ID: 1116905089

View in Genome Browser
Species Human (GRCh38)
Location 14:50396635-50396657
Sequence CCGGCTCCCCGCGGAGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 316}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116905080_1116905089 -1 Left 1116905080 14:50396613-50396635 CCCTGCGGCAAGAAGACACCTCC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG 0: 1
1: 0
2: 1
3: 21
4: 316
1116905076_1116905089 26 Left 1116905076 14:50396586-50396608 CCCCGGTTCTAATTTCGGGTCTC 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG 0: 1
1: 0
2: 1
3: 21
4: 316
1116905081_1116905089 -2 Left 1116905081 14:50396614-50396636 CCTGCGGCAAGAAGACACCTCCC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG 0: 1
1: 0
2: 1
3: 21
4: 316
1116905077_1116905089 25 Left 1116905077 14:50396587-50396609 CCCGGTTCTAATTTCGGGTCTCA 0: 1
1: 0
2: 1
3: 0
4: 86
Right 1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG 0: 1
1: 0
2: 1
3: 21
4: 316
1116905078_1116905089 24 Left 1116905078 14:50396588-50396610 CCGGTTCTAATTTCGGGTCTCAT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG 0: 1
1: 0
2: 1
3: 21
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116905089 Original CRISPR CCGGCTCCCCGCGGAGGCGG CGG Intronic
900095980 1:940304-940326 CCGGCTCCGCGGCGGGGCGGGGG - Intronic
900321179 1:2084891-2084913 CCAGCTCCTCGGGGAGGCTGAGG + Intronic
900947637 1:5840357-5840379 CCGGCTCCCCCCGGCTGCTGTGG + Intergenic
901317346 1:8318052-8318074 CGGGCCCCGCGCGGATGCGGAGG + Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901494896 1:9615280-9615302 ACGGCTCCATGCTGAGGCGGCGG + Intergenic
903828659 1:26162005-26162027 CCGGCGCCCCCCGGTGTCGGTGG + Exonic
904128495 1:28259402-28259424 CTGTTTCCCCGGGGAGGCGGGGG - Intergenic
904500073 1:30908384-30908406 CCGGCACCCCGCGCGGGGGGCGG + Intronic
905786339 1:40760602-40760624 CCAGCTACCCGGGGAGGCTGAGG + Intronic
905862538 1:41361196-41361218 CCTGCTCGGCGCGGAGGCGGGGG - Intergenic
906263121 1:44407795-44407817 GCGGCTGCCCGCTGAAGCGGTGG + Intronic
907010632 1:50959896-50959918 TCGGCGCCCGGCGGCGGCGGCGG - Exonic
907053506 1:51345075-51345097 GCGGCCCCTCGCGGCGGCGGCGG + Exonic
908320300 1:62972213-62972235 CTGGCTCCGCCAGGAGGCGGAGG - Intergenic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
909942288 1:81624464-81624486 CCAGCTACCCTCGGAGGCTGAGG + Intronic
912174643 1:107141113-107141135 GAGGCTCCCCCCGGGGGCGGAGG + Exonic
914393561 1:147243007-147243029 CCCGCGCGCCGCGCAGGCGGGGG - Intronic
914663532 1:149813276-149813298 CCCGCTCCCCGCGGATGCGGCGG + Exonic
914667057 1:149840752-149840774 CCCGCTCTCCACGGATGCGGCGG + Exonic
914668710 1:149853038-149853060 CCCGCTCTCCACGGATGCGGCGG - Exonic
915214140 1:154328900-154328922 GCGGCTCCCCGGGGAGGTGCAGG - Intronic
915564417 1:156705816-156705838 CGCGCTCTCCGCAGAGGCGGGGG + Exonic
919235687 1:194839149-194839171 CCAGCTACCCGGGGAGGCTGAGG - Intergenic
919451274 1:197775391-197775413 GCGGCTACCGGCGGAGACGGGGG - Intronic
920002000 1:202807248-202807270 TCGGCTCCCCGGGGAGGCCTGGG - Intronic
920048548 1:203149477-203149499 CCAGCTCCCAGAGGAGGAGGAGG + Intronic
922526539 1:226308800-226308822 CCGGCCCCCAGCCGAGGTGGAGG - Intronic
1063417960 10:5889370-5889392 CGGGCTGCGCGGGGAGGCGGCGG + Exonic
1064208968 10:13347771-13347793 CCGGCCCCGCGCGGCGGCGGCGG + Intronic
1065025352 10:21535031-21535053 CCGGCCCCAGGCGCAGGCGGCGG - Intronic
1065342891 10:24723395-24723417 CGGGCGCCCGGCGGGGGCGGAGG - Intronic
1066464502 10:35640786-35640808 CCAGCTCGCGGCGGCGGCGGTGG - Exonic
1067142259 10:43667647-43667669 CCCACTCTCCGCGGAGGCTGGGG - Intergenic
1067669694 10:48307222-48307244 CCGGCTCCCCGCCGCCCCGGAGG - Intronic
1068560960 10:58513454-58513476 CCGCTCCCCCGCGGAGCCGGAGG + Intronic
1069381877 10:67849922-67849944 CCTGCTCCCCGCTAAGGCTGGGG + Intergenic
1070570647 10:77637748-77637770 CCCGCGCTCCGCGGCGGCGGCGG - Intronic
1072750384 10:97974701-97974723 CGGGCTCCCGGCAGAGGCAGGGG - Intronic
1073051657 10:100671121-100671143 CCCGGCCCCGGCGGAGGCGGCGG - Intergenic
1073099529 10:100999565-100999587 TCGGCTCGACGCGGCGGCGGCGG - Exonic
1073099600 10:100999784-100999806 CGGGGGCGCCGCGGAGGCGGAGG + Exonic
1073226569 10:101925793-101925815 CCGGCTACCCAGGGAGGCTGAGG + Intronic
1076402023 10:130190769-130190791 CCGGGTCCCCGGGGACGAGGGGG - Intergenic
1076869662 10:133187168-133187190 CAGCGTCCCCGCGGAGGCAGCGG - Intronic
1076935317 10:133565001-133565023 CCGACGCCCCGGGGAGCCGGGGG - Intronic
1077543557 11:3159049-3159071 CAGGCTCCCCTCTGAGACGGAGG - Intronic
1077962463 11:7089625-7089647 CCGGCTCGCAGCAGCGGCGGTGG + Exonic
1080802103 11:35618659-35618681 CCAGAGCCCCGCGGTGGCGGCGG - Exonic
1080983292 11:37432081-37432103 CCAGCACCCCCCGGAGGCCGAGG + Intergenic
1081605836 11:44526588-44526610 CCTGCTCCCCACGGAGCCCGGGG - Intergenic
1081773766 11:45664746-45664768 CCAGCTGCACCCGGAGGCGGGGG - Intronic
1083342668 11:61968339-61968361 CCGCCTCCCCGGGGAGTCGTGGG + Intergenic
1083441402 11:62678934-62678956 CCAGGTCCCCGCGGAAGCCGCGG - Exonic
1084265513 11:68003509-68003531 ACGGCCCCCCGCGGCGGGGGTGG - Intronic
1084888120 11:72223828-72223850 CCGGCTCCCCGGGGCGGCGCGGG + Intronic
1085038015 11:73311128-73311150 CCAGCTCCCCACGGCGGCTGGGG - Exonic
1085353552 11:75815809-75815831 CCGGCTCCCTGCGTTGGGGGAGG - Intronic
1085375924 11:76060843-76060865 CAGGATCCCCACGGAGGAGGGGG - Intronic
1089243126 11:117098433-117098455 CCGGCTCCCCGCGGCCCCGGAGG - Exonic
1089499906 11:118925777-118925799 CTGGCTCCGGGCGGCGGCGGTGG + Intronic
1090474052 11:127003838-127003860 CCGGCTCGCCCCGCTGGCGGAGG - Intergenic
1091613982 12:2035149-2035171 CCGGCGCCCCGCGGAGGGCCCGG - Intronic
1093931135 12:24956094-24956116 CCAGCTCCCCGGGGCGGGGGCGG - Intergenic
1095476292 12:42589957-42589979 CCGGCTCCACGCGCAGCCAGTGG + Intronic
1097057425 12:56258295-56258317 CGAGCTCCCGGCGGCGGCGGCGG + Exonic
1097089585 12:56494598-56494620 GCGGCTCCCAGAGGGGGCGGCGG + Intergenic
1098105957 12:67069300-67069322 GCGGCTCCGGGCGGCGGCGGCGG + Intergenic
1100444822 12:94650587-94650609 CCCCCACCCCGCGGCGGCGGCGG - Intergenic
1102136890 12:110583037-110583059 CCGCCTCCTCGGGGGGGCGGCGG - Exonic
1102136895 12:110583040-110583062 CCGCCCCCCCGAGGAGGCGGGGG + Exonic
1102520681 12:113476062-113476084 CCGGGTCTGCGCGGCGGCGGCGG + Intergenic
1103074264 12:117969302-117969324 CCTGCTCCCGGGGGCGGCGGGGG + Intergenic
1103364014 12:120369333-120369355 CCGGGCGCCCGCGGAGGCGGCGG + Intergenic
1104420228 12:128628720-128628742 CCTGCTCCACCCGGAGGCGAGGG + Intronic
1104602258 12:130162050-130162072 CCGGCACCCCGAGGACGCCGAGG - Intergenic
1104957745 12:132474670-132474692 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957755 12:132474693-132474715 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957843 12:132474902-132474924 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957892 12:132475015-132475037 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104958066 12:132475410-132475432 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1105000531 12:132687455-132687477 CCGGCGCCCGGCGGGGGAGGTGG + Intergenic
1105472068 13:20703732-20703754 CCGGCTCGGGGCGGCGGCGGCGG + Intronic
1106108965 13:26760538-26760560 CAGGCGGCCCGCGGGGGCGGGGG + Intronic
1106683431 13:32031528-32031550 CCTGCAGCCCTCGGAGGCGGCGG - Exonic
1106776734 13:33016524-33016546 CCGGCTCCGCACGCAGGCGGCGG - Exonic
1111951314 13:94711543-94711565 GGGGCTGCCCGCGGCGGCGGCGG + Exonic
1111976021 13:94968012-94968034 CCGGGACCCCTCGGAGGCTGCGG - Intergenic
1112507144 13:99981952-99981974 CGGGCTCCAGGCGCAGGCGGCGG - Exonic
1113798529 13:113074570-113074592 CGGGGTCCCGGCGGGGGCGGCGG + Intronic
1115203138 14:30874690-30874712 CCCGCACCGCGGGGAGGCGGGGG - Intronic
1115320877 14:32077560-32077582 CAGGCTCCCCTCGGCGGCCGCGG - Intronic
1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG + Intronic
1118627914 14:67675387-67675409 CCAGCTACCCCCGGAGGCTGAGG + Intronic
1118797104 14:69153295-69153317 CCAGCCCCCCGCGGAGGGGAGGG - Intergenic
1119410240 14:74425932-74425954 CCCGAGCCCCGCGGAGGAGGCGG - Exonic
1119759516 14:77141063-77141085 CACGCTCTCCGCGGAGGCTGCGG - Intronic
1121321644 14:92995058-92995080 CCGGCTCCCAGTGGTGGTGGTGG - Intronic
1121645872 14:95516720-95516742 GCGGGTCCCGGCGGGGGCGGGGG - Intronic
1121786202 14:96663090-96663112 CCGGATTCCCGCGGAGCTGGTGG + Intergenic
1122271154 14:100568947-100568969 CGCGCTCCCGGCGGACGCGGCGG - Intronic
1122418584 14:101561715-101561737 CGGGCTGCCCCCGGCGGCGGCGG - Exonic
1122550159 14:102545065-102545087 CCGGCTCCCCGGGCGGGGGGTGG + Intergenic
1122582287 14:102778024-102778046 CCGGCACCCCGCGGGGCCGCGGG + Intronic
1124192831 15:27595488-27595510 CTGACTCCCTGCGGAGGCTGTGG + Intergenic
1124966696 15:34437321-34437343 CCGGGTCCCCGCGGCGCCGCGGG + Intronic
1127415048 15:58749621-58749643 CCGGCTTCCCGTGGAGGCTCCGG - Exonic
1128028575 15:64460585-64460607 CCGGATCGCGGCGGCGGCGGCGG + Intergenic
1128622238 15:69160603-69160625 CCGGCTGCGCGCGGAGCGGGAGG + Intronic
1128737442 15:70061205-70061227 CAGCCTCACCGTGGAGGCGGGGG - Intronic
1129016560 15:72474230-72474252 CGGGCTCCACGCAGGGGCGGTGG + Intergenic
1129301319 15:74627221-74627243 CCAGCTCCCTGCTGAGGTGGGGG + Intronic
1129771229 15:78204685-78204707 CCGGCCCCCATCGGAGGCTGCGG + Intronic
1131259580 15:90881569-90881591 TCGGCTGCCCCCGGAGGTGGAGG + Exonic
1133156584 16:3880508-3880530 CCGGAGCCCGGCGGCGGCGGCGG - Exonic
1133305036 16:4803092-4803114 CCGTCTCACCCCGGACGCGGAGG + Intergenic
1135419668 16:22297444-22297466 CCGGCTCTCCTCTCAGGCGGCGG - Exonic
1135821885 16:25692387-25692409 CCGGCTCGCGGCGGCGGCGGCGG - Exonic
1138360749 16:56425441-56425463 CCGGCCCGGCGCGGCGGCGGCGG - Exonic
1141430651 16:83968877-83968899 CCGGGTCCCAGCGGAGGCCACGG - Intronic
1141804978 16:86336428-86336450 CAGGCTCCCCATGGAGGCCGAGG - Intergenic
1142068608 16:88076786-88076808 GCTGTTCCCCGCGGAGGCAGCGG - Exonic
1142430786 16:90025770-90025792 CCAGCTCCTCGTGGAGGCTGAGG + Intronic
1142627858 17:1203616-1203638 CGGGCTCCTCGCAGCGGCGGCGG - Intronic
1142631686 17:1229775-1229797 GCGGCTCCTCGCGGCGGGGGCGG + Intergenic
1142876132 17:2853160-2853182 CCGACTCTGCGGGGAGGCGGGGG + Intronic
1142990020 17:3724150-3724172 CCGGCAGCCCGGTGAGGCGGCGG + Exonic
1143668170 17:8376715-8376737 CCGGCTTCCGGCGGAGCGGGCGG - Intronic
1143719459 17:8799408-8799430 CAGGTGGCCCGCGGAGGCGGTGG - Intergenic
1144021166 17:11241071-11241093 GCGGCTCCGGGCGGCGGCGGCGG - Intergenic
1144784433 17:17823819-17823841 CCACCTCCCCACGGCGGCGGGGG + Intronic
1146182971 17:30709150-30709172 CGGGCTCCCCGCAGTGGCCGCGG - Intergenic
1146371177 17:32266276-32266298 GCGGCTGCCCGCGGCGCCGGAGG + Exonic
1147393446 17:40123166-40123188 CAGGGTCCCGGCGGTGGCGGTGG - Intronic
1147644315 17:42024656-42024678 CCAGCTACCCGGGGAGGCTGAGG + Exonic
1147742095 17:42675538-42675560 CCAGCACCTGGCGGAGGCGGAGG - Intronic
1148437120 17:47693832-47693854 CCGGCTCCCTGCGGCGCCAGCGG - Intergenic
1148769023 17:50056347-50056369 CCTGCTCCCCGCGCCGCCGGAGG - Intronic
1149599744 17:57885679-57885701 CTGGCTACCCGGGGAGGAGGAGG - Exonic
1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG + Intronic
1150347516 17:64415544-64415566 CCAGCTACTCGCGGAGGCTGAGG - Intergenic
1151660051 17:75514321-75514343 CTGGCTCCCCTCGGAGTCGATGG + Intronic
1152245452 17:79182768-79182790 CCGGGCCTCCGGGGAGGCGGGGG - Intronic
1152752477 17:82070010-82070032 CCGGCTACTCGGGGAGGCTGAGG + Intergenic
1152758785 17:82097920-82097942 CCGGGGCCCCGCGGAGTAGGTGG - Intronic
1155096374 18:22559813-22559835 CCGGACGCCCGCGGGGGCGGGGG + Intergenic
1155928812 18:31685101-31685123 CCGGCGCCCCGCGGCCGCCGCGG + Intronic
1155972225 18:32092898-32092920 CCGGCTCCGCGAGGGGGAGGGGG - Intronic
1157552855 18:48593494-48593516 CCAGCTACTCGGGGAGGCGGAGG - Intronic
1157618556 18:49002173-49002195 CCCGCTCCCCTCCGAGGCTGAGG - Intergenic
1158954163 18:62523605-62523627 CCGAGTCCCCGGGGCGGCGGCGG - Exonic
1160680351 19:409233-409255 CCCCCTTCCCGCGGGGGCGGGGG - Intergenic
1160690967 19:460616-460638 CCGGATCCACTCGGCGGCGGCGG + Exonic
1160887045 19:1354967-1354989 GCCGCTCCCCGCGGGGCCGGGGG - Intronic
1161029527 19:2051223-2051245 CCGGCTCCTCTCAGCGGCGGTGG - Exonic
1161161103 19:2762272-2762294 AGGGCTGCCCGCGGAGGCTGAGG - Intronic
1161428559 19:4217623-4217645 CCGGCTGCTGGCGGAGGAGGAGG + Exonic
1162486034 19:10961115-10961137 CCGGCCCCGCGCGGAGGGGCGGG + Exonic
1162718514 19:12648249-12648271 CCGGCTCCTGGCGGAGCAGGAGG - Exonic
1162975825 19:14206618-14206640 CGGGCTCCCCGCAGTGGCCGCGG + Intergenic
1163304820 19:16471607-16471629 CCGGGGACCCGCGGAGGCGCTGG - Intronic
1164217164 19:23160766-23160788 CCGGCTGCCCCGGGAGGTGGGGG - Intergenic
1166219051 19:41353684-41353706 CCTCCTCCCCGCAGTGGCGGGGG + Exonic
1166782696 19:45350712-45350734 CCGGCTCCGAGGCGAGGCGGCGG + Exonic
1168315708 19:55483902-55483924 CCCGGGCCCCGGGGAGGCGGGGG + Exonic
924987733 2:287613-287635 CCTGGGCCGCGCGGAGGCGGCGG - Exonic
927591346 2:24360526-24360548 CCGGCTTCCTGCGGAGGCCGCGG - Exonic
928549392 2:32356850-32356872 CCCGCTCCTCGCGGGGGCAGGGG - Intergenic
929188809 2:39121093-39121115 CCGGCTCCCGGTGAAGGAGGAGG + Intronic
929501403 2:42494008-42494030 CCGGCTCGCGGCGGCGGGGGCGG + Exonic
933741636 2:85538763-85538785 GCGTCCCCCAGCGGAGGCGGCGG - Intergenic
934949412 2:98566177-98566199 CCGGCTCCTCGGGGCTGCGGGGG + Intronic
935137823 2:100322522-100322544 CCGCCTCCCCGCAGAGGTGCCGG + Exonic
935592733 2:104856222-104856244 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
936038180 2:109129123-109129145 CCAGGTCCCCGGGGAGGCCGGGG - Intergenic
936452721 2:112645741-112645763 CCGGCTCCCCGCTGGGGGCGTGG + Intergenic
937047353 2:118858864-118858886 TTGGCTGCCCCCGGAGGCGGAGG + Intergenic
937933036 2:127220144-127220166 ACGGCTCCCGGCGGGGGCGCGGG - Intergenic
942241111 2:173964677-173964699 CCGCCCCCCGGCGGCGGCGGCGG + Intronic
943571509 2:189580776-189580798 CCGGCCCACGGCGGCGGCGGCGG - Exonic
944831214 2:203535334-203535356 GCAGCGCCCCGCGGCGGCGGCGG + Exonic
946310915 2:218882185-218882207 CGGGCTCCGGGGGGAGGCGGAGG - Exonic
946372507 2:219289555-219289577 CCGGCTCCGGGCTGAGGCTGGGG + Intergenic
947118623 2:226796395-226796417 CCAGCGCCCCGGGGAGCCGGAGG - Exonic
947418487 2:229921713-229921735 CCTGCTCCCGGCGCCGGCGGCGG - Intronic
948425096 2:237882513-237882535 CTGGTTCCCGGCGGAGGTGGAGG + Intronic
948700034 2:239753642-239753664 CCGGGTCCCTGCGGAGGCTTGGG - Intergenic
1168876497 20:1175689-1175711 TCGGCTCCCCTCAAAGGCGGGGG + Intronic
1170999147 20:21396423-21396445 CCCGCTGCACGCGGCGGCGGCGG - Exonic
1171411918 20:24953277-24953299 CCATCTCCCCGAGGAGGCTGGGG + Intronic
1172118763 20:32585625-32585647 CCCGCTCCTCCCGGACGCGGCGG + Intronic
1172618985 20:36307229-36307251 GCGGCGCCCCGCGGAGACAGGGG + Intronic
1172794559 20:37527861-37527883 CCGGCTTCCTGCGGCGTCGGTGG - Exonic
1174013583 20:47470221-47470243 CCAGCTACCCGGGGAGGCTGAGG + Intergenic
1174392241 20:50224763-50224785 CCAGCTCCCCACTGACGCGGGGG + Intergenic
1174658600 20:52191850-52191872 GCGGCTCCCCGGGGAAGCGGCGG + Exonic
1176128604 20:63486954-63486976 CAGGCTCCCTGAGGATGCGGAGG - Intergenic
1176547497 21:8208135-8208157 CCGGGAGCCCGCAGAGGCGGCGG - Intergenic
1176555406 21:8252344-8252366 CCGGGAGCCCGCAGAGGCGGCGG - Intergenic
1176566448 21:8391182-8391204 CCGGGAGCCCGCAGAGGCGGCGG - Intergenic
1176574324 21:8435369-8435391 CCGGGAGCCCGCAGAGGCGGCGG - Intergenic
1176610936 21:8986661-8986683 CCGGGAGCCCGCAGAGGCGGCGG - Intergenic
1178288289 21:31344228-31344250 CCGGCTGCTGGCGGAGGCAGTGG + Intronic
1178334714 21:31732444-31732466 CCTGCACCCGGCGGGGGCGGCGG + Intergenic
1178403523 21:32306721-32306743 CCGCCTCCCCGCAGATGAGGTGG + Exonic
1180216048 21:46324413-46324435 GCGGCTTCCAGCGGAGCCGGCGG - Intronic
1180949310 22:19714185-19714207 CCGGGTCCCAGCGAGGGCGGGGG + Intergenic
1181003866 22:20000321-20000343 CTGGCTCCCAGCAGAGGAGGGGG - Intronic
1181048744 22:20228811-20228833 CCGGCTCCCCGCAGATGGGAGGG + Intergenic
1181155443 22:20917370-20917392 CCGGCTCCCGGCGGCCGCCGGGG - Intergenic
1182494219 22:30694922-30694944 GCGGCTCCGAGCCGAGGCGGCGG + Exonic
1182903957 22:33920761-33920783 CCGGCGCATCTCGGAGGCGGCGG - Intronic
1184086790 22:42270362-42270384 CCCGCCCCCGGCGGAGGCCGAGG - Intronic
1184184637 22:42856800-42856822 GCGGCTCTGAGCGGAGGCGGGGG - Intronic
1184247043 22:43241002-43241024 CCGGGTCTCTGCGGAGGGGGAGG + Intronic
1184593753 22:45502545-45502567 CCGACTCCGCGCGGAGGAGCGGG - Intronic
1185055262 22:48575860-48575882 CTGGCCCGCCGCGGCGGCGGTGG + Intronic
1185409605 22:50674823-50674845 GAGGGTCCCGGCGGAGGCGGCGG - Intergenic
1203252370 22_KI270733v1_random:124420-124442 CCGGGAGCCCGCAGAGGCGGCGG - Intergenic
1203260427 22_KI270733v1_random:169506-169528 CCGGGAGCCCGCAGAGGCGGCGG - Intergenic
951803540 3:26623048-26623070 TTGGCTCCCGGCGAAGGCGGCGG - Exonic
952706270 3:36380682-36380704 CGGGCTGCCCAAGGAGGCGGTGG + Exonic
953561903 3:43998609-43998631 CCTGCTCCCTGCGCAGGAGGAGG - Intergenic
954672319 3:52297689-52297711 CTGGCTCCCCAAGGAGGCAGTGG - Intergenic
960101219 3:113745781-113745803 TCGGCTCCCGGAGGGGGCGGAGG - Intronic
960120854 3:113947835-113947857 CCGCCTCCCCGCGGTGCCCGCGG - Intergenic
961322265 3:126084092-126084114 CCGGGTCCCCTCCCAGGCGGCGG + Exonic
961389204 3:126542423-126542445 GCGGCTCCCCGGGGCCGCGGCGG - Exonic
961585049 3:127915418-127915440 CCCGCGCCCTGCGGAGGAGGAGG - Exonic
962793985 3:138834998-138835020 CCCGGGCCCCGCGGTGGCGGCGG + Intergenic
964570788 3:158105834-158105856 CGGGCGGCCGGCGGAGGCGGCGG - Exonic
964771253 3:160225993-160226015 CCGGCGCCCCCCGGAGGCCCGGG - Exonic
965590829 3:170358308-170358330 CCGCCCCCCCGCGGGGGCCGCGG - Intronic
965757415 3:172040309-172040331 CCGCCTCTCCGCGCCGGCGGGGG + Intronic
966883330 3:184361797-184361819 CCGGCTCCCTGCGGATGCCCGGG + Intronic
966982666 3:185152826-185152848 TCGGCTCCGCGCGGAGGGAGAGG - Exonic
967493776 3:190120986-190121008 CAGGCTCCCCGCTGCAGCGGCGG + Intronic
967859018 3:194137889-194137911 CCGGGTCCCGGTGGGGGCGGTGG - Exonic
968009630 3:195265561-195265583 CCAGCTCTCTGCAGAGGCGGTGG - Intronic
968161638 3:196432021-196432043 CCGGGTCCCCGGGCCGGCGGGGG + Intronic
968551614 4:1226336-1226358 CCGTCTCCCTGGGGAGGAGGAGG + Intronic
968575069 4:1362227-1362249 CCGCCTCCCCGCGGTGGCTGGGG + Intronic
969330337 4:6470982-6471004 CCGGAGCCCCGCGGAGGCCCGGG - Intronic
969532254 4:7736552-7736574 CCGGGTCCCAGTGGAGGCAGCGG + Intronic
970202882 4:13627490-13627512 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
971231146 4:24800686-24800708 CTGGCTTCCCGCGGGAGCGGTGG - Exonic
974385755 4:61200992-61201014 CCGGCTGTCCGCGGAGGTTGCGG + Intergenic
975612182 4:76213889-76213911 CCGCCTCCCCGCGCAGTCGCCGG - Exonic
982486242 4:155968856-155968878 CCAGCTCCTCGGGGAGGCTGAGG + Intergenic
983923437 4:173371265-173371287 CCCGTTCCCCGCCGAGGCGGCGG - Exonic
985489285 5:169821-169843 CCTGCTGCCCCTGGAGGCGGAGG + Intronic
985688688 5:1295152-1295174 CGGGGTCCGCGCGGAGGAGGCGG + Intergenic
985778364 5:1857072-1857094 CTGGCTCCCCGCACAGGCTGGGG + Intergenic
990382919 5:55233467-55233489 CCGCCTCCCCGCTCGGGCGGCGG + Exonic
990955151 5:61332811-61332833 CCCGGCCCCCGCGGCGGCGGCGG - Exonic
992769704 5:80035505-80035527 CCTGCTCCCCGCGAGGCCGGGGG - Exonic
993503320 5:88685105-88685127 CCGGCTCCCCTGGGACGCTGGGG - Intergenic
993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG + Exonic
994043617 5:95284656-95284678 CCGGGTCCCCGCGGCGCTGGCGG + Intergenic
994083219 5:95731190-95731212 CGCGCTCCCCGCGGAGGCCCCGG - Exonic
994171349 5:96662445-96662467 CCGGGGCCGCGGGGAGGCGGCGG - Exonic
995224662 5:109689650-109689672 CAGGCTCCGCGGGGAGGCGCAGG - Exonic
995574373 5:113513929-113513951 CCGGCTCCTGGCGGTGGCGGAGG + Exonic
996185261 5:120465572-120465594 GCGGCTCCGGGCGGGGGCGGGGG + Intronic
1002199009 5:177516638-177516660 CCTCCTCCCCACGGAGGCCGAGG + Intronic
1002498884 5:179634491-179634513 CCCGCGCACCGCGGAGGAGGCGG - Intronic
1002502792 5:179658033-179658055 CCCGCGCACCGCGGAGGAGGCGG + Intergenic
1002591214 5:180292429-180292451 CCGGCTCCCCGCGGACCCCGCGG - Intergenic
1003049418 6:2766056-2766078 CGCGCTCCCCGCCGCGGCGGCGG - Exonic
1003881347 6:10482757-10482779 CCGGGTGCCGGCGGAGGAGGGGG + Intergenic
1005456040 6:26020873-26020895 CCCTCTCTCCGCGGATGCGGCGG - Exonic
1007557987 6:42782736-42782758 CCGGCTCCCGGCGGCTCCGGGGG - Intronic
1007600072 6:43076076-43076098 CCGGATCCCTGCAGAGTCGGTGG + Intergenic
1007625369 6:43243572-43243594 CCCGCTCCCTCCGGCGGCGGCGG - Intergenic
1011762777 6:90586697-90586719 CCGGCACCAGGCAGAGGCGGGGG + Intronic
1015149433 6:130020543-130020565 CCGGGTCCCCGCGGAGGGCTGGG + Intronic
1017446349 6:154510341-154510363 CGGGATCCCGGCGGCGGCGGGGG - Exonic
1017672493 6:156779560-156779582 CCGTCTTCCCGCGGGGGCGGCGG + Intronic
1017891587 6:158644226-158644248 ACGTCTCCCCGCGGAGGTGCGGG - Intronic
1018613379 6:165663192-165663214 GCCGCTGCCCGTGGAGGCGGTGG + Intronic
1019562583 7:1665935-1665957 CCGGAGCCCAGCGGAGCCGGCGG - Intergenic
1019707878 7:2505059-2505081 CCGCCTCCCCGCAGAGGCCCTGG + Intergenic
1020079049 7:5276712-5276734 ACGGTTCCCTGCGGAGGCAGAGG - Intronic
1020418210 7:7969448-7969470 CCCGCTCCCGGCGGCGGCGACGG - Exonic
1022731053 7:33026231-33026253 CCAGCTGCTCGGGGAGGCGGAGG + Intronic
1024579825 7:50792968-50792990 CGGGCGCGCGGCGGAGGCGGAGG - Intronic
1024579918 7:50793241-50793263 CCGCAGCCACGCGGAGGCGGCGG - Intronic
1025812172 7:64882303-64882325 TCGGCTCCCCCTGGAGGAGGAGG - Intronic
1026909467 7:74083898-74083920 CCGCCGGCCCGGGGAGGCGGGGG - Intronic
1026909472 7:74083901-74083923 CCGCCTCCCCGGGCCGGCGGCGG + Intronic
1028417625 7:90596506-90596528 CCGGCCCGCCGAGGAGGTGGTGG + Intronic
1029487866 7:100854230-100854252 CCGGCTCCTGGGGGAGGAGGGGG + Exonic
1031886841 7:127252797-127252819 CCTGCTCCCCGCAGAGGGCGCGG + Exonic
1032525699 7:132577083-132577105 GCTGCTCCCCGGGGAGGCGCGGG + Exonic
1034200805 7:149281923-149281945 CTGGCTCCCCGAGGAGCCTGAGG + Exonic
1034414128 7:150955959-150955981 CCGGCTGCTGGCGGAGGGGGAGG - Intronic
1034468883 7:151245462-151245484 GCGGCTCCGCGCGGGGGCGGTGG + Exonic
1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG + Exonic
1037590007 8:20304146-20304168 CCGGGACCCCGCGCAGGCCGCGG - Intergenic
1039512819 8:38105363-38105385 CCGGCCTCCCGCGCCGGCGGTGG - Exonic
1040065444 8:43140804-43140826 GCCGGGCCCCGCGGAGGCGGGGG + Intronic
1040981570 8:53251001-53251023 CCGGCTCCCCGCGGAAGATCTGG + Exonic
1043502809 8:80873845-80873867 CCGGCGCTGCGCGGCGGCGGCGG + Intronic
1044335970 8:90985224-90985246 CTGGCTGACCGCGGTGGCGGCGG + Exonic
1044719851 8:95134299-95134321 CCGTCCCCCCGCGGCGGCGGCGG - Intronic
1045564364 8:103298795-103298817 CGGGCTCGCGGCGGCGGCGGCGG - Intronic
1047251784 8:123186413-123186435 CCGGCTCCGCTCGGGGGCTGAGG - Intronic
1047259192 8:123241068-123241090 CCGCTTCCCCGTGGAGGAGGAGG + Intronic
1047259228 8:123241166-123241188 CCGGGGCCCCGCGGAGGGCGAGG + Intronic
1047614983 8:126556552-126556574 CCTGCACCCGGCGGAGCCGGAGG - Exonic
1048214264 8:132480863-132480885 CCGGCGCTCCGGGGCGGCGGCGG + Exonic
1048308039 8:133297178-133297200 CCAGCGCCCCGCGGAAGCCGAGG + Exonic
1049419529 8:142510705-142510727 GCGGCTCTCGGCGGCGGCGGCGG + Intronic
1049740912 8:144240445-144240467 CCGCCTTCCAGCGGAGGCCGGGG - Intronic
1049896128 9:113513-113535 CCGGCTCCGCGGGGCGGCGCGGG + Intergenic
1054842623 9:69759815-69759837 CCGACGACCCTCGGAGGCGGCGG + Intronic
1057470212 9:95350012-95350034 CGGACTCCCTCCGGAGGCGGAGG + Intergenic
1057997147 9:99828722-99828744 CTGGCTGCCCGCGGCGGCTGCGG - Exonic
1058070791 9:100598822-100598844 CCGGCTCCGCGGGCAGGAGGAGG + Intergenic
1060599587 9:124869147-124869169 GCGGCTGCGCGCGGAGGCGGTGG + Exonic
1061656977 9:132099795-132099817 CTGGTCCCCCACGGAGGCGGAGG - Intergenic
1061802765 9:133121186-133121208 CCGGCGCGCGGCGGGGGCGGCGG + Intronic
1062179723 9:135184862-135184884 CCGGCTTCCCGGAGAGGCGACGG - Intergenic
1062272789 9:135717493-135717515 CTGGCTCCCCCTGGAGGCTGCGG + Intronic
1062362105 9:136193086-136193108 CAGTCTCCCCGCGGAGCGGGAGG - Intergenic
1062389229 9:136327466-136327488 CCCCCTCCCCGCGCGGGCGGCGG + Exonic
1062462002 9:136666048-136666070 CCGGCTCCCCCTGCCGGCGGCGG + Intronic
1062592837 9:137281709-137281731 CCGGCTCCACGGGGTGGGGGTGG + Exonic
1062630777 9:137462149-137462171 CCGGCCACCCGCGGCGGCGGAGG - Intronic
1203770881 EBV:49529-49551 CCCGGTCCCAGCGGATGCGGCGG - Intergenic
1203468775 Un_GL000220v1:107571-107593 CCGGGAGCCCGCAGAGGCGGCGG - Intergenic
1203476596 Un_GL000220v1:151543-151565 CCGGGAGCCCGCAGAGGCGGCGG - Intergenic
1192440399 X:71169780-71169802 CCGGCTCCCCGCTGAGGGCTAGG - Exonic
1192962490 X:76145327-76145349 CCGCCTCCCCGAAGAGGCGGTGG + Intergenic
1192963043 X:76149760-76149782 CCGCCTCCCCGAAGAGGCGGTGG - Intergenic
1197709337 X:129654644-129654666 CCGGCTCGCCGGGGCCGCGGCGG - Exonic
1197749198 X:129953243-129953265 CCGGCTGCCCGAGGAGGGAGGGG - Intergenic
1200402679 X:156028756-156028778 CCGGCGCCACGAGGGGGCGGTGG + Intergenic