ID: 1116902640

View in Genome Browser
Species Human (GRCh38)
Location 14:50376576-50376598
Sequence ATGTTATTGCTGAGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116902638_1116902640 1 Left 1116902638 14:50376552-50376574 CCTATCTATTGGCTGATGACCAT 0: 1
1: 0
2: 1
3: 6
4: 88
Right 1116902640 14:50376576-50376598 ATGTTATTGCTGAGTGAAGAAGG 0: 1
1: 0
2: 4
3: 21
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116902640 Original CRISPR ATGTTATTGCTGAGTGAAGA AGG Intronic
903390034 1:22957386-22957408 ATGAAATTGCTGAGTCAAGGGGG + Intronic
904316445 1:29669197-29669219 CTGTTAGAGCTGAGTGAAGTTGG - Intergenic
905251388 1:36650996-36651018 ATGTCCTTGCTCTGTGAAGATGG + Intergenic
910751706 1:90638090-90638112 ATGTGACTGCTGTTTGAAGATGG + Intergenic
911513307 1:98835222-98835244 ATGTTTAAGCTTAGTGAAGAAGG - Intergenic
913558065 1:119989141-119989163 ATGCAATAGCTGAGTGAATATGG + Intronic
915924686 1:160007301-160007323 ATGTTACAGCTGAGGGAAGTGGG + Intergenic
916486440 1:165263952-165263974 ATGGTAGTGCTGAATGAAGAAGG + Intronic
916622503 1:166515728-166515750 ATTTTTCTGCTGATTGAAGAAGG + Intergenic
919323341 1:196071818-196071840 ATATTATTGCTTAGTTAAAAAGG + Intergenic
919571885 1:199259360-199259382 ATGATGCTGTTGAGTGAAGAAGG - Intergenic
921202192 1:212817990-212818012 ATGTTATCTTTGAGTGAAGTGGG - Intergenic
922004472 1:221515728-221515750 ATGCCATTGGTGAGAGAAGATGG + Intergenic
922495731 1:226056362-226056384 ATGATTTTGCTTAGTGAGGAAGG - Intergenic
1064973179 10:21086975-21086997 ATGGTTCTGCTGAGTGTAGATGG - Intronic
1065263750 10:23954097-23954119 ATGTTCTTGCTCAGTGGATATGG - Intronic
1066073435 10:31846472-31846494 ATATTTTTGCTGGGTGCAGAAGG + Intronic
1066520430 10:36212402-36212424 ATGTAATTGCAGAGTCTAGAAGG + Intergenic
1067493913 10:46744738-46744760 ATGTTATTGCTTAATGACAAAGG - Intergenic
1067600746 10:47595666-47595688 ATGTTATTGCTTAATGACAAAGG + Intergenic
1067802244 10:49366902-49366924 ATTTTATTGCTTTGTGAAGCTGG + Intronic
1068064656 10:52114119-52114141 ATGTTATTGCTCAGTTTAGGTGG + Intronic
1068068858 10:52169986-52170008 ATGTTATTTCTTGGTTAAGAAGG + Intronic
1068238182 10:54265676-54265698 ATGTTATTGCTTAATGACAAAGG + Intronic
1071318276 10:84424843-84424865 ATGTAAGCACTGAGTGAAGATGG + Intronic
1071982914 10:91021915-91021937 ATGCTGAGGCTGAGTGAAGAAGG - Intergenic
1072481239 10:95810619-95810641 ATTTTGTACCTGAGTGAAGAAGG - Intronic
1073878554 10:107952593-107952615 ACGTTGTTGCTGAGTCAGGAGGG + Intergenic
1074118281 10:110474158-110474180 ATGTTATTGTTTATTGCAGAGGG - Intergenic
1074175191 10:110993195-110993217 ATTTTATTTCTTAGTCAAGATGG + Intronic
1079010567 11:16824838-16824860 ACGTTACTGCTGAGTGAGGTTGG - Intronic
1079029371 11:16974513-16974535 ATGTTATCACTGAGGGAAGCTGG - Intronic
1080007832 11:27428557-27428579 AAGTGATTGCAGAGTCAAGAAGG + Intronic
1083917624 11:65759311-65759333 ATGTTATTGTTGAGGGAAACAGG - Intergenic
1084162714 11:67358655-67358677 ATGTTATTGCTGAGTGAGTAGGG - Intronic
1086152914 11:83632541-83632563 ATGTTATAGTTGAGTGTTGATGG + Intronic
1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088461965 11:110092553-110092575 GTGTTACTGCTGGGTGGAGAAGG + Intergenic
1089031037 11:115329769-115329791 ATTTTATTGCTGGATGGAGATGG + Intronic
1089111476 11:116061375-116061397 ATGATTTTGCTAAGTGAAGGTGG + Intergenic
1089218703 11:116852655-116852677 ATGTTATTTCTGAGTGCATAAGG + Intronic
1092204144 12:6605640-6605662 ATGTAATAGCCTAGTGAAGAGGG - Intronic
1094019076 12:25895115-25895137 ATGTTTCTGCTGAGTGATGAGGG + Intergenic
1096197129 12:49655917-49655939 CTGTTATTGGTGAGGGGAGAAGG - Intronic
1096616375 12:52835470-52835492 ATCTTCTTGCTGAGAGAAGGGGG - Intergenic
1097652297 12:62315942-62315964 ATGTTCTAGCTAAATGAAGAGGG - Intronic
1098099635 12:67001056-67001078 ACATAATTGCTAAGTGAAGATGG - Intergenic
1099316782 12:81093681-81093703 ATGTTATTACTGGGGGAAGCTGG - Intronic
1099540015 12:83896045-83896067 TTGTTATAGCAGAGTGAAAATGG + Intergenic
1105394590 13:20018070-20018092 TTGTTATTGCTGAGTGGATATGG + Intronic
1107500393 13:40968030-40968052 ATGTTGTTGCTAAGTGTGGATGG - Intronic
1107811655 13:44206468-44206490 TTGTTACTGCTGGGTGAAGATGG + Intergenic
1108896778 13:55339064-55339086 CTGTTATGCCTGAATGAAGAAGG - Intergenic
1108993784 13:56698744-56698766 AAATAAGTGCTGAGTGAAGAAGG - Intergenic
1110597999 13:77340151-77340173 ATTTTATTGTTGAGTTAGGAAGG - Intergenic
1111040888 13:82745991-82746013 GTGTTATAGCTGAGTGAAACTGG + Intergenic
1113333681 13:109357298-109357320 ATATTCTTTCTGAATGAAGAAGG + Intergenic
1113906184 13:113820263-113820285 CAGTCATTGCTGAGTGAGGAGGG - Intergenic
1116902640 14:50376576-50376598 ATGTTATTGCTGAGTGAAGAAGG + Intronic
1118285064 14:64464005-64464027 ACGTGTTTGCTGAGTGAACAAGG + Intronic
1119202510 14:72767043-72767065 TTGTTGTTGCTGAGTGGAGGTGG - Intronic
1120919968 14:89745649-89745671 AGGTAATTGCTGAGGGAAAAGGG + Intergenic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1126192836 15:45896698-45896720 ATTTGATTTCTCAGTGAAGAAGG - Intergenic
1127394536 15:58533650-58533672 ATGATAATGATAAGTGAAGAAGG + Intronic
1130769426 15:86909753-86909775 ATGTAATTGCTGAGAGAGGTGGG + Intronic
1131082672 15:89549873-89549895 ATGCTATTTCTGAATAAAGAGGG + Intergenic
1133475541 16:6118088-6118110 ATGTTAATACTCAGAGAAGATGG - Intronic
1134347465 16:13404155-13404177 TTGTTATTGTTGAGTGAAGAAGG - Intergenic
1135842881 16:25892781-25892803 ATCTTATGGATGAGTTAAGAAGG - Intronic
1136591633 16:31221297-31221319 AGGGCATTGCTGAGAGAAGAAGG + Intronic
1136591753 16:31221809-31221831 AGGGTATTGCTGGGAGAAGAAGG + Intronic
1139749827 16:69102865-69102887 ATGTTGCTGCTGAGTGAGGACGG + Intergenic
1142982031 17:3677906-3677928 AGCTTTTTGCTGAGTGAGGAGGG - Intronic
1143208957 17:5169016-5169038 ATGTTAGCGCTGAGTGAGGATGG - Exonic
1144274585 17:13653470-13653492 AGGTTATTGCAGGGTGTAGATGG - Intergenic
1144618448 17:16798491-16798513 ATGTTAGCGCTGAGTGAGGATGG - Intronic
1144894258 17:18517202-18517224 ATGTTAGCGCTGAGTGAGGATGG + Intergenic
1145137973 17:20427040-20427062 ATGTTAGCGCTGAGTGAGGATGG - Intergenic
1149531119 17:57396054-57396076 GTGTTCTTGGGGAGTGAAGATGG + Intronic
1149871173 17:60183182-60183204 ATGTTAGCGCTGAGTGAGGATGG + Exonic
1152394797 17:80025797-80025819 CTGTTCCTGCTGTGTGAAGAAGG - Intronic
1153107057 18:1540113-1540135 ATTTTATTGCTCAGGGGAGATGG + Intergenic
1153492873 18:5667694-5667716 ATGTTATGTCTCAGAGAAGAGGG + Intergenic
1155207492 18:23573359-23573381 ATGTTATTGCAGGGTGGAGGTGG - Intronic
1155627167 18:27847702-27847724 CTGTTACTGCTGGGTAAAGAAGG - Intergenic
1156348229 18:36278479-36278501 ATGTTATTTGTGAATGAAAATGG - Intergenic
1156621604 18:38858000-38858022 TTGTTATTGCTGGGTGAAGGTGG - Intergenic
1161412069 19:4122616-4122638 ATGTCCTTGCAGAGAGAAGATGG - Intronic
1165701239 19:37939791-37939813 ATTTGATTGCTAAGTGAAAAGGG + Intronic
1166523092 19:43494647-43494669 ATCTTATTGGTCAGTGAGGAGGG - Intronic
1166760021 19:45218366-45218388 AACTTATTCCTAAGTGAAGAGGG - Intronic
1166922748 19:46241594-46241616 ATGTGACTTCTGATTGAAGACGG - Intergenic
1168451026 19:56466764-56466786 ATGTTATCTCTGAGTAAAGTGGG - Intronic
926770375 2:16367328-16367350 ATGTTAGTGTTAAGTGGAGAAGG - Intergenic
927586199 2:24308005-24308027 AATTTCTTGCTGAGTGAAGAGGG + Intronic
928158426 2:28897562-28897584 ATGTTATTATTGAGTGAATCTGG + Intronic
928620080 2:33079983-33080005 ATGATATTACTGTGTTAAGAAGG + Intronic
928852088 2:35760402-35760424 ATGATTATGCTTAGTGAAGAAGG + Intergenic
931710355 2:64984818-64984840 ATGTTACTGTGGATTGAAGATGG + Intergenic
937385747 2:121430651-121430673 CTGTGATGGCTGAGTTAAGAAGG - Intronic
937965757 2:127508394-127508416 TTGTGATGGCTGAGTTAAGACGG + Intronic
939561826 2:143741462-143741484 ATTTTTTTTCTGAGTGAAGAAGG + Intronic
942161601 2:173194714-173194736 ATGTGACTGCTGTGTGTAGAGGG - Intronic
1168776230 20:449784-449806 ATGTTGTTTCAGAGTGAGGAGGG - Intronic
1170033854 20:11969803-11969825 AAGTCATTGCTGAGTGAAAGTGG + Intergenic
1170078079 20:12442257-12442279 ATGTTACTACTGTGTGAAGCTGG - Intergenic
1170736740 20:19019447-19019469 AGGTTATAGCTCAGTCAAGAGGG + Intergenic
1170877070 20:20259855-20259877 GAGTTATTGCTGAGTGATGGTGG + Intronic
1171274312 20:23842617-23842639 ATGTCATGGCTCAGAGAAGAGGG - Intergenic
1173175073 20:40758762-40758784 GTGTTATTGATAAATGAAGATGG - Intergenic
1174065393 20:47860924-47860946 ATGTGTTTGGTGAGTGAGGAGGG - Intergenic
1174815237 20:53681572-53681594 ATTTTATAGCTGAGGGAACAGGG - Intergenic
1175784937 20:61706414-61706436 ATGTTATTGTTGAGAGAAGGGGG - Intronic
1177670298 21:24215954-24215976 ATGTGAATGCTGAGTAAAAAAGG - Intergenic
1177822350 21:26045170-26045192 ATTTTATTCCTGAGGGAAGATGG + Intronic
1178456988 21:32764221-32764243 ATGACATTGCTGTTTGAAGAGGG - Intronic
1179119128 21:38526679-38526701 ATGTTATTTCTGAGTGAGGAGGG + Intronic
1181457148 22:23066262-23066284 GTGTCATTGCTGAGTCAGGATGG + Intronic
1182241032 22:28916378-28916400 ATGTAATTGCTGTCTGGAGAGGG + Intronic
1182805390 22:33065629-33065651 ACATTATTGCTGAATGAATAAGG + Intergenic
1183457956 22:37932953-37932975 CTGTTACTGATGAGGGAAGAGGG - Intronic
1183668545 22:39258602-39258624 AAGTTATTGATTTGTGAAGATGG - Intergenic
1184748471 22:46470479-46470501 GTTTTATCCCTGAGTGAAGATGG - Intronic
1184992109 22:48177697-48177719 ATGTTGTTGTTGAGGGATGAAGG - Intergenic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
950725777 3:14915970-14915992 ATGTTATTGCCATGTGGAGAGGG + Intronic
951492375 3:23285866-23285888 ATGTTATTTTTTAGTCAAGAGGG + Intronic
951610280 3:24484193-24484215 ATTTTATTTTTGAGTGCAGATGG + Intronic
952600922 3:35081997-35082019 AAAGTATTGCTGAGTGAAGTGGG - Intergenic
954975154 3:54686737-54686759 ATGTCATAGCTCTGTGAAGATGG + Intronic
956985771 3:74698473-74698495 ACGTTACTGCAGAGTGAAGGGGG - Intergenic
957832174 3:85535884-85535906 ATGGTAATGCTGTGTGTAGAAGG + Intronic
957848898 3:85779505-85779527 TTGTTGTTGCTATGTGAAGAAGG - Intronic
958657586 3:97021992-97022014 ATTTTAGTGATGAGTGAACAGGG - Intronic
959693339 3:109223205-109223227 ATGGAATTGCTGAGTGGAAATGG - Intergenic
960284342 3:115810469-115810491 ATGTTATAGCTGACTGCTGATGG + Intronic
960401203 3:117201253-117201275 CTGTTATTGCAGAGAGCAGAAGG + Intergenic
964012294 3:151905277-151905299 CTTTTCTTGCTGAGTGAAGCAGG - Intergenic
964402324 3:156312183-156312205 ATGCTATTGCTGAGTAAAATAGG + Intronic
965005406 3:163016449-163016471 ATGATTTAGCTTAGTGAAGAGGG + Intergenic
968111271 3:196048845-196048867 ATGCTATTGCTTAGTGAAAGAGG + Intronic
968471355 4:783936-783958 TTGTTACAGCTGAGTGAGGAAGG - Intergenic
970427581 4:15959650-15959672 ATTTAATTGCTGAGTGTACAGGG + Intergenic
970472432 4:16392306-16392328 ATGTTACTGCTGGGTGAATGGGG + Intergenic
971081131 4:23212609-23212631 AAGTGAGTGCTGAGTGAAGGAGG + Intergenic
972591533 4:40492746-40492768 ATGGGAGTGCTGAGTGAACAGGG - Intronic
972681467 4:41310639-41310661 AAGTGAGTGCTGAGTGAAGTGGG + Intergenic
974414352 4:61586200-61586222 ATGAAATTGATGAGTCAAGAGGG - Intronic
975600325 4:76093111-76093133 ATGCTGTTTCTGACTGAAGATGG - Intronic
979102360 4:116635824-116635846 GTGTTATTATTGAGTAAAGAGGG - Intergenic
979136498 4:117117644-117117666 ATGTTCATGCTGAGAGAAGTGGG + Intergenic
979383627 4:120037649-120037671 ATGTTATTGAAAAGTGGAGAGGG + Intergenic
980055664 4:128077021-128077043 ATATTATCGGTGAGTAAAGATGG - Intronic
981010927 4:139924016-139924038 ATGTTTCTGCTGAGTGGAGATGG - Intronic
981933780 4:150217666-150217688 ATTTTACTGAGGAGTGAAGAGGG + Intronic
982875459 4:160642652-160642674 AGGCTATTTATGAGTGAAGAGGG + Intergenic
984868876 4:184309953-184309975 ATTTCAGTGCTGAGTGAAAAGGG - Intergenic
984869050 4:184310836-184310858 TTGTTATTGTTGAGGGAATATGG - Intergenic
987181659 5:15374242-15374264 TTCTTATTGCTGCCTGAAGATGG - Intergenic
990876251 5:60489728-60489750 ATGTTATCTCTGAGTAAAGGGGG - Intronic
990987273 5:61652329-61652351 CTGTCATTGCTGATAGAAGATGG + Intronic
992144649 5:73833799-73833821 AAATGAGTGCTGAGTGAAGAGGG + Intronic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
992464179 5:76987572-76987594 ATGTTATTGATGAGTGCAGTGGG + Intergenic
993249490 5:85500206-85500228 ATGATATTTCTGGGAGAAGAAGG - Intergenic
994435425 5:99724441-99724463 AAATTATTGCTGAATGAATATGG + Intergenic
994625939 5:102219099-102219121 ATGTTTGAGCTTAGTGAAGAAGG - Intergenic
995693867 5:114858015-114858037 CTGTTCTTGCTCTGTGAAGACGG + Intergenic
996272191 5:121619475-121619497 ATAATAATGCTGAGTGAAAAAGG + Intergenic
996696981 5:126408470-126408492 ATGGGATTGCTGAGTCAAAATGG + Intronic
996819589 5:127611822-127611844 AGGTTATTGCAGATTGAATATGG - Intergenic
1000369788 5:160523779-160523801 TGGTTATTGCTGATTGGAGAGGG + Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1003397828 6:5768433-5768455 AAGTTATTGCCAATTGAAGATGG - Intronic
1003995509 6:11537006-11537028 AAGTTCTTGCTGCGGGAAGAGGG + Intergenic
1004492781 6:16131861-16131883 ATTTTGTTTCTGAATGAAGATGG + Intronic
1005404496 6:25471885-25471907 ATTTTACTGCTAAGTGAGGAGGG + Intronic
1005431771 6:25764912-25764934 ATGTTATTGCAGAATTAAAATGG + Intronic
1005941871 6:30566570-30566592 ATTGAATTGCTAAGTGAAGAAGG + Intergenic
1007837299 6:44683567-44683589 GTCTTGTTGCTGAGTGCAGATGG + Intergenic
1009654354 6:66521809-66521831 ATGTTTTTAATGAGTGCAGATGG - Intergenic
1010937265 6:81877053-81877075 TAGTGATTGCTGAGTGAAGAAGG + Intergenic
1012831920 6:104214619-104214641 GGGTTTTTGCTAAGTGAAGAAGG - Intergenic
1013480126 6:110545744-110545766 ATGTGATAGCTAAGTGAAGGAGG - Intergenic
1016754054 6:147664096-147664118 GTTTTATTGTTGAGTGAAGGTGG - Intronic
1017700759 6:157067838-157067860 ATGTAATTGCAGAGTGTACATGG + Intronic
1021358101 7:19678783-19678805 ATGATTTTGATGAGAGAAGAAGG - Intergenic
1022138521 7:27471974-27471996 ATGTTATTGATCAGTGAGGTAGG - Intergenic
1022202237 7:28127773-28127795 TTGCTATTGCCGTGTGAAGAAGG - Intronic
1027452892 7:78353076-78353098 ATGTTATTGCTGAGTGCAGGAGG + Intronic
1028349897 7:89833345-89833367 ATGTTATTTATGAGTGAAAAAGG + Intergenic
1029950002 7:104573767-104573789 ATGATAATGTTGAGAGAAGAGGG - Intronic
1030109420 7:106013721-106013743 ATGTTCTTGGGGATTGAAGAAGG - Intronic
1030183940 7:106740766-106740788 AGCTTATTGATGAGTAAAGAAGG - Intergenic
1032729681 7:134627290-134627312 AAGTGATTGCTTAGTGAATAGGG - Intergenic
1033795049 7:144836233-144836255 TTGTTAAAGCTGAGTGCAGAGGG - Intronic
1034790056 7:153959900-153959922 ATGATTATGCTGAGTGAGGAAGG - Intronic
1035571877 8:677828-677850 GTGTTCTTGCTGGGTGATGAGGG - Intronic
1038980937 8:32758924-32758946 ATGGTATTGCAAGGTGAAGAAGG - Intronic
1039306325 8:36267298-36267320 ATTTTATTGCTGAATGGAGGTGG + Intergenic
1041403275 8:57467191-57467213 CTGTAATTGTTGAATGAAGATGG - Intergenic
1042845511 8:73166356-73166378 ATGTTATTTTTGCATGAAGATGG - Intergenic
1043603862 8:81975298-81975320 ACATTATTGATGAGTGAATACGG + Intergenic
1043688907 8:83125710-83125732 ATGTTATCTCTGAGTAAAGTAGG + Intergenic
1045098161 8:98819838-98819860 ATATTATTGCAGGGAGAAGAGGG - Intronic
1046002821 8:108442654-108442676 AAGTTATTGGTCAGTAAAGAAGG - Intergenic
1046049237 8:109001536-109001558 TTGTTATTGCTGTTGGAAGATGG - Intergenic
1046355113 8:113072928-113072950 TTGTTATTGTTGAGTAAGGATGG - Intronic
1047776511 8:128075711-128075733 AATATATTGCTGAGTGAAAAGGG - Intergenic
1051405162 9:16729361-16729383 TTGTTATTCTTGAGTTAAGAAGG - Intronic
1052722040 9:32183691-32183713 ATGTTATTGATGAATTAAGGAGG + Intergenic
1054971035 9:71087132-71087154 AAGTTCTTGCTGAGGGATGAGGG - Intronic
1057647809 9:96893500-96893522 ATGGGATGGCTGAGTCAAGATGG - Intergenic
1059516250 9:114898423-114898445 ATGCTATTGCTGTCTGGAGATGG + Intronic
1060293165 9:122323026-122323048 ATTTTATTGTTTAGTGAAAATGG - Exonic
1061685610 9:132274850-132274872 ATTTTACTGCTGAGGTAAGAAGG + Intronic
1186421627 X:9431579-9431601 ATGTAATTCCTGAGAGAAAATGG + Intergenic
1189521864 X:41777606-41777628 TAGTTATTTCTGAGAGAAGAAGG + Intronic
1189812273 X:44791565-44791587 ATGCTATTGCTGGTTGAAGATGG + Intergenic
1192603299 X:72487356-72487378 ATATTTTTTCTGACTGAAGAAGG + Intronic
1197140906 X:123116521-123116543 ATTTTATTGTTTAGTGAAAATGG + Intergenic
1198309786 X:135419827-135419849 ATGTTACTGTTGAGGGAAGCTGG + Intergenic
1199976059 X:152895560-152895582 ATGTTACTGCTGAGAGAAAGTGG + Intergenic
1200063455 X:153494044-153494066 CTGCTCTTGCTGAGGGAAGAAGG + Intronic
1201553419 Y:15242888-15242910 ATGAATTTGCTGAGTGAAAATGG + Intergenic