 ACAGAAGAGAAAAAAGAAGAGGG - Intergenic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1005761719 6:28973677-28973699 AAAGAGGAGAAGGAAGAGGAGGG - Intergenic
1005768946 6:29045271-29045293 GTAGAGGAGGAGAAGGAGGAGGG + Intergenic
1005925759 6:30444222-30444244 TCAGTGGAGCAGGAGGAGGAAGG - Intergenic
1005951370 6:30633808-30633830 AAAGAGGAGAAGGAAGAGGAAGG + Intronic
1005989852 6:30896085-30896107 ACAGAGGCACACAGAGAGGAGGG - Intronic
1006361027 6:33587158-33587180 ACTGAGGCTCAGAAAGAGGAAGG - Intergenic
1006388860 6:33747053-33747075 AAAGAGGAGGAGAGAGAAGAGGG + Intergenic
1006485011 6:34332394-34332416 GAAGAGGAGGAGGAAGAGGAGGG + Intronic
1006617746 6:35341380-35341402 AAAGAGAAGCAGAAAGAAGGGGG + Intergenic
1006799400 6:36750420-36750442 GCAGAAGAGGAGAAAGAGGTGGG - Intronic
1006826422 6:36939294-36939316 GCAGAGGACCAGAAGGAGGTTGG + Intergenic
1007075498 6:39063657-39063679 AAGGAGGAGAAGAAAGAGCAGGG + Intronic
1007103691 6:39268763-39268785 ACAGAGGAAAGGAAAGAGGCAGG - Intergenic
1007297967 6:40842554-40842576 ACAGAATAGAAGAAAGAGCAAGG - Intergenic
1007315677 6:40986745-40986767 ACAGAGGAGGAGAAAAAGTGAGG + Intergenic
1007452609 6:41951603-41951625 AGAGAGAAGCAGGAAGAAGAGGG + Intronic
1007518377 6:42431397-42431419 ACAGAGAGGCAGAAAGAAAAAGG + Intronic
1007744948 6:44038097-44038119 AAAGAGGAGCACAGACAGGATGG + Intergenic
1007836576 6:44678597-44678619 ACAGAGGAGGAGACAGAGAGGGG - Intergenic
1007946506 6:45832035-45832057 ATAGGGGAGGAGAAAGAGGGAGG - Intergenic
1007965365 6:45999613-45999635 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
1008099528 6:47376517-47376539 AGAGAGGAGTAGAAAGGGCATGG - Intergenic
1008124048 6:47648946-47648968 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008585992 6:52949964-52949986 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
1008593062 6:53012957-53012979 AAAGAGGAGCAGAAAGATCTGGG + Intronic
1009051891 6:58285443-58285465 AAAGAGAAGAAGCAAGAGGAAGG - Intergenic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009268491 6:61588335-61588357 AAAGAGGAGAAGGTAGAGGAAGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1009859143 6:69303420-69303442 GCTGAGGAGGAGAAAGAAGAGGG - Intronic
1010335256 6:74674039-74674061 AGAGAGGAGAAGAGAGAGGAAGG - Intergenic
1010335570 6:74678917-74678939 ACAGAAGAGAAAGAAGAGGAAGG - Intergenic
1010409901 6:75549467-75549489 AGATAGGAGTAGAAAGAGAAAGG + Intergenic
1010527613 6:76923221-76923243 ACAGAGGAGAAAAAAGAAAAAGG + Intergenic
1010570136 6:77464989-77465011 ACTGAGCAGCTGGAAGAGGATGG - Intergenic
1010574014 6:77510324-77510346 AGAGAGGAGAAGAGAGAGGCTGG + Intergenic
1010800387 6:80168348-80168370 AGAGAGGAGAGGAGAGAGGAAGG + Intronic
1010943079 6:81942206-81942228 CCAGAGTATCAGACAGAGGAAGG - Intergenic
1011113126 6:83860059-83860081 ATAAAGGACCAGAAAGAAGAGGG - Intronic
1011616625 6:89203318-89203340 ACCAAGGATCAGAAAGTGGAGGG - Intronic
1011712823 6:90071946-90071968 ACTGAGGAGGAGGAAGAAGAGGG + Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1011949128 6:92942557-92942579 AGAGAGAAAAAGAAAGAGGAAGG - Intergenic
1012178744 6:96123970-96123992 AAAGAGGAGTAGAACTAGGATGG + Intronic
1012201715 6:96414690-96414712 GCAGAGAAGGAGAAAGAGAAGGG - Intergenic
1012450563 6:99349527-99349549 GCAGAGGAGGAGGAGGAGGAAGG + Exonic
1012984453 6:105859883-105859905 GAAGAGGAAAAGAAAGAGGAGGG + Intergenic
1013115851 6:107103234-107103256 ACAGCTGGGCAGAAAGGGGATGG + Intronic
1013267331 6:108512566-108512588 ACAGAGGGGCATGAATAGGATGG + Intronic
1013615734 6:111841429-111841451 ACAGTGGAGGAGAAAGAGAAGGG + Intronic
1014510776 6:122319336-122319358 ACAGATGAGAAGGAAGAGCATGG + Intergenic
1014642340 6:123927792-123927814 AGAGGGGAGGAGAAGGAGGAGGG + Intronic
1014933245 6:127358543-127358565 ATAGAGGAAGAGAAAGAGAAAGG - Intergenic
1015141066 6:129932382-129932404 AGAGAGAAAAAGAAAGAGGAGGG + Intergenic
1015155680 6:130092932-130092954 AGAGAGGAGGAGAAAAAGAAAGG - Intronic
1015233986 6:130949785-130949807 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015559391 6:134498123-134498145 GGAGAGAAGAAGAAAGAGGAAGG - Intergenic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1016221622 6:141678209-141678231 AAAAAGGAGAAGGAAGAGGAAGG - Intergenic
1016269498 6:142272389-142272411 ACTGGGGAGCAGAAAGAAAAGGG + Intergenic
1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG + Intronic
1016460508 6:144276130-144276152 AAAGAGGAGAAGACAGAGGGTGG + Intergenic
1016640150 6:146338870-146338892 AGAGAAGAGAAGAAGGAGGAAGG - Intronic
1016642856 6:146370241-146370263 ACAGAGGTGAAGAAAGAAAAGGG - Intronic
1016667368 6:146657655-146657677 ACATCAGAGAAGAAAGAGGAAGG - Intronic
1017035396 6:150262637-150262659 ACAGACGACCAGGAAGAAGAGGG - Intergenic
1017190843 6:151651060-151651082 AAGGAGGAGGAGAAAGAGAATGG - Intergenic
1017547293 6:155466364-155466386 ACAAAGGAGGAGAAAGAGAAAGG - Intergenic
1017587444 6:155942789-155942811 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017790174 6:157790836-157790858 ACAGAGAACCAGAAAGACAAAGG - Intronic
1018038080 6:159898665-159898687 AGGGAGGAGGAGGAAGAGGAAGG - Intergenic
1018097735 6:160406702-160406724 ACAGAGAGGCAGAAAGAAGAAGG - Intronic
1018219834 6:161566751-161566773 ACAGAGCAAAACAAAGAGGAAGG - Intronic
1018485414 6:164236610-164236632 ACAAAAAAGCAAAAAGAGGAAGG + Intergenic
1018862309 6:167720057-167720079 CCAGAGGCGCAGGGAGAGGAGGG + Intergenic
1018931611 6:168243730-168243752 AGAGAGGGACAGAGAGAGGATGG - Intergenic
1018938830 6:168294304-168294326 ACAGAGGAAGGGGAAGAGGACGG + Intronic
1018940165 6:168304323-168304345 GCAGGCGCGCAGAAAGAGGATGG - Intronic
1019128959 6:169859755-169859777 ACAGAGGAGCAGGGAGAGACAGG - Intergenic
1019132944 6:169890678-169890700 ACGGAGGACCTGGAAGAGGAAGG - Intergenic
1019770000 7:2877536-2877558 AGAGAGGAGACGAAAAAGGAAGG - Intergenic
1019874661 7:3799115-3799137 AAAGAGGAGAAGAAACATGAGGG - Intronic
1019884940 7:3895601-3895623 ACAGCGGAGTGGAAAGAGAAAGG - Intronic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1020324605 7:6964717-6964739 AGAGAGGTGGAGAAAGAGAAAGG - Intergenic
1020994475 7:15245484-15245506 AGGGAGGATCAGAAAAAGGAAGG - Intronic
1021128344 7:16880503-16880525 GGAGAGGAGGGGAAAGAGGAGGG - Intronic
1021171182 7:17399543-17399565 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021636809 7:22702024-22702046 AAAGAGGGGAAGAAATAGGAAGG - Intergenic
1021695239 7:23269909-23269931 ACAGAGAAGGGGAGAGAGGAAGG - Intronic
1021809024 7:24385040-24385062 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1021849754 7:24795874-24795896 GCTGAGGAGAAGGAAGAGGAGGG - Intergenic
1022288728 7:28980107-28980129 ACTGAGGAGCAAAAAAAGAAGGG - Intergenic
1022400754 7:30034668-30034690 GCAGAGGAAGAGGAAGAGGAGGG + Intronic
1022972480 7:35530452-35530474 GCAGAGGGGCTGAAAGATGATGG - Intergenic
1023071740 7:36441573-36441595 ACTGAGGAGCAGCAAGAGGCAGG + Intronic
1023098783 7:36691504-36691526 ACAAAGGAGGAGAAAGAGAATGG + Intronic
1023120926 7:36907589-36907611 ACAGAGGAGCAGAAAGGAAGAGG - Intronic
1023163196 7:37318019-37318041 ACTGAGGAGCAGAAAGATGGTGG + Intronic
1023386712 7:39665201-39665223 GAAGAGGAGGAGGAAGAGGAAGG - Intronic
1023996831 7:45163706-45163728 ACAAAGGACCAGAAAGGTGAAGG + Intronic
1024178085 7:46861494-46861516 ACAGAGGAGGAGCCAGAGGTTGG - Intergenic
1024329355 7:48140901-48140923 ACAGAAGAGCATAAAAAGGGAGG + Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024405226 7:48971478-48971500 ACAGAACAGCAAAAAGAGCAAGG + Intergenic
1024469530 7:49752667-49752689 ACAGGAGAGAAGAAGGAGGATGG + Intergenic
1024720930 7:52136963-52136985 AAAGAGGAGGAGGAAGAAGAAGG + Intergenic
1024720953 7:52137073-52137095 GGAGAGGAGGAGAAGGAGGAGGG + Intergenic
1025108009 7:56189041-56189063 AAATTGGAGCAGAAAAAGGAGGG - Intergenic
1025284351 7:57650144-57650166 ACAGAGCAGAAGAAGCAGGAGGG + Intergenic
1026234714 7:68516889-68516911 ACAAAGGAGAAGCAAGGGGAAGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028052839 7:86206963-86206985 GAAGAGGAACAGAAAGAGAAAGG + Intergenic
1028246673 7:88487374-88487396 AAAGAGGAGGAGAAGGAGAAGGG + Intergenic
1028302119 7:89213192-89213214 ACAGAGATGCAGAAAGATGATGG + Intronic
1028621122 7:92830694-92830716 GCAGAAGAGAAGAAACAGGAAGG + Intronic
1028839103 7:95407938-95407960 TCACAGGAGCAAGAAGAGGAAGG + Intronic
1029167473 7:98603092-98603114 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1030061029 7:105621451-105621473 ACTAAGGAGAAGGAAGAGGATGG - Intronic
1030102987 7:105962519-105962541 ACAGCAGAGCAGAGAGAGAACGG - Intronic
1030558540 7:111056846-111056868 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1030594142 7:111516345-111516367 ACAGAGGGAGAGGAAGAGGAGGG + Intronic
1030744869 7:113152836-113152858 ACAGAGCAAGAGAAAGAGGGAGG - Intergenic
1030977294 7:116142710-116142732 GCAGAGATGCAGACAGAGGAAGG + Intronic
1031133825 7:117863638-117863660 ACAGATGAGAAAACAGAGGATGG - Intronic
1031160405 7:118160683-118160705 GCAGAGGGGTAGCAAGAGGAAGG + Intergenic
1031374510 7:121007786-121007808 AAAGAGAAGCAGCAACAGGATGG - Intronic
1031537417 7:122952438-122952460 GAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1031544707 7:123036467-123036489 GCAGGGGAGCTGAAAGAGGCTGG - Intergenic
1031798822 7:126215396-126215418 ACAGGAGAGCAGAAAGAGCATGG - Intergenic
1031854629 7:126907299-126907321 AGGGAGGAGGAGGAAGAGGAAGG + Intronic
1031985029 7:128158637-128158659 CCAGAGGAGGAGATGGAGGATGG - Intergenic
1032128596 7:129211850-129211872 TCGGAGGAGGAGGAAGAGGAAGG + Intronic
1032167467 7:129556701-129556723 CCAGAGGGGCAGAGAGAGGCTGG + Intergenic
1032377451 7:131435357-131435379 ACAAAGGAGAAGGAAGAGAAGGG - Intronic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1032523301 7:132562053-132562075 GAAGAGGAGGAGAAGGAGGAGGG - Intronic
1032786307 7:135203170-135203192 ACACTGGATCAGAAAGAGCATGG - Intronic
1032908543 7:136402211-136402233 ACAGAGTAGAAGCAAGAGAATGG - Intergenic
1033000831 7:137502541-137502563 GGAGAGGAGGAGAAAGGGGAAGG + Intronic
1033222205 7:139535666-139535688 CCAGAGGATCAGGAAGAGGATGG + Intronic
1033409501 7:141104483-141104505 ACAGAGCAGCAGATAGAGGGAGG - Intronic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033712015 7:143957229-143957251 GCAGAGCAGGAGAAGGAGGAAGG + Intergenic
1033786882 7:144742715-144742737 ATAGAGGAAAAGAAAGAGCAAGG + Intronic
1033989630 7:147267479-147267501 ACAGAACATCAGAGAGAGGAAGG - Intronic
1034024837 7:147689535-147689557 ACAGAGGAGCAGAAAGAAATCGG - Intronic
1034041719 7:147884744-147884766 ACAGAAGAGCAGTAAGATGACGG - Intronic
1034214840 7:149397544-149397566 AGAGAGGGGAAGAGAGAGGAGGG - Intergenic
1034220841 7:149444955-149444977 AAAGAGTAGCAGAAACAGGTGGG - Intronic
1034455221 7:151166679-151166701 ACAGAGGAGGAAAAAAATGAAGG + Intronic
1034785958 7:153925790-153925812 ACAGAGGCTCAGAAAGATTAGGG - Intronic
1034822194 7:154226386-154226408 GCAGAAGAGCAGAGAAAGGAAGG + Intronic
1034824636 7:154250534-154250556 ACACAGGATCAGAAAAAGTAAGG - Intronic
1034945491 7:155259169-155259191 AGAGAGGAGGAGGAAGAAGAAGG - Intergenic
1035305573 7:157929272-157929294 TCAGAGGAGCAGAGAGCGGATGG - Intronic
1035741483 8:1931122-1931144 ACCGTGGAGCAGAGACAGGACGG - Intronic
1035751400 8:1999245-1999267 ACAGAGGGACAGGAAGAGCAGGG + Intronic
1035958333 8:4108106-4108128 ACGGAGGAGGAGGAGGAGGAGGG + Intronic
1035989912 8:4478024-4478046 ACAGAGGAGATGAAAGTGAATGG - Intronic
1036371461 8:8166224-8166246 AGAGAGGTGGAGAAAGAGAAAGG + Intergenic
1036411501 8:8506173-8506195 ACAGAGCAGCAGAGAGCGGTGGG + Intergenic
1036444588 8:8810490-8810512 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1036459261 8:8937533-8937555 GCAGAAGAGGAGGAAGAGGAGGG + Intergenic
1036879442 8:12499420-12499442 AGAGAGGCGGAGAAAGAGAAAGG - Intergenic
1037313065 8:17576722-17576744 ACAGAGGAGCAGCAAGAACCCGG + Exonic
1037462948 8:19131504-19131526 AGAGAGGAGTAGAGGGAGGAAGG + Intergenic
1037620528 8:20559595-20559617 GCAGAAGTGCAGAAAGAGGCCGG + Intergenic
1037841638 8:22249253-22249275 ACAGAGGTGCAGGGCGAGGACGG + Exonic
1037894905 8:22645503-22645525 ACAGAAGGGAAGAAAGGGGAAGG + Intronic
1037911545 8:22746624-22746646 GGAGAGGAGGAGAGAGAGGAGGG - Intronic
1038133129 8:24756383-24756405 AGAGAAGAGGAGAAAGGGGAAGG + Intergenic
1038234321 8:25737198-25737220 GAAGAGGAAGAGAAAGAGGAGGG - Intergenic
1038245919 8:25855925-25855947 ACAGAATAGGAAAAAGAGGAAGG - Intronic
1038365461 8:26927522-26927544 AGAGAGCATCAGAAAAAGGAGGG + Intergenic
1038412713 8:27370587-27370609 GCAGATCAGCAGATAGAGGATGG - Intronic
1038591470 8:28842207-28842229 ACTGAGGAGGAGGAAGACGAGGG + Intronic
1038794749 8:30699951-30699973 AAAGAGAAGCTGTAAGAGGAGGG + Intronic
1038834910 8:31108806-31108828 GCAGAGGAGAAGGGAGAGGAAGG + Intronic
1038898324 8:31812667-31812689 AGAGAGGAGCAGCGAGGGGAGGG - Intronic
1038945041 8:32349836-32349858 ACAGAGAATCAGAAAGAAGATGG - Intronic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039390855 8:37179866-37179888 AGAGAGAAGAAGAAAGAAGAGGG - Intergenic
1039436179 8:37560894-37560916 AGAGAGGAGAAGGAGGAGGAGGG - Intergenic
1039439492 8:37584813-37584835 ACCGAGGCACAGAAAGATGAAGG - Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039560390 8:38507939-38507961 AGAGAGGAGAAGAGAGGGGAAGG - Intergenic
1039568648 8:38568761-38568783 ACAGTGGTGCAGAAATATGATGG + Intergenic
1040080714 8:43281680-43281702 ACAGACGGGCAGAAACAGAAAGG + Intergenic
1041108383 8:54463306-54463328 AAAGAGGAACAGGAGGAGGAAGG - Intergenic
1041120341 8:54580036-54580058 CCAGAGCAGCAGAAAAAGCAAGG + Intergenic
1041209160 8:55530102-55530124 AGAGAGGAAAAGAAAGAGGGAGG + Exonic
1041403354 8:57468299-57468321 ACAGAGGAGGAGAGAAAGGAGGG + Intergenic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1041821699 8:62042922-62042944 ACAGAAGAGGAGAAAGAGAAGGG + Intergenic
1042318959 8:67454954-67454976 ACAGAGGAGGGGAGAGAGCAGGG + Intronic
1042371071 8:67991182-67991204 ACAAAAGAGCAGTAAGAAGAAGG + Intronic
1042748302 8:72131540-72131562 AGAAAGGAGAAGAAAAAGGAAGG - Intergenic
1042758206 8:72241746-72241768 AGAGAGGGAGAGAAAGAGGAAGG + Intergenic
1043082708 8:75785374-75785396 TAAGAGGAGGAGAAAGAGGAGGG - Intergenic
1043438195 8:80254383-80254405 ATAGAGGAGAAGAATGAGGGTGG + Intergenic
1043656957 8:82679672-82679694 GAAGAGGAGAAGAAGGAGGAGGG + Intergenic
1043746925 8:83886131-83886153 ACTGAGGAGGAGGAAAAGGAAGG + Intergenic
1043754115 8:83980649-83980671 AGAGAGGAGGGGAAAAAGGATGG + Intergenic
1043956070 8:86360999-86361021 AAAGAGGAGAAGGAAGAGGTGGG + Intronic
1044643117 8:94406363-94406385 AGAAAGGAGAATAAAGAGGAGGG + Intronic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045149629 8:99389653-99389675 ACTGAGGAGGAGGAAGAGGAGGG + Intronic
1045755346 8:105534489-105534511 ACAGAGGAAGAGGAAGAGAAAGG - Intronic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1045958039 8:107932689-107932711 ACAGATGGGCAGAAAGGTGAGGG + Intronic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1046776007 8:118164096-118164118 AGGGAGGAGTAGGAAGAGGAGGG + Intergenic
1046927972 8:119813599-119813621 CCAGAGAAGGACAAAGAGGATGG + Intronic
1046969286 8:120203681-120203703 ACAGAGGACAAAAAAGAGAATGG - Intronic
1047035856 8:120937799-120937821 ACAAAGGATCAGAAAGTGGGTGG - Intergenic
1047278369 8:123423406-123423428 ACAGAAGAGAAGGAAAAGGAGGG - Intronic
1047322236 8:123797473-123797495 GAAGAGGAGGAGGAAGAGGAAGG - Intronic
1047414678 8:124654374-124654396 ACAGAGGTGGAGAGAGTGGATGG - Intronic
1047641201 8:126823607-126823629 GCAGAGAAAGAGAAAGAGGAGGG + Intergenic
1047665764 8:127089400-127089422 ACAGAGAAGCAGGAAAATGAGGG + Intergenic
1047955693 8:129973605-129973627 TGAGAGGAGACGAAAGAGGAAGG - Intronic
1048132924 8:131717512-131717534 AAAGAAGAGCAGAAAGAAGATGG + Intergenic
1048167649 8:132077545-132077567 ACAGATGGGAAGAAAGAGGTAGG + Intronic
1048208446 8:132434292-132434314 ACAGAGGAGGAGATGGATGATGG - Intronic
1048288393 8:133160932-133160954 AGAGAGAAGCAGAAAGAGTGAGG + Intergenic
1048366374 8:133742374-133742396 AGAGAGGAAGAGAAAGAGGGAGG + Intergenic
1048687034 8:136916428-136916450 ACAGAGGAGGAAAAAGAAAAGGG + Intergenic
1048898686 8:139017527-139017549 ACAGAGGAACACAGAGAGGCAGG + Intergenic
1049121970 8:140747505-140747527 GAAGAGGAGGAGGAAGAGGAGGG + Intronic
1049182664 8:141231015-141231037 ACAGGGGAGAAGAGAGAGGCCGG - Intronic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1049706238 8:144044198-144044220 ACAGGGGAGCAGAGAGAAGGTGG + Intronic
1049729742 8:144170165-144170187 AATGAGGAGGAGAGAGAGGAGGG + Intronic
1049816680 8:144606350-144606372 GCCGAGGAGAAGGAAGAGGAAGG - Intergenic
1050984103 9:12060109-12060131 AGAGAGGAGAATAAAGAAGATGG - Intergenic
1051148778 9:14058495-14058517 GCAGAGGAGGAGAAGGAGGGGGG + Intergenic
1051329448 9:16008595-16008617 ACAGGGGACCAGAAAGAGAGAGG - Intronic
1051437711 9:17051002-17051024 ACAGGGGACCAGGAAGAGGAAGG - Intergenic
1051544556 9:18259602-18259624 AGAGGGGAGCAGAAAGAGGAGGG - Intergenic
1051657320 9:19395542-19395564 AATGAGGAACAGGAAGAGGATGG - Intergenic
1051662117 9:19435409-19435431 ACACAGAAGGAAAAAGAGGAAGG + Intronic
1051804522 9:20977169-20977191 ACAGAGAACCAGAAAGATGATGG - Intronic
1051975712 9:22945945-22945967 ACAAGGGAGCAGAATGAAGAAGG - Intergenic
1052305669 9:27006636-27006658 AGAGAAGAGAAGAGAGAGGAGGG + Intronic
1052851931 9:33383805-33383827 CCAGAGGAGGAGACAGAGCAGGG - Intergenic
1052925916 9:34016216-34016238 GAAGAGGAGGAGGAAGAGGAAGG + Intronic
1052988956 9:34507523-34507545 GAAGAGGAGGAGAAAGAGGAGGG + Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053047906 9:34935846-34935868 ACAGATGAGGACAAAGAGGAGGG + Intergenic
1053084678 9:35208682-35208704 CCAGAACAGCACAAAGAGGATGG + Intronic
1053222977 9:36327006-36327028 TCAGGGGAGAAGACAGAGGAGGG + Intergenic
1053443843 9:38136495-38136517 AGAGAGGTTCAGAGAGAGGAAGG + Intergenic
1053680037 9:40480353-40480375 CCAGAGGAGGAGACAGAGCAGGG - Intergenic
1053930029 9:43108663-43108685 CCAGAGGAGGAGACAGAGCAGGG - Intergenic
1054283675 9:63144582-63144604 CCAGAGGAGGAGACAGAGCAGGG + Intergenic
1054391144 9:64620356-64620378 CCAGAGGAGGAGACAGAGCAGGG - Intergenic
1054504584 9:65895971-65895993 CCAGAGGAGGAGACAGAGCAGGG + Intergenic
1054797791 9:69318650-69318672 CCAGAGCAGGAGAAAGAGAAGGG + Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055527900 9:77153815-77153837 ACAGAGGAGGAGGAAGATCAAGG + Intergenic
1055781689 9:79828064-79828086 ACAGAGGACTAGAATGAGCAGGG + Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056543723 9:87595760-87595782 AAAGAGATGCAGAAAGAGAAGGG - Intronic
1056774019 9:89498301-89498323 AAAGAGGAGGAAAAAGAGAAGGG - Intergenic
1056945191 9:90988869-90988891 ACAAAGGAGTAGAAACATGAAGG - Intergenic
1057014060 9:91635022-91635044 GCGGAGGAGGAGGAAGAGGAGGG + Intronic
1057075711 9:92137166-92137188 ACAGAGCAGAGGACAGAGGAAGG + Intergenic
1057154330 9:92827228-92827250 AAAAAGGAGCAGACAGAGAAAGG - Intergenic
1057307890 9:93922759-93922781 ACAGAGAAGAAGGAAGAGGGAGG + Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057394482 9:94667535-94667557 ACAGAGAAACCAAAAGAGGACGG + Intergenic
1057725985 9:97568514-97568536 ACAGGGAAGCAGAAAGGGAAGGG + Intronic
1057850102 9:98559022-98559044 ACCGAGGCCCAGAAAGGGGAAGG - Intronic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058147295 9:101426151-101426173 ACAGTGGATCTGAAAGAGGGTGG - Intronic
1058483903 9:105424164-105424186 GAAGAGGACCAGAGAGAGGAGGG - Intronic
1058553233 9:106138181-106138203 GCAGAGGAGAAGGAAGAGGGAGG - Intergenic
1058671980 9:107367565-107367587 AAAGAGGAGGAGAGAGAGGCCGG - Intergenic
1058756143 9:108084718-108084740 GCAGAAGAGGAGGAAGAGGAGGG - Intergenic
1058874352 9:109230204-109230226 AAAGAGGAGCAGAAAGACCAAGG + Intronic
1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG + Intergenic
1059072427 9:111152831-111152853 AGGGAGGAGGAGGAAGAGGAAGG + Intergenic
1059336771 9:113573901-113573923 ACAGAGGAGTAGAAAGAGCAGGG + Intronic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059409726 9:114124365-114124387 AGAGAGGAGGAGGCAGAGGAGGG + Intergenic
1059431532 9:114253414-114253436 GAAGAGGAGAAAAAAGAGGAGGG + Intronic
1059705983 9:116823711-116823733 ACTGAGGATCAGAAAGGTGAGGG + Intronic
1059773144 9:117446819-117446841 ACTGAGGACCAGAAAGGGAAAGG - Intergenic
1060163004 9:121383943-121383965 TGAAAGGATCAGAAAGAGGAAGG + Intergenic
1060269755 9:122132097-122132119 ACGGAGGCTCAGAGAGAGGAAGG - Intergenic
1060481923 9:124021395-124021417 ACAGAGAAGCAGACACAGGGTGG - Intronic
1060492447 9:124094863-124094885 ACAGAGGAGCATAATTAGGAAGG + Intergenic
1060573686 9:124668287-124668309 AAAGAGGAGGAGGAAGAGAAGGG + Intronic
1060658572 9:125389255-125389277 ACAGAGGGGCAGCACGTGGAAGG - Intergenic
1060671338 9:125472282-125472304 GCAGAGCAGCAGAAAGAACAGGG - Intronic
1060699456 9:125738141-125738163 AAAGAAGAGGAGGAAGAGGAGGG + Intergenic
1060717586 9:125947210-125947232 ACAGGGGAGGAGATACAGGAAGG + Intronic
1060730435 9:126033644-126033666 ACAGAGGAGCAGAAACACCCAGG + Intergenic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1060865456 9:126991694-126991716 ACAGAGACACAGAAAGATGAGGG - Intronic
1061059140 9:128242042-128242064 ACAGAGTGGAAGACAGAGGAAGG - Intronic
1061246257 9:129402520-129402542 GCCGAGGAGGAGGAAGAGGAGGG - Intergenic
1061386039 9:130289874-130289896 ACAGATGAGAACACAGAGGATGG - Intronic
1061425237 9:130494358-130494380 ACAGAGGCACAGAGAGGGGAAGG + Intronic
1061555271 9:131364224-131364246 ACAAAAGAGCAGGAAGAGGCCGG - Intergenic
1062080828 9:134622551-134622573 AGAGAAGGGCAGACAGAGGAGGG - Intergenic
1062080858 9:134622650-134622672 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062080889 9:134622751-134622773 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062080920 9:134622850-134622872 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1203732497 Un_GL000216v2:103597-103619 ACGGGGGGGCAGAAAGAGGCTGG - Intergenic
1203612304 Un_KI270749v1:21085-21107 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1185501716 X:601800-601822 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185501748 X:602078-602100 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185545374 X:939477-939499 ACAGAGGAGAAAACAGAGAAAGG - Intergenic
1185595835 X:1306255-1306277 ACAGAGAAACAGAGAGAGGGAGG + Intronic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185701260 X:2232133-2232155 AGAGAGGAGGAGAAAGAGGAAGG - Intronic
1185969627 X:4648013-4648035 ACAGAGGAGCACAAGGTAGAAGG + Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186168729 X:6855107-6855129 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1186379320 X:9040483-9040505 ACAGTAGAGATGAAAGAGGAGGG - Intronic
1186459941 X:9740007-9740029 ACAGAGGACAAGAGAGAGGAGGG + Intronic
1186535550 X:10343625-10343647 ACAGACAAGCAGAAAGAACATGG + Intergenic
1186960418 X:14730568-14730590 ACAGAGGAGAAGATTGAGGGAGG + Exonic
1187163972 X:16787362-16787384 AAAGAGGGGAAAAAAGAGGAGGG - Intronic
1187579809 X:20595557-20595579 ACAGAGGAGGAAAAAGTGAATGG + Intergenic
1187619617 X:21036800-21036822 CCAGAGCAGGAGCAAGAGGAGGG + Intergenic
1187620089 X:21042959-21042981 GCTGAGGAGTAGGAAGAGGAGGG + Intergenic
1188548093 X:31332420-31332442 AGAGAGGAGTAGAGAGAGAAGGG + Intronic
1188642252 X:32520924-32520946 AGAGAGCTGCAGAAAGAGGATGG - Intronic
1188909707 X:35831634-35831656 ACAGAGTGGTAGAATGAGGAAGG - Intergenic
1189010081 X:37038263-37038285 ACAAAGGAGCAGAGAGAGGCTGG + Intergenic
1189038503 X:37517467-37517489 ACAAAGGAGCAGAGAGAGGCTGG - Intronic
1189110758 X:38286567-38286589 AGAGGGGAGGAAAAAGAGGAGGG - Exonic
1189224338 X:39399982-39400004 ACATAGTAGCAGAAACAGGTTGG - Intergenic
1189235673 X:39485067-39485089 AGAGAAGACGAGAAAGAGGAGGG - Intergenic
1189264062 X:39700105-39700127 ACAGAGGGGCAGGGACAGGAAGG + Intergenic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1189646244 X:43135795-43135817 ACAGAGGAACAGAGAAAGGAGGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189725701 X:43966339-43966361 AAAGAGGAGGAGGAGGAGGAAGG + Intronic
1189848406 X:45157023-45157045 AGAGAGGAGCTGGAAAAGGAGGG - Intronic
1190326327 X:49209311-49209333 ACAGAGGAGGAGGAAGAAGAGGG - Exonic
1190393097 X:49952175-49952197 AGAAAGGGGCAGAAAGAGGCTGG + Intronic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1190591237 X:52003859-52003881 ACAGAGGTGAAGAAAGGGGTAGG + Intergenic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190753551 X:53381888-53381910 AAAGGGGAGGAGAATGAGGAAGG + Intronic
1190795039 X:53733056-53733078 ACTGAGGAGGAGGAAGAAGAGGG - Intergenic
1191104202 X:56762334-56762356 AGAGAGGAGGAGGAGGAGGAGGG - Intergenic
1191641646 X:63433643-63433665 TCAGAGGAGGAGGAGGAGGAGGG + Intergenic
1191672650 X:63762839-63762861 TAAGAGGAGAAGGAAGAGGAGGG - Intronic
1191730094 X:64324385-64324407 AGAGAAGAGAAGAAAGAGGACGG + Intronic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1191848794 X:65570394-65570416 AGAGAGGAGCAGAAAAAGAGAGG + Intergenic
1191882834 X:65859733-65859755 ACTCAGGAGCAGTAAGAGGGAGG - Intergenic
1192005602 X:67208750-67208772 AATGAGGTCCAGAAAGAGGAAGG - Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192539931 X:71959165-71959187 CCAGAGGATAGGAAAGAGGATGG + Intergenic
1192559123 X:72113886-72113908 ACTGAGGGTCAGAAAGAGGAAGG - Intergenic
1193364027 X:80608885-80608907 ACAGAGAAGAAGAGAAAGGATGG + Intergenic
1193832287 X:86304242-86304264 ACAGAGGAGTAGTCAGGGGAAGG - Intronic
1194268082 X:91779301-91779323 ACCGAGGGGGAGAAAGGGGAAGG - Intronic
1194277860 X:91909336-91909358 ACAGAGGATCAGGAAGGAGAGGG - Intronic
1194312594 X:92331349-92331371 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1195263357 X:103155962-103155984 GAAGAGGAGGAGCAAGAGGAGGG - Intergenic
1195412063 X:104578208-104578230 GCAGAGAAGCAAAAAGATGAGGG + Intronic
1195431238 X:104791770-104791792 ACTGAGGTTCAGTAAGAGGAAGG - Intronic
1195431276 X:104792137-104792159 ACTGAGGTTCAGAAAGAGGAAGG + Intronic
1195539466 X:106046184-106046206 ACAGGGGAACAGAAAGAGTCGGG - Intergenic
1195668370 X:107449975-107449997 GAAGAGGAGGAGGAAGAGGAGGG + Intergenic
1195727760 X:107935649-107935671 AAAGGGGAGAAAAAAGAGGATGG - Intergenic
1195793286 X:108614436-108614458 ACAGAGGGACAGACAGAAGATGG + Intronic
1195873635 X:109514580-109514602 ACTGAGGAGGAGGAAGAGGAAGG + Intergenic
1196050325 X:111297596-111297618 ACTGTGGAGGAGAAGGAGGAAGG + Exonic
1196311944 X:114178663-114178685 GCAGAGGAGAAGGAAGAAGAGGG - Intergenic
1196908288 X:120460289-120460311 AACGAGGAGGAGGAAGAGGAGGG + Intronic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197840892 X:130745294-130745316 ACAGAGGAAAGAAAAGAGGAGGG - Intronic
1197854041 X:130895697-130895719 ACAGAGCACCAGAAAGGGGAGGG + Intronic
1198606073 X:138339220-138339242 ACAGAGGAGAAGGAAGTGAAAGG - Intergenic
1198693812 X:139314004-139314026 ACAGAGGAGGAAGAAGAGGAAGG - Intergenic
1198921892 X:141738373-141738395 TGAGAGGAGCAGAAAGTGGAGGG - Intergenic
1199351103 X:146802005-146802027 CCAGAAGACCAGAAAAAGGATGG + Intergenic
1199352804 X:146822488-146822510 CCAGAAGACCAGAAAAAGGATGG - Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199613904 X:149640110-149640132 ACATGGGAGCAGAATGAGGCTGG - Intergenic
1199796957 X:151208053-151208075 ACAGAGTAACAGAAACAGCATGG - Intergenic
1199814933 X:151388794-151388816 GCAGAGGAGCAGAAACAGGGTGG + Intergenic
1199818891 X:151424732-151424754 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1200267943 X:154655890-154655912 ACAGAGGCGCAGGAGGAGGCCGG - Intergenic
1200585284 Y:5000222-5000244 ACAGAGGGGGAGAAAGGGGAAGG - Intronic
1200595195 Y:5131410-5131432 ACAGAGGATCAGGAAGGAGAGGG - Intronic
1200620857 Y:5445495-5445517 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1201266277 Y:12210275-12210297 ACAGATGAGGAGGAGGAGGAGGG + Intergenic
1201559133 Y:15297528-15297550 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1201607306 Y:15801111-15801133 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1201652669 Y:16307574-16307596 ACAGAGGAGAAGAGGGAGGGTGG + Intergenic
1201735799 Y:17260211-17260233 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic