ID: 1116900295

View in Genome Browser
Species Human (GRCh38)
Location 14:50356081-50356103
Sequence GGGTAAGTATACTAACCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116900295 Original CRISPR GGGTAAGTATACTAACCTAA GGG Intronic
908650254 1:66325137-66325159 GAGTAAGTATGCTAACTTAAAGG + Intronic
909158169 1:72108108-72108130 GGGTAAGTAAAGTAACTGAATGG + Intronic
911071386 1:93834529-93834551 GGGTAAGAATTCTAACCACACGG - Intronic
912595267 1:110869604-110869626 GGGTAAGTATAGTGACCAACAGG - Intergenic
914400892 1:147318915-147318937 GGGGAAATTTACTAACCAAATGG + Intergenic
918601394 1:186366940-186366962 GGGAAAGTATACTTAACTAATGG + Intronic
919497460 1:198291776-198291798 TGGAAACTATACTAAGCTAAAGG - Intronic
923858772 1:237872051-237872073 GGGCAGGTGTTCTAACCTAAAGG + Intergenic
1087113313 11:94494575-94494597 GGGTATGTTTCCTAACTTAAAGG - Intronic
1088801858 11:113314248-113314270 GGGCAAGGATATTAAGCTAACGG + Intergenic
1092836177 12:12490984-12491006 TGGTAAGTATACTATTCAAATGG + Intronic
1094389829 12:29936835-29936857 TCGTAAGTATACAAACATAAAGG + Intergenic
1104172799 12:126298737-126298759 GGGTAAATATGCTTCCCTAATGG - Intergenic
1104573714 12:129947861-129947883 TGCTAAGTATAATAAACTAAAGG + Intergenic
1108615339 13:52127415-52127437 GGGAAAGCATACTTAGCTAAAGG - Exonic
1115514560 14:34172783-34172805 GGGCAAGTAGACTAACCCCATGG - Intronic
1116900295 14:50356081-50356103 GGGTAAGTATACTAACCTAAGGG + Intronic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1124630430 15:31333757-31333779 GGGAAACTATCCTAAACTAAGGG - Intronic
1127200567 15:56645249-56645271 TGGAAAGTATAATTACCTAATGG - Intronic
1136853208 16:33630725-33630747 GGGGAATTATACCCACCTAAAGG - Intergenic
1141024569 16:80533354-80533376 GGGTAAAGAGACTAATCTAAGGG - Intergenic
1203114805 16_KI270728v1_random:1479167-1479189 GGGGAATTATACCCACCTAAAGG - Intergenic
1143811559 17:9475877-9475899 GGGTAAATAAACTTGCCTAAAGG + Intronic
1146244340 17:31266202-31266224 ATGTAAGTCTACTAACTTAATGG - Intronic
936254154 2:110895255-110895277 GGAAAAATATATTAACCTAAAGG + Intronic
940595961 2:155793505-155793527 TGGTAAGTATACTATTCTAGTGG + Intergenic
941198011 2:162474163-162474185 GGGAAAGTTTGCTAACCTCATGG - Intronic
941376147 2:164733282-164733304 GGTTAAGAATATTAACATAATGG + Intronic
941555193 2:166970170-166970192 GGGTAAAAATACTAAGCTGAAGG - Intronic
945592036 2:211745744-211745766 AGATAAGTATACTTACCTAAGGG - Intronic
1170005889 20:11668368-11668390 GGGTAAGAGTACTGACCCAACGG - Intergenic
950875454 3:16267394-16267416 GGGTAAGAATTTTATCCTAAGGG - Intronic
961904501 3:130248581-130248603 GGGAAAGATTACTTACCTAAAGG - Intergenic
964519036 3:157543503-157543525 GGGGCAGTTTACTAACCTCAAGG - Exonic
974730388 4:65856979-65857001 GTGTAATTACACAAACCTAATGG + Intergenic
977364364 4:96048530-96048552 AGGTAAGTATACAAGCCTATGGG + Intergenic
978116142 4:105022408-105022430 AGGGAAGTATACTCCCCTAAGGG + Intergenic
979110879 4:116754407-116754429 AGGTAAGTAGACTATCCAAAAGG + Intergenic
979890023 4:126080419-126080441 GAGCACGTGTACTAACCTAAAGG - Intergenic
982873183 4:160609903-160609925 GTGTAAATATACTAACATCACGG - Intergenic
986792255 5:11173391-11173413 GGGTTAGTATACTGATCTAGAGG - Intronic
987209500 5:15665303-15665325 GGGTTAGTTTACAAAGCTAAAGG - Intronic
988478331 5:31607890-31607912 GTGTATGTAAAGTAACCTAATGG + Intergenic
991048684 5:62249494-62249516 GGGGAATTATACCCACCTAAAGG + Intergenic
992103299 5:73428149-73428171 GGGTAAGTAGACAAAGCCAATGG + Intergenic
993602837 5:89949911-89949933 GGGTAAGTATTCTAAACTAAGGG + Intergenic
994573439 5:101543502-101543524 GAGTAAGTAGAATAATCTAAAGG - Intergenic
1000437801 5:161234615-161234637 GGGTAATGATAATTACCTAATGG - Intergenic
1011909232 6:92414623-92414645 TGGTAAGAATACTAACATAGAGG - Intergenic
1012406344 6:98904037-98904059 GGGTAATTAAAATACCCTAATGG + Intronic
1015778056 6:136834656-136834678 GGGTAAGGATCATATCCTAATGG + Intronic
1021612735 7:22473965-22473987 AGGTAAGTGTATTAACCTATTGG + Intronic
1030542975 7:110856343-110856365 TTGTAAGTATACTTAGCTAAGGG + Intronic
1045261458 8:100578627-100578649 CATTAAGAATACTAACCTAAAGG - Intronic
1046159563 8:110342455-110342477 GTGTCAGTAAACTAACCTACAGG + Intergenic
1189066185 X:37811779-37811801 GGCTAAGGATACTAACCAATAGG + Exonic
1200749664 Y:6933343-6933365 AGGCAAGTATAATAGCCTAATGG + Intronic