ID: 1116911250

View in Genome Browser
Species Human (GRCh38)
Location 14:50467176-50467198
Sequence ACGTGTGACCCATTTTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116911249_1116911250 9 Left 1116911249 14:50467144-50467166 CCAATCTACAAGAGAACTTTGTC 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1116911250 14:50467176-50467198 ACGTGTGACCCATTTTCTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116911250 Original CRISPR ACGTGTGACCCATTTTCTTG TGG Intronic
903266548 1:22161301-22161323 TCCTGTGACCCATTCTCCTGAGG + Intergenic
904602416 1:31680869-31680891 GCCTGTGACCCATATTCTAGGGG - Intronic
904663990 1:32106020-32106042 GCGCCTGGCCCATTTTCTTGAGG - Intergenic
905095227 1:35464664-35464686 ACATTTTCCCCATTTTCTTGGGG - Intronic
905516803 1:38567839-38567861 ACTTTTCACCCATTTCCTTGTGG + Intergenic
909508715 1:76426065-76426087 ACTTTTGCCCCATTTTCTTTAGG + Intronic
911511758 1:98815893-98815915 ACGTGACAGCCATTTTCATGAGG + Intergenic
913307728 1:117450524-117450546 ACATTTGCCCCATTGTCTTGGGG - Intronic
916959168 1:169872071-169872093 ACATTTTCCCCATTTTCTTGGGG - Intronic
918666768 1:187161214-187161236 ACTTGTGACCTATTTTTTTCTGG + Intergenic
920734339 1:208517142-208517164 ACGTTTTCCCCATTGTCTTGAGG + Intergenic
921308262 1:213818503-213818525 TCGTGTGACCCATTTTATTGCGG + Intergenic
922973290 1:229761156-229761178 ACCTGTGTCCCCTCTTCTTGGGG + Intergenic
1068184152 10:53563954-53563976 ACATGTTCCCCATTGTCTTGAGG - Intergenic
1070485259 10:76924324-76924346 ATGTATGATCCATTTTTTTGAGG + Intronic
1075550292 10:123387997-123388019 ACGTTTTCCCCATTCTCTTGGGG - Intergenic
1079248685 11:18771839-18771861 ACACGTGACCCATTCTCATGAGG - Intronic
1079281979 11:19095908-19095930 AATTGGGACACATTTTCTTGGGG - Intergenic
1079739157 11:24036097-24036119 ACATTTTTCCCATTTTCTTGGGG - Intergenic
1080359850 11:31500143-31500165 AAGACTGACCAATTTTCTTGTGG - Intronic
1080566984 11:33519050-33519072 ATGTGTAGCACATTTTCTTGGGG + Intergenic
1080739702 11:35052345-35052367 GAGTGTGACCCATTCTGTTGTGG + Intergenic
1084512289 11:69613755-69613777 ACCTGTGGCCCATTAACTTGGGG - Intergenic
1085731790 11:79006263-79006285 AGGTGCCACCCATTTTCTTGGGG - Intronic
1098926947 12:76360979-76361001 ACATTTTCCCCATTTTCTTGGGG + Intronic
1099780025 12:87182862-87182884 ACGTTTTCCCCATTGTCTTGGGG - Intergenic
1101333997 12:103780108-103780130 ACATGTGACAAATTTCCTTGAGG - Intronic
1101663631 12:106788843-106788865 ACATTTTCCCCATTTTCTTGGGG + Intronic
1101994281 12:109513764-109513786 ACGAGGGCCCCATTTTCCTGAGG - Intronic
1102102339 12:110290002-110290024 ACCTCTGCCCCATTTTCTTGGGG + Intronic
1104165282 12:126223056-126223078 TTGTGTGACACATTTTATTGTGG + Intergenic
1105338099 13:19493760-19493782 ATGTGTGACAGATTTTCTGGTGG + Intronic
1107188316 13:37549596-37549618 ACATTTTACCCATTGTCTTGGGG - Intergenic
1108115772 13:47126187-47126209 ACTTGTGAACAATTTTGTTGTGG - Intergenic
1108671639 13:52696112-52696134 CCGTGTGACTGAGTTTCTTGAGG + Intronic
1109838862 13:67895696-67895718 AAGTGTTACACATTTTGTTGAGG - Intergenic
1109951866 13:69510673-69510695 ACATTTTTCCCATTTTCTTGGGG - Intergenic
1110377805 13:74814258-74814280 ACATTTTCCCCATTTTCTTGGGG - Intergenic
1111558932 13:89918593-89918615 ACCTATGATCCCTTTTCTTGAGG + Intergenic
1111850932 13:93573892-93573914 ATGTGTGATCCATTGTCTTTAGG + Intronic
1111891308 13:94085706-94085728 ACAAGTTACCTATTTTCTTGAGG - Intronic
1115298516 14:31857403-31857425 ACGTTTTCCCCATTGTCTTGGGG + Intronic
1116911250 14:50467176-50467198 ACGTGTGACCCATTTTCTTGTGG + Intronic
1117593669 14:57304268-57304290 TCGTTTGACCCATTTTACTGGGG + Intergenic
1118069558 14:62231565-62231587 ACGTTTTCCCCATTGTCTTGGGG - Intergenic
1118085037 14:62404619-62404641 ACATGTAAGGCATTTTCTTGGGG + Intergenic
1118496134 14:66309512-66309534 ACATGTCCCCCATTGTCTTGAGG + Intergenic
1118539520 14:66806359-66806381 ACATTTTCCCCATTTTCTTGGGG + Intronic
1120755191 14:88236662-88236684 ATGTGTGACTCATTTTATTGTGG - Intronic
1121809813 14:96874639-96874661 ATGTGTGAAGCATTTTCTTTAGG + Intronic
1122036326 14:98951704-98951726 AAGTGAGACCCACCTTCTTGAGG + Intergenic
1131665610 15:94568246-94568268 CTGTCTGTCCCATTTTCTTGTGG + Intergenic
1131795139 15:96008528-96008550 GCCTGTGTCCCCTTTTCTTGAGG - Intergenic
1139271199 16:65684564-65684586 ATATGTGACTCCTTTTCTTGAGG - Intergenic
1139966969 16:70751128-70751150 ACGTTTGACCAAGTTTCTTAAGG - Intronic
1142551636 17:744203-744225 AGAGGGGACCCATTTTCTTGAGG + Intergenic
1143068159 17:4266117-4266139 ACGTGTAAGCCTTTTTGTTGTGG + Intergenic
1146338692 17:31999362-31999384 AATTGTGAGACATTTTCTTGGGG + Exonic
1153978198 18:10287718-10287740 AAGTTTGCCCCATCTTCTTGTGG + Intergenic
1156322283 18:36038154-36038176 ACGTTTTCCCCATTGTCTTGAGG - Intronic
1159374757 18:67579170-67579192 AAGTGAAACCCATTTTGTTGAGG - Intergenic
1160327695 18:77966267-77966289 AAGTGTGACACATATTCTTAAGG - Intergenic
1163765283 19:19160403-19160425 TCCTGTGACCCATTTTATGGGGG - Intronic
1164566248 19:29327998-29328020 ACATGTAACCCATTTTCTCATGG + Intergenic
925117288 2:1390384-1390406 ATATGTGCCACATTTTCTTGTGG + Intronic
930574647 2:53131601-53131623 ACATGTGAGTCATTTTCTTGTGG - Intergenic
932107521 2:68959700-68959722 ATGTGTCAACTATTTTCTTGTGG - Intergenic
935705824 2:105856424-105856446 ACCTGTGTCACATTTACTTGGGG + Intronic
935850442 2:107213254-107213276 TCATGGGACCCAGTTTCTTGAGG + Intergenic
936038473 2:109130307-109130329 ACGTGTGTCCCATCCTCCTGTGG + Intronic
938231356 2:129662916-129662938 ACTTGTGCTCCATCTTCTTGAGG - Intergenic
940431388 2:153593809-153593831 ACCACTGACCCATTTTCTGGTGG + Intergenic
943084095 2:183291607-183291629 AAATGTGACTCATTTTTTTGTGG + Intergenic
1169508194 20:6235789-6235811 AGGTGTGAGCCACTTGCTTGTGG - Intergenic
1170317086 20:15054611-15054633 GTGTGTGACTCATTTTATTGTGG + Intronic
1170804319 20:19616640-19616662 TCCTGGAACCCATTTTCTTGGGG - Intronic
1171396001 20:24833611-24833633 ACGTGTGGCCCAGTTTACTGTGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172439419 20:34955310-34955332 AAGTGCGACCGATTTCCTTGTGG - Intronic
1172796146 20:37539749-37539771 ACATGTGACCCAGGTTGTTGGGG + Intergenic
1173209548 20:41021527-41021549 ACTTCTGTTCCATTTTCTTGGGG + Intergenic
1178099640 21:29253487-29253509 ACATGTTCCCCATTGTCTTGGGG + Intronic
950843307 3:15988450-15988472 ACATTTTACCCATTGTCTTGGGG + Intergenic
951960878 3:28318895-28318917 AATTGTGCCCCATTTTCTTCAGG + Intronic
956410265 3:68971722-68971744 AGCTGTAACCCATTTTTTTGTGG + Intergenic
957144521 3:76406477-76406499 ACCTGTGGGCCATTTTCTTAAGG - Intronic
957407534 3:79790722-79790744 ACATTTTTCCCATTTTCTTGGGG + Intergenic
958481568 3:94651554-94651576 ACATTTGCCCCATTGTCTTGGGG - Intergenic
958960470 3:100504974-100504996 ACGACAGACCCATTTTCTGGGGG - Intronic
966611574 3:181873127-181873149 ACATGTGGCCTAGTTTCTTGAGG + Intergenic
967363295 3:188656616-188656638 ACAGGTGACCCATTTCCTGGTGG + Intronic
967412560 3:189181229-189181251 ACATTTTCCCCATTTTCTTGGGG + Intronic
971149842 4:24020526-24020548 ACCTGTGAAGCATTGTCTTGTGG - Intergenic
973312567 4:48725260-48725282 AAGTGTGGGCCATTTTCTTCTGG - Intronic
974943213 4:68493457-68493479 ACATGGCACCCATTTTTTTGGGG + Intronic
975848660 4:78549781-78549803 ACCTGTTACTCATTTTCTTCTGG + Intergenic
976021603 4:80635549-80635571 AACTGTGACCCATTTTGTTTTGG - Intronic
977366030 4:96068700-96068722 ACATTTTACCCATTTTCTTGGGG + Intergenic
977973013 4:103232869-103232891 ACGTTTTTCCCATTGTCTTGGGG - Intergenic
978915744 4:114124333-114124355 ACATTTTTCCCATTTTCTTGGGG + Intergenic
979390174 4:120118273-120118295 ACATTTGCCCCATTGTCTTGGGG + Intergenic
982082114 4:151800494-151800516 AGGTCTGACCCTTTTCCTTGTGG - Intergenic
982722168 4:158870163-158870185 ACCTGTGATCCACTTACTTGAGG + Intronic
983926900 4:173412418-173412440 ACATGGGAGCCATTTTATTGAGG - Intergenic
987181629 5:15373920-15373942 ATTTCTGACCCATTATCTTGGGG - Intergenic
987260447 5:16196759-16196781 ACGTTTTCCCCATTGTCTTGGGG + Intergenic
988949015 5:36239684-36239706 AGATGCCACCCATTTTCTTGAGG + Intronic
991464105 5:66891962-66891984 ACCTGTGACACCTATTCTTGTGG + Intronic
995437232 5:112150295-112150317 ACTTGTTGCCCATTTTCTCGTGG - Intronic
1001126336 5:169022915-169022937 ACCTTTTGCCCATTTTCTTGTGG - Intronic
1009780356 6:68260787-68260809 ACATTTTTCCCATTTTCTTGGGG + Intergenic
1011645186 6:89450923-89450945 TTGTGTGACTCATTTTATTGTGG + Intronic
1014449314 6:121565250-121565272 ACATGTCCCCCATTGTCTTGGGG - Intergenic
1016937723 6:149460037-149460059 ACGTGTGACTCATGTGCCTGAGG + Intronic
1022492945 7:30834542-30834564 ACGTTTTCCCCATTGTCTTGTGG + Intronic
1026234811 7:68517857-68517879 ACTTGTGAACCATTTTAATGAGG - Intergenic
1028143792 7:87299226-87299248 ACATGTCTCCCATTGTCTTGGGG + Intergenic
1030587559 7:111439442-111439464 TCGTGTGACTCACTTTATTGAGG - Intronic
1030826764 7:114168711-114168733 ACGTTTTCCCCATTGTCTTGAGG - Intronic
1031700543 7:124919572-124919594 CTGTGTGTCCCATTTTCTTTTGG - Intronic
1046231573 8:111364807-111364829 ACATGTTCCCCATTGTCTTGGGG + Intergenic
1046400369 8:113697323-113697345 ACATTTTCCCCATTTTCTTGGGG - Intergenic
1047341205 8:123982075-123982097 ACGTGTGCGCCAGTTTCTTGTGG + Intronic
1047394510 8:124483165-124483187 ATTAGTGGCCCATTTTCTTGGGG + Intronic
1048677053 8:136794517-136794539 ACTTCTGACCCATTGTCTTCAGG + Intergenic
1050789868 9:9454251-9454273 AGCTTTTACCCATTTTCTTGAGG + Intronic
1051860880 9:21623450-21623472 ACGTTTTCCCCATTATCTTGGGG + Intergenic
1052188961 9:25634077-25634099 ATGTGTGTCACATTTTCTTGTGG + Intergenic
1059435331 9:114272481-114272503 AGGAGAGACCCATTTTCTTAAGG + Intronic
1186761612 X:12729338-12729360 TGGAGTAACCCATTTTCTTGAGG + Intergenic
1186797704 X:13062601-13062623 ACATTTTCCCCATTTTCTTGGGG + Intergenic
1188600062 X:31952734-31952756 AACTGTGACCCATTCTCATGGGG - Intronic
1193422061 X:81294205-81294227 ACTTTTTCCCCATTTTCTTGGGG - Intronic
1196391278 X:115210161-115210183 ACATTTTCCCCATTTTCTTGGGG - Intronic
1196713156 X:118784814-118784836 ATGTGTCATCCATTTTCTTCTGG + Intronic
1198857447 X:141033210-141033232 ACATTTTACCCATTGTCTTGGGG - Intergenic
1198905249 X:141554161-141554183 ACATTTTACCCATTGTCTTGGGG + Intergenic
1200033039 X:153311694-153311716 ACGTGTGGCCCATGTTATTCTGG + Intergenic