ID: 1116904509

View in Genome Browser
Species Human (GRCh38)
Location 14:50391948-50391970
Sequence CAAAGTGGAGATAATGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 366}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116904509_1116904513 13 Left 1116904509 14:50391948-50391970 CCCATATCATTATCTCCACTTTG 0: 1
1: 0
2: 2
3: 37
4: 366
Right 1116904513 14:50391984-50392006 TCTTAATCCCTTGCTGATGAAGG 0: 1
1: 0
2: 0
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116904509 Original CRISPR CAAAGTGGAGATAATGATAT GGG (reversed) Intronic
900692855 1:3992235-3992257 CAAAGGGGAGATGATGTCATGGG + Intergenic
904768500 1:32868502-32868524 TAAAATGGAGATATTGATAGCGG - Intronic
906406544 1:45546899-45546921 GAAAGTGGAGAAAATGATGGAGG - Intergenic
906756388 1:48320222-48320244 CAAAGCCTAGATAAAGATATTGG + Intronic
907236348 1:53052570-53052592 TAAAGTGGAGATACTAATATCGG + Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909020135 1:70421952-70421974 CAAAATGGAGATAATTATACCGG + Intronic
911431418 1:97792636-97792658 TAAAGTGGAGATAATGATAATGG - Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912211199 1:107559008-107559030 GCAAGAGGAGATAAGGATATTGG + Intergenic
913174156 1:116258727-116258749 AAAATTGGAGGTGATGATATGGG - Intergenic
913539488 1:119805237-119805259 CAGAGGGCAGATAATGACATGGG + Intronic
915567111 1:156721333-156721355 GAAAGTGCAGATAATGATCCTGG + Intergenic
916362155 1:163982689-163982711 AAATGTGGAAATTATGATATTGG - Intergenic
919037921 1:192340225-192340247 CATGGTGAAGATAATAATATGGG - Intronic
919507910 1:198423541-198423563 CAAATTGGAAATAATGATAGAGG + Intergenic
920424387 1:205862395-205862417 CAAAGGGCGGATAATTATATGGG + Intergenic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922073978 1:222224038-222224060 TAAAGCGGAGAAAAAGATATTGG + Intergenic
922315571 1:224438800-224438822 TTAAGTGGGGATAATGACATTGG + Intronic
922427505 1:225512976-225512998 CCAAGTGGAGGGAATGCTATTGG - Exonic
924310713 1:242740172-242740194 GAAAGAGGACATTATGATATTGG + Intergenic
924366279 1:243297034-243297056 TAAAGTGGTGATAATCACATAGG - Intronic
1063272247 10:4523528-4523550 CAAAATGGAGCTAATCTTATGGG + Intergenic
1063689853 10:8276417-8276439 AAGTGAGGAGATAATGATATCGG - Intergenic
1063950357 10:11216565-11216587 CAACTTGTAGATAAAGATATTGG - Intronic
1064200551 10:13281116-13281138 CAAAGTGAACAAATTGATATTGG + Intronic
1064495731 10:15908229-15908251 AAGAGTTGAGATAATGGTATTGG + Intergenic
1065996816 10:31067177-31067199 CAAAGTAGGGATAATAATACAGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066767802 10:38818513-38818535 CAAAGTGGAATCAATCATATTGG - Intergenic
1067074497 10:43167695-43167717 CAAAGTGAAGAAATTAATATTGG + Intronic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068817006 10:61327926-61327948 CAAGATGGAGATATTGATAATGG - Intergenic
1069941722 10:71961269-71961291 CAAAGGGTGGATAATTATATGGG + Intergenic
1071393711 10:85200645-85200667 CAGAGTGATGATAATGATAATGG - Intergenic
1071722874 10:88164915-88164937 GACAGTGGAGATATTGATTTTGG + Intergenic
1072093787 10:92156325-92156347 AAAAATGAAGATAATGATGTTGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073808079 10:107121876-107121898 GAAAATGGAGATAAAAATATTGG - Intronic
1074163236 10:110851859-110851881 CAAAATCGAGGTTATGATATAGG - Intergenic
1074845732 10:117395748-117395770 TAAAGTGGGAATAATGACATAGG + Intergenic
1076497501 10:130906448-130906470 CAGGGTGGAGAAAATGATTTGGG + Intergenic
1077571521 11:3342660-3342682 CAAAGTGGAGATCATGAATATGG + Intronic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080552235 11:33382754-33382776 CAAAGTAAAGAAAATGATCTTGG + Intergenic
1080887417 11:36379137-36379159 CAAAGTGAGGATTATGATTTAGG - Intronic
1082904850 11:58295678-58295700 CAAATTGTAGACAATGATTTGGG + Intergenic
1083644611 11:64165283-64165305 CAAAGTGGAGGTTATGATCCCGG - Intronic
1084780547 11:71405370-71405392 CCAGGTGGACATAATGATAGGGG - Intergenic
1085157450 11:74309337-74309359 CAAAGTTGTGATAATGACAGTGG + Intronic
1085862130 11:80246523-80246545 CAAAGTGGAAATAAGGAGACAGG + Intergenic
1086041681 11:82486852-82486874 CAAATTGGAGTTAATGTTATAGG - Intergenic
1086802164 11:91190341-91190363 TACAGTTAAGATAATGATATAGG - Intergenic
1087290498 11:96315429-96315451 GTAAGTGGAGATAAGCATATAGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088787841 11:113198886-113198908 TACAGTGGAGACAATAATATTGG + Intronic
1088972542 11:114786692-114786714 CAAACTAGAAACAATGATATGGG - Intergenic
1089447552 11:118565574-118565596 GAAAGTGGAGGTGATGATTTTGG - Intronic
1090794958 11:130127046-130127068 AAAAGGGCAGATAATGGTATAGG - Intronic
1091582742 12:1798984-1799006 CACAGTGGAGATGAAGAGATGGG + Intronic
1091669789 12:2444828-2444850 CAAAGTAGAGATAGTGGGATTGG - Intronic
1093691386 12:22113587-22113609 CAAAGGGGAGATAAAGAGATTGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097465854 12:59923670-59923692 CAATGTGGAGATAAAGAAAGTGG - Intergenic
1098508497 12:71283201-71283223 CGAAGTGAAGATAAGGATAGTGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099888505 12:88561085-88561107 CAAAGTAGAAATTAAGATATGGG - Intronic
1100273789 12:93051595-93051617 AAAAGTGGAGACAATGTCATAGG - Intergenic
1100640296 12:96476123-96476145 CAGAGGGGAGAAAATGATAGAGG - Intergenic
1100917252 12:99438398-99438420 CAAATTGGAAATATTGGTATGGG - Intronic
1101525607 12:105526290-105526312 CAAAGTGAAGAAACTGATATTGG + Intergenic
1101852121 12:108411751-108411773 CAAAATGAAGATAATAATAGTGG + Intergenic
1103405705 12:120673731-120673753 TAAAATGGAGATGATGTTATAGG + Intergenic
1104105066 12:125651252-125651274 CAAAATGGAGAATATGATGTTGG - Intronic
1105070453 12:133231410-133231432 CAAAGTGGAGGTGAGGAGATAGG - Intronic
1105204553 13:18209745-18209767 CAGAGAGAAGAAAATGATATAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106787056 13:33118042-33118064 GTAAGTGGAAATAATGAGATTGG - Intronic
1107205047 13:37774532-37774554 ACAAGTGGAGATAATTACATAGG + Intronic
1107319310 13:39168516-39168538 CAAAGTGCAGAGAATGACCTGGG + Intergenic
1107708301 13:43128523-43128545 AAAAATGGAGATAATAATAATGG - Intergenic
1108105109 13:47000589-47000611 CAAAGTGGGAATAATGCTGTAGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111523021 13:89429455-89429477 CAAAGTTTAGATAACGAAATAGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114601468 14:23958929-23958951 TAAGGTGGAGATGATGAAATAGG - Intronic
1114780330 14:25532217-25532239 CAATGTGGAGATAATTGAATGGG - Intergenic
1114857827 14:26472246-26472268 CAAACTGGAGAAAAAGATAATGG - Intronic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1116365560 14:44058437-44058459 CAAAGTTCAGATATTGTTATAGG - Intergenic
1116804771 14:49482392-49482414 CAATGTGGAGACATTGGTATGGG + Intergenic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123506848 15:20950575-20950597 CACAGAGGAGATAATGAACTTGG - Intergenic
1123564074 15:21524317-21524339 CACAGAGGAGATAATGAACTTGG - Intergenic
1123600328 15:21961601-21961623 CACAGAGGAGATAATGAACTTGG - Intergenic
1123910116 15:24957340-24957362 AAAAGTGGAGACAATCTTATTGG + Intronic
1125199510 15:37089267-37089289 CAAGGGGGAAATAATGAAATTGG - Intronic
1125871261 15:43104220-43104242 GGAATTGGAGATAATGATACAGG - Intronic
1125888076 15:43243896-43243918 TAAAGTTGGGATAATCATATGGG - Intronic
1126234344 15:46365315-46365337 CAAAACCCAGATAATGATATTGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126713747 15:51490629-51490651 TAAAATGGAGATGATGACATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127876011 15:63112018-63112040 CAAAATGGAGATAGTGATGCAGG - Intergenic
1130133260 15:81161019-81161041 CCAAGTAGGGATAATGCTATGGG + Intronic
1131183056 15:90253585-90253607 CAAAGTGCAAATCATGAGATAGG - Intronic
1202972435 15_KI270727v1_random:251415-251437 CACAGAGGAGATAATGAACTTGG - Intergenic
1133777258 16:8906466-8906488 CATAGTGGAGATAATCATGGTGG - Exonic
1134167107 16:11939587-11939609 CAAGGTGGAGATCATGAAAATGG + Intronic
1134352890 16:13454283-13454305 AAAAATGGAGATGAGGATATAGG + Intergenic
1134493601 16:14714130-14714152 CAAGGTGGAGATCATGAAAATGG - Intronic
1134498981 16:14753254-14753276 CAAGGTGGAGATCATGAAAATGG - Intronic
1134525533 16:14939871-14939893 CAAGGTGGAGATCATGAAAATGG - Intronic
1134546871 16:15116507-15116529 CAAGGTGGAGATCATGAAAATGG + Intronic
1134581587 16:15375765-15375787 CAAGGTGGAGATCATGAAAATGG + Intronic
1134713118 16:16338357-16338379 CAAGGTGGAGATCATGAAAATGG - Intergenic
1134720986 16:16381717-16381739 CAAGGTGGAGATCATGAAAATGG - Intronic
1134946440 16:18330168-18330190 CAAGGTGGAGATCATGAAAATGG + Intronic
1134953702 16:18370315-18370337 CAAGGTGGAGATCATGAAAATGG + Intergenic
1135071617 16:19357119-19357141 GAAAGTGGAAATAATGGAATGGG + Intergenic
1135312499 16:21417033-21417055 CAAGGTGGAGATCATGAAAATGG + Intronic
1135365447 16:21849498-21849520 CAAGGTGGAGATCATGAAAATGG + Intronic
1135446392 16:22521850-22521872 CAAGGTGGAGATCATGAAAATGG - Intronic
1136151673 16:28354995-28355017 CAAGGTGGAGATCATGAAAATGG + Intronic
1136167905 16:28468835-28468857 CAAGGTGGAGATCATGAAAATGG + Intronic
1136195069 16:28646176-28646198 CAAGGTGGAGATCATGAAAATGG - Intronic
1136211408 16:28760288-28760310 CAAGGTGGAGATCATGAAAATGG - Intronic
1136256129 16:29040243-29040265 CAAGGTGGAGATCATGAAAATGG - Intronic
1136282507 16:29222106-29222128 CAAAGTGGAGATGGGGTTATGGG - Intergenic
1136309199 16:29395998-29396020 CAAGGTGGAGATCATGAAAATGG + Intronic
1136322619 16:29497537-29497559 CAAGGTGGAGATCATGAAAATGG + Intronic
1136437299 16:30237509-30237531 CAAGGTGGAGATCATGAAAATGG + Intronic
1136597347 16:31260431-31260453 CAAAGTGGAGATGGTGAGAGGGG - Intronic
1136939441 16:34508265-34508287 CAAAGTGGAGCTGGTGAGATTGG + Intergenic
1136960380 16:34840296-34840318 CAAAGTGGAGCTGGTGAGATTGG - Intergenic
1137369673 16:47893711-47893733 TAAGATGGAAATAATGATATAGG - Intergenic
1137529065 16:49265382-49265404 GAAAATGGAGATAATAATAATGG - Intergenic
1137838068 16:51613160-51613182 TAAAGTGGAGATGATGATCATGG - Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139856899 16:69988424-69988446 CAAGGTGGAGATCATGAAAATGG + Intergenic
1140365819 16:74379559-74379581 CAAGGTGGAGATCATGAAAATGG - Intronic
1140636126 16:76916030-76916052 TAAAGCTAAGATAATGATATTGG + Intergenic
1140812735 16:78593957-78593979 CAAGTTGGATATAATGATAGTGG - Intronic
1140871229 16:79108427-79108449 CAAAGGGGAGAAAAAGGTATGGG + Intronic
1141048482 16:80738849-80738871 TAAAATGGAGATGATGATAGTGG + Intronic
1141192469 16:81834484-81834506 CAAAATGGAGTTGATGATAATGG + Intronic
1142086883 16:88188030-88188052 CAAAGTGGAGATGGGGTTATGGG - Intergenic
1143350856 17:6287180-6287202 CAAAGGAGGGATAGTGATATAGG - Intergenic
1143577901 17:7805314-7805336 CCAAGTGGAGATAGTGATGCAGG + Exonic
1144055719 17:11538897-11538919 CAAAGAGGTGATATAGATATTGG - Intronic
1145092339 17:19996307-19996329 CAAAGTGGCAATATTGAGATGGG - Intergenic
1146589797 17:34118975-34118997 CAAAATGGAGATTATGGAATGGG - Intronic
1147282496 17:39373840-39373862 AAAAGTGAAGATGATTATATGGG + Intronic
1147751926 17:42741070-42741092 AAAAGTGAAGATAATTAGATAGG - Intronic
1149101990 17:52918302-52918324 CTCAGTAGAGATGATGATATGGG + Intergenic
1151083922 17:71359674-71359696 GAAAGTGGAGATAATGTATTTGG + Intergenic
1152095601 17:78269949-78269971 AGAAGTGGGGATAATGATCTGGG + Intergenic
1153176870 18:2385054-2385076 CAAAATATAGATAATTATATGGG + Intergenic
1153655961 18:7282578-7282600 CAATGTGGGGACAATGAGATTGG - Intergenic
1153738428 18:8097308-8097330 CAAAAGGGACATAATTATATGGG - Intronic
1154118378 18:11631699-11631721 CAAGGTGGAGATCATGAAAATGG + Intergenic
1154347788 18:13557892-13557914 CAAAGTGAAAATAATGAGATTGG - Intronic
1154404222 18:14073669-14073691 CAGAGTGAAGATCATGATACAGG - Intronic
1154963025 18:21328881-21328903 TAAAGTGGGGATAATAATAATGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1158497206 18:57967282-57967304 CAAACTGTAGATAAAGATACAGG + Intergenic
1159625071 18:70683355-70683377 CAAAGTACAGATAACGATATGGG + Intergenic
1159875986 18:73811780-73811802 CAAAGTAGAGATAATAACACTGG + Intergenic
1162005562 19:7776395-7776417 CAAAGTGAAGAAATTAATATTGG - Intergenic
1163989649 19:20986681-20986703 AAAAGGGGAAATAATTATATGGG + Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925946880 2:8872672-8872694 CAAAGTGAATAAAATGATATTGG - Intronic
926255125 2:11187180-11187202 GAAAGTGAAGACAAGGATATGGG - Intronic
926588210 2:14712239-14712261 GAAAGTGGAGATAAAGGCATTGG - Intergenic
926784894 2:16509136-16509158 TAAAATGGAGATAATAACATGGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
932234187 2:70108057-70108079 CAGAATGGAGATAAGGATTTGGG + Intergenic
935005514 2:99072325-99072347 AAAACTGGAGATAATTATTTTGG - Intronic
935372173 2:102357908-102357930 CAAAGAGGAGAAAATGATCTTGG - Intronic
936823269 2:116550540-116550562 TAAAATGGAGAAAATGAAATGGG + Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937197374 2:120171337-120171359 CAAAGTGGAGCTGAGAATATGGG + Intronic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
938115266 2:128598288-128598310 AAAGGTGGTGATAATGATAGTGG - Intergenic
938590456 2:132730966-132730988 GCAAGTGGAGATTATGCTATAGG - Intronic
938973557 2:136454244-136454266 CAAAGTGAAGTAAATGAGATAGG - Intergenic
939719914 2:145635404-145635426 CAATGTGAAGACAATGATAAAGG + Intergenic
939766393 2:146255589-146255611 CAATGTGGAGATGAAGATGTTGG - Intergenic
940178584 2:150906275-150906297 CAAAGTTGAGATATTTATAGAGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
941083897 2:161094227-161094249 CAAAGAACAGTTAATGATATAGG + Intergenic
941207600 2:162593305-162593327 TATAGTGGGGATAATAATATAGG + Intronic
941272947 2:163453471-163453493 CAAAGTGGGAGTAATGATAGGGG - Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
943244329 2:185426488-185426510 GGAAGATGAGATAATGATATTGG - Intergenic
943936465 2:193922444-193922466 TAAAATGGAGATAATAATACAGG + Intergenic
944275110 2:197827567-197827589 CAAAGTGGATATCATGATAAAGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1169292171 20:4362086-4362108 CCAAGTGAAGATAAAGATGTGGG + Intergenic
1169846555 20:9999560-9999582 CAAAGTGAACATATTGACATAGG + Intronic
1170304838 20:14926919-14926941 CAAATTGATGATAATTATATTGG + Intronic
1170323804 20:15133527-15133549 CAGAGTGGATATATTGATAAAGG + Intronic
1172825876 20:37785359-37785381 TAAAGAGGAGATAGAGATATTGG - Intronic
1172928382 20:38562277-38562299 TAAAGTAGAGATAATAATAATGG - Intronic
1172968270 20:38854695-38854717 TAAAGTGGAGAGAATGATGCAGG + Intronic
1173005553 20:39137294-39137316 CAGAGTGGACATAAAGAGATTGG + Intergenic
1175526452 20:59637944-59637966 CAAAATGGGGATAATAATAATGG - Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176713424 21:10328343-10328365 CAGAGAGAAGAAAATGATATAGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1180829805 22:18898922-18898944 CAGAGAGAAGAAAATGATATAGG - Intergenic
1182322458 22:29487010-29487032 TAAAGTGGAGATGATAATAAGGG + Intronic
1182747323 22:32615890-32615912 CAAAGTGGAGGGAATGCAATGGG + Intronic
1182791100 22:32953766-32953788 AATAGTGGAGATGATGATGTTGG - Intronic
1183542006 22:38434876-38434898 CAAACTGGAGATGACGATACTGG + Intronic
1184349896 22:43936671-43936693 AAAAATGGAGATGATGATAGTGG + Intronic
1184447989 22:44563161-44563183 CAAAGTGTGGATATTAATATTGG + Intergenic
1185066385 22:48633782-48633804 TAAAGTGAAGATGAGGATATGGG + Intronic
1203279896 22_KI270734v1_random:124195-124217 CAGAGAGAAGAAAATGATATAGG - Intergenic
949450740 3:4182162-4182184 CAAGGTGTAAATAATGATACAGG + Intronic
950411666 3:12842008-12842030 CAAAATGGAGACAATAATAGGGG - Intronic
950857547 3:16119908-16119930 GAAAGTGGAGTTAATGAAAGAGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951863551 3:27280625-27280647 CAAAGTTTAGATACTGATTTTGG + Intronic
955887765 3:63618913-63618935 CAAAGTGGGGAGAATGAGACAGG + Intergenic
957379229 3:79403823-79403845 TACAATGGAAATAATGATATGGG + Intronic
957796535 3:85016360-85016382 GAAAATGGAAATAAAGATATAGG + Intronic
957817719 3:85323795-85323817 CAAAGTATAGAGGATGATATTGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958680538 3:97325137-97325159 TAAAATGGGGATAATAATATAGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959266153 3:104141577-104141599 CAAACTGGAGATCATGAAAAGGG + Intergenic
959587522 3:108038974-108038996 CAAATTGGAGATAAAAATAAGGG - Intergenic
960259295 3:115547338-115547360 GAAAGTGGAGATAAGGACAAAGG + Intergenic
960284243 3:115809594-115809616 CACAGTGGAGAAAATGAAAATGG + Exonic
960352817 3:116613850-116613872 CAAAGTGAAGATTATTATGTGGG + Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963181472 3:142361581-142361603 CCAAGTGTTGACAATGATATAGG - Intronic
963238755 3:142982174-142982196 TAAAAAGGAGATAATTATATTGG - Intronic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
965257124 3:166427238-166427260 TAAAGTGGAGGTAAAGAGATAGG + Intergenic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966129013 3:176615126-176615148 GATGGTGGTGATAATGATATTGG + Intergenic
966294659 3:178405463-178405485 CAAAGAGTAAATAATGATAGAGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967143711 3:186587381-186587403 CAAAATGGAGATAATGAAGGGGG + Intronic
967254767 3:187578712-187578734 CAAAGATGAGAAAATGATATTGG + Intergenic
967298678 3:187990732-187990754 TAAGGTGGAGATAAAGATTTGGG - Intergenic
967316542 3:188155643-188155665 CGAAGTGGAGAAAACCATATTGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973576088 4:52290731-52290753 CCAAGGGGAGAGAATGATCTGGG - Intergenic
973729179 4:53806664-53806686 CAAAGTAGGGATAATAATACAGG - Intronic
973821227 4:54663333-54663355 TAAAATGGAGATGATGACATAGG + Intronic
974100592 4:57411783-57411805 CAAAGTAGAGAAAAAGAAATTGG + Intergenic
974473044 4:62342960-62342982 AAAATTTGAGATAATGATGTGGG - Intergenic
976785516 4:88815239-88815261 CAAAGTGAAAATAATGAGGTGGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979936607 4:126705498-126705520 CAAAGTAGAGACAATGGAATGGG - Intergenic
980741828 4:136960548-136960570 CAAAGAGGAGGTAATGATAGAGG - Intergenic
980877333 4:138675098-138675120 CAGAGTAGAGATAATGGAATGGG - Intergenic
981111849 4:140943888-140943910 CTAATTGGTGATAATGCTATAGG + Intronic
982512373 4:156299254-156299276 CAAAATGGAGATACTCATCTTGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984448175 4:179865218-179865240 CAAGCTGAAGATAAGGATATGGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986054531 5:4122814-4122836 GAAAGTGGAGATAGTGATCAAGG - Intergenic
986832916 5:11601254-11601276 AAAAGTGAAAATAATGCTATGGG - Intronic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987549694 5:19362746-19362768 CAAAGGGGAGATTTTGACATAGG - Intergenic
990139701 5:52689450-52689472 GACAGTGGAGAAAATGTTATTGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990919716 5:60948930-60948952 CCAAGTGTTGATAAGGATATAGG - Intronic
991270206 5:64770020-64770042 CATATTGGAGAAAATGAGATTGG + Intronic
991663804 5:68976009-68976031 CAAAGAGGGGATAAAGAGATAGG + Intergenic
991952656 5:71961685-71961707 TAAAATGGAGAAAATGCTATTGG - Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993236808 5:85321232-85321254 AAAAGTGGAGATACTGACATGGG + Intergenic
993646710 5:90472131-90472153 CAAAGGTGAGAGAATGATAGGGG - Intronic
993923027 5:93830773-93830795 CAGAGTGGAGAGGATGATTTTGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
995591386 5:113703947-113703969 CAAAATGAAGATATTGAAATGGG - Intergenic
996347989 5:122508290-122508312 TAAAATGGAGATAATGATAATGG - Intergenic
997306597 5:132841622-132841644 CCAAGAGGAGAGAGTGATATAGG - Intergenic
997711834 5:136011424-136011446 CCAAGTGCAGAAAATGAAATAGG - Intergenic
999364920 5:151016582-151016604 CAAAATGGGGATAATAATGTTGG + Intergenic
1000363221 5:160467339-160467361 CAAAATGGAGATAATAATTCGGG + Intergenic
1000910222 5:167013003-167013025 CAAGGTGAAGCTAAAGATATGGG + Intergenic
1001017755 5:168156949-168156971 CAAAGTGTAGGTAATGACAACGG + Intronic
1003236202 6:4297127-4297149 GAAAGGGGAGACAATGATAAAGG + Intergenic
1004014522 6:11719971-11719993 CCTAGTGGAGATAATGCTAGTGG - Intronic
1007560215 6:42801535-42801557 AAAAGTGGAAAAAATCATATTGG + Intronic
1008179190 6:48306741-48306763 TCAAGTGGAGAGAAAGATATGGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008718138 6:54314547-54314569 AAAAGAGTAGAGAATGATATTGG + Intronic
1009215653 6:60917023-60917045 CAAAATGGGTATAATAATATTGG - Intergenic
1009491071 6:64292004-64292026 TAAAGTGGAGACAATAATATTGG - Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1010056092 6:71566929-71566951 CAAAGTTAAGAAAATGCTATAGG + Intergenic
1010247582 6:73676114-73676136 AAAAGTGGAGATAATTCTATTGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010881261 6:81176356-81176378 AAAAGTGAAGATAAAGAAATTGG - Intergenic
1011239861 6:85259451-85259473 CAAAGTGGAAAGAATAATATTGG - Intergenic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1011901511 6:92303611-92303633 TAAAGAGGAGACAAAGATATAGG + Intergenic
1012084365 6:94805243-94805265 CAAAGTCCTTATAATGATATAGG - Intergenic
1012144861 6:95668886-95668908 CAAAGTGGAAATAAGAATAAAGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012672442 6:102072044-102072066 CAAAGTGTGAATAATAATATGGG + Intergenic
1013726492 6:113103585-113103607 CAAAGTAAAAATACTGATATTGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014956960 6:127631596-127631618 CAAAGTGGAGGAAATTAGATAGG + Intergenic
1015096938 6:129427082-129427104 CAAAGTTAATAGAATGATATGGG - Intronic
1018305815 6:162453920-162453942 GAAAGTGGACATAATAATAAGGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020473761 7:8570547-8570569 GGAAGTGCAGATAATCATATTGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021051388 7:15989750-15989772 CAAAGCAGAGATGTTGATATAGG + Intergenic
1021391865 7:20102748-20102770 GAGAGTGGAAATAATGAAATGGG + Intergenic
1022039544 7:26567125-26567147 TCAAGTGGAGATAAGGAAATGGG + Intergenic
1022800066 7:33768211-33768233 TAAAATGGATATAATAATATTGG + Intergenic
1023544637 7:41305513-41305535 GAAAGTGGAGAGGATGAAATAGG + Intergenic
1023570991 7:41571732-41571754 CAAAGTGGAGAGAGTTTTATTGG + Intergenic
1023602203 7:41891139-41891161 CATACTGGAGCTAATGCTATGGG - Intergenic
1023747789 7:43338064-43338086 CTAAGTGGAGAGAATAATCTTGG - Intronic
1024327250 7:48118668-48118690 CAAATTGAAGATAATGTAATTGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1026273344 7:68855268-68855290 CAAATTGGAGAGATTGGTATTGG - Intergenic
1026467405 7:70666207-70666229 CAAAATGGGAATAATGATAATGG + Intronic
1027593169 7:80139833-80139855 TAAAGTTGAGAAAATGATAATGG + Intronic
1027593715 7:80146181-80146203 CAGAGTGGAGATTAAGATATGGG + Intronic
1027732024 7:81886325-81886347 CACAGAGCAGAGAATGATATAGG - Intergenic
1030528204 7:110678832-110678854 CAAAGGTGAGATAATGTGATAGG + Intronic
1030540195 7:110820902-110820924 GAGATTGGAGATAATCATATTGG - Intronic
1030574169 7:111265342-111265364 CAAAGTAGAGATTTTGATTTGGG - Intronic
1030667321 7:112293766-112293788 CAAAATGGAACTAATTATATAGG + Intronic
1031007191 7:116486640-116486662 CATAGTGGAGAAAATGTTTTAGG + Intronic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032707027 7:134429981-134430003 TAAAATGGAGATAATGCTAATGG - Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036221548 8:6925173-6925195 CAAACTGGAGACAGTCATATGGG - Intronic
1041618369 8:59934899-59934921 CACCTTGGAAATAATGATATTGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044376704 8:91482741-91482763 CAAAGTAAAAATAATAATATTGG + Intergenic
1046353269 8:113044750-113044772 GAAACTGGAGAAAATGAAATAGG - Intronic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046760371 8:118014190-118014212 CAAAATGGGGTTAAAGATATTGG + Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050664523 9:7920426-7920448 CAAAGTAGACATTATGAAATAGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051558956 9:18418605-18418627 TAAAATGGGGAAAATGATATAGG + Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052641863 9:31178669-31178691 CAAAGGGAAGAGAATGTTATGGG - Intergenic
1052980374 9:34444044-34444066 CCAAGTGGGGATAATGATATGGG - Intronic
1054839114 9:69716627-69716649 TAAAGTGGGGATAAAGATGTAGG - Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055642682 9:78332616-78332638 AAAAGGGGAGATAAAGATACAGG + Intergenic
1057158222 9:92863816-92863838 TAGAGTGGAGATAAAGATTTGGG + Intronic
1057191123 9:93088200-93088222 CAGAGGGGAGGAAATGATATGGG + Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057735860 9:97659496-97659518 CAGAGTTGACATAATGAAATAGG - Intronic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1060451412 9:123744490-123744512 CAAAGTGGAAAAAATGTTAAAGG + Intronic
1060709158 9:125839139-125839161 TAAAATGGAGATAATTATAGTGG + Intronic
1061891343 9:133622271-133622293 CAAAGTGGAGGAAATGAGAGGGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186777571 X:12880918-12880940 TAAAATGGAGATAATAATAGAGG + Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188135769 X:26492720-26492742 CAAAGAGCAGAGAATAATATAGG + Intergenic
1188828094 X:34861728-34861750 TAAAGTTGAGATAATGTTACTGG + Intergenic
1189402423 X:40683734-40683756 CAAAGTGGGGATAATGAACCTGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191867111 X:65712983-65713005 CACATTGGAGATAAAGAAATAGG - Intronic
1191979034 X:66905336-66905358 CAATGTGTAGATAATGAGTTGGG - Intergenic
1192223052 X:69210413-69210435 CAAAATGGGGATGATAATATTGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193900616 X:87172115-87172137 CAAAATGGAGAACATGTTATTGG + Intergenic
1195593349 X:106658071-106658093 AAAAGTGGAGATTATCATATTGG + Intronic
1195789750 X:108570690-108570712 CAAGGTGGAGAGAAGGGTATTGG + Intronic
1198249224 X:134863514-134863536 CAAAGAGTAGAAAATGGTATAGG - Intergenic
1198606183 X:138340604-138340626 CAAAGGGGAGAGAATCAAATTGG + Intergenic