ID: 1116912759

View in Genome Browser
Species Human (GRCh38)
Location 14:50488651-50488673
Sequence CTGGAAACACAGTTGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116912759_1116912765 9 Left 1116912759 14:50488651-50488673 CCACCCTGCAACTGTGTTTCCAG 0: 1
1: 0
2: 4
3: 18
4: 241
Right 1116912765 14:50488683-50488705 TGTGAGGTTTCTATCAGGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 167
1116912759_1116912767 20 Left 1116912759 14:50488651-50488673 CCACCCTGCAACTGTGTTTCCAG 0: 1
1: 0
2: 4
3: 18
4: 241
Right 1116912767 14:50488694-50488716 TATCAGGCAAGGTGAGGTCTTGG 0: 1
1: 0
2: 0
3: 13
4: 151
1116912759_1116912764 4 Left 1116912759 14:50488651-50488673 CCACCCTGCAACTGTGTTTCCAG 0: 1
1: 0
2: 4
3: 18
4: 241
Right 1116912764 14:50488678-50488700 AGCTATGTGAGGTTTCTATCAGG 0: 1
1: 0
2: 1
3: 15
4: 106
1116912759_1116912762 -7 Left 1116912759 14:50488651-50488673 CCACCCTGCAACTGTGTTTCCAG 0: 1
1: 0
2: 4
3: 18
4: 241
Right 1116912762 14:50488667-50488689 TTTCCAGCAGCAGCTATGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 216
1116912759_1116912766 14 Left 1116912759 14:50488651-50488673 CCACCCTGCAACTGTGTTTCCAG 0: 1
1: 0
2: 4
3: 18
4: 241
Right 1116912766 14:50488688-50488710 GGTTTCTATCAGGCAAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116912759 Original CRISPR CTGGAAACACAGTTGCAGGG TGG (reversed) Intronic
900161437 1:1225907-1225929 CTGAAGACACGGCTGCAGGGCGG + Intronic
900829787 1:4957808-4957830 CTGGAAATACAGTTGCATCATGG + Intergenic
902301403 1:15505216-15505238 CTGGAAACCTTGTTGCTGGGCGG + Intronic
902973808 1:20074317-20074339 CTGCATAAACTGTTGCAGGGAGG + Intronic
903464890 1:23545219-23545241 CTGGAGCCACAGCTGCAAGGTGG + Intergenic
903546313 1:24125588-24125610 CTGTAAACAAAGTTGCAAAGTGG + Intronic
905320569 1:37113917-37113939 CTGGAAGCATAGATGCTGGGAGG + Intergenic
909396306 1:75174415-75174437 CTGGAATTACAGGTGTAGGGAGG - Intergenic
909795633 1:79732088-79732110 CAGGAAAAACAGTTGAGGGGGGG + Intergenic
909997730 1:82301170-82301192 CTGCAAACACAGTTACATGGGGG + Intergenic
911559508 1:99387107-99387129 GTGTAAACACAGTTGAATGGAGG - Intergenic
911775735 1:101809647-101809669 ATGGAAACACAGTTCCAAGAGGG + Intronic
912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG + Intergenic
914949395 1:152099139-152099161 CTGAAAACTCAGAAGCAGGGAGG + Intergenic
916581422 1:166112849-166112871 GTGGAAACCCAGGTGCAGAGAGG + Intronic
916673099 1:167042545-167042567 ATGGAAACTCAATTGGAGGGTGG + Intergenic
917671065 1:177274058-177274080 CTGGAACCACAGTTTGAAGGTGG + Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
920981203 1:210837268-210837290 CTGGGAACACAGGGGAAGGGTGG - Intronic
922575388 1:226657951-226657973 CTGGGAACAGACTTGGAGGGAGG - Intronic
923099241 1:230799028-230799050 CTGGAAAGAAAGATACAGGGAGG - Intronic
924089484 1:240487600-240487622 CTGGGAACACAGTTGGTGAGTGG - Intergenic
1062836004 10:636073-636095 CTGGAAACACACATGTAGTGTGG - Intronic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064644731 10:17449459-17449481 CTTGAAACATCTTTGCAGGGAGG + Intronic
1067400116 10:45965032-45965054 CCAGACACACAGCTGCAGGGAGG - Intergenic
1067868446 10:49934324-49934346 CCAGACACACAGCTGCAGGGAGG - Intronic
1070048552 10:72863736-72863758 CTGTAATCCCAGTTACAGGGAGG - Intronic
1071123659 10:82309753-82309775 CTGGAATCACAGTGTCGGGGAGG + Intronic
1071366107 10:84902070-84902092 GTGGAATTTCAGTTGCAGGGAGG - Intergenic
1071505736 10:86230310-86230332 CTGGTCACACAGTTGCCTGGGGG + Intronic
1071913991 10:90269787-90269809 TTGGAAACTGAGTTCCAGGGTGG - Intergenic
1074255920 10:111802415-111802437 ATACAAACACAGTTGCAGTGGGG + Intergenic
1076402974 10:130195365-130195387 CCGGAAACCCAGGTGCAGGCAGG + Intergenic
1078145667 11:8720463-8720485 CTGGAAACTCAATTTCAGGAAGG + Intronic
1078196426 11:9140628-9140650 TAGGAAACACAGTTGAAAGGAGG - Intronic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1080392394 11:31860557-31860579 CTGGCATCACAGTGGCAGAGGGG + Intronic
1081625569 11:44653340-44653362 CTGGAAAAGCAGTGGCAAGGAGG - Intergenic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1084780731 11:71406700-71406722 CTGGGAACGCAGTTGCACTGGGG + Intergenic
1085722684 11:78926758-78926780 CAGTAAACAGAGCTGCAGGGTGG + Intronic
1086163471 11:83749574-83749596 CTGGAAATACAGCTGCTGGGTGG - Intronic
1087657975 11:100949250-100949272 CTGGTAACACAGTTTGAGGGAGG - Intronic
1087860259 11:103144787-103144809 CTGGAAACACAGATATACGGTGG + Intronic
1088598933 11:111458905-111458927 ATGGTAAAACAGTGGCAGGGAGG - Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1088819927 11:113448317-113448339 CTGGAATCACAGTTGCTGCCTGG - Intronic
1089377066 11:118002023-118002045 CTGGGAACAGAGCTCCAGGGAGG - Intergenic
1090793801 11:130116591-130116613 CTGTAATCTCAGCTGCAGGGTGG - Intronic
1090899125 11:131010489-131010511 CTTGAACCACACATGCAGGGAGG - Intergenic
1091111164 11:132969530-132969552 ATTTAAACACAGTTGCAGGGGGG - Intronic
1096830321 12:54308813-54308835 CTGGGAATACAGTTGCATGCAGG - Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1102299824 12:111763133-111763155 ATGGAAACTCAGTTGTAGTGGGG - Intronic
1102437906 12:112939699-112939721 CTGGGATCACAGTGGCAGTGTGG - Intronic
1102783541 12:115585520-115585542 CTGGGAGGACAGATGCAGGGAGG + Intergenic
1103157619 12:118699930-118699952 GTGGAAGCCCAGTTGCATGGAGG - Intergenic
1104038074 12:125112295-125112317 CTGGAAGCTGAGCTGCAGGGTGG - Intronic
1104631334 12:130405431-130405453 GTGGAAACACATGTGCAAGGTGG + Intronic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1107605848 13:42055852-42055874 CTGGAAACACATTTGTAGCTGGG + Intronic
1110555086 13:76850779-76850801 CTGGAAACTCAGTCCCAGGAAGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113438690 13:110311860-110311882 CTGGAAACTAAGCGGCAGGGTGG - Intronic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1114306000 14:21423477-21423499 CTCTCAACACAGTTGCATGGGGG + Intronic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1118242586 14:64074380-64074402 CTGGAAACATAGTTGAAAGAAGG - Intronic
1118793949 14:69122625-69122647 CTGGAAAGACAGGAACAGGGTGG - Intronic
1120306894 14:82782138-82782160 CTTGAAACACAGTTGCATTGGGG + Intergenic
1121485618 14:94312365-94312387 CAGTAAACCCAGGTGCAGGGAGG - Intronic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123826048 15:24083153-24083175 CTGAGAACACAGTTGCAGTGTGG - Intergenic
1125545631 15:40502167-40502189 CTGGAAAGACAGTTCCTGGATGG + Intergenic
1126242547 15:46461743-46461765 CTGAAACCACAGATACAGGGAGG + Intergenic
1127448313 15:59089051-59089073 CTGGGAACAGAGTTGCATGTTGG + Intronic
1127916678 15:63460655-63460677 CAGGAACCACAGATCCAGGGAGG - Intergenic
1128459948 15:67859574-67859596 CATGACACACAGTAGCAGGGGGG - Intergenic
1130646305 15:85730187-85730209 CTGGGAAAGCAGTTGCAGAGTGG + Intronic
1130867845 15:87947583-87947605 CTGGAAACTCTGTTTCTGGGTGG - Intronic
1131326277 15:91449871-91449893 CAGGGAACACACCTGCAGGGAGG - Intergenic
1131330269 15:91491456-91491478 CTGGGAACCTAGTTTCAGGGGGG - Intergenic
1133260850 16:4548937-4548959 CTGGCAACACAGTGGCACTGGGG + Intergenic
1136458203 16:30394451-30394473 CTGGAAACACAGCTCCAGCCAGG + Intronic
1137881710 16:52055830-52055852 CTGTTATCACAGTTACAGGGAGG - Intronic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1141779883 16:86152378-86152400 CAGGAAACATAGATGCTGGGGGG + Intergenic
1142034456 16:87854890-87854912 GTGGAGACACAGGTGAAGGGAGG - Intronic
1144238068 17:13281915-13281937 CTGGAAAGATATTTGAAGGGGGG - Intergenic
1144676617 17:17166228-17166250 CTGGGAGCACTGCTGCAGGGAGG - Intronic
1145324628 17:21793583-21793605 CTGGAAACAAAGTAGAAGTGAGG + Intergenic
1146422093 17:32696965-32696987 TTGGAAACACATTAACAGGGAGG - Intronic
1146572920 17:33968362-33968384 CTCAGAACACAGTTGCAGGCGGG - Intronic
1147261987 17:39214159-39214181 CTTGAAACACAGTGTGAGGGGGG - Intronic
1148743134 17:49904006-49904028 CTGGAAACTCAGCTTCAGGGTGG - Intergenic
1149251252 17:54772185-54772207 CTGGAAATGTAGTTGCAGGTCGG + Intergenic
1149462905 17:56847683-56847705 CTGGAAACTGAGGTGCAGGAAGG - Intronic
1151280337 17:73069224-73069246 CTGGAAACTCAGTGACAGGGAGG - Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1153515812 18:5900061-5900083 CTGGAAAAAACTTTGCAGGGAGG + Intergenic
1154024635 18:10696018-10696040 CAGGAAACACAGTTGCATGGAGG + Intronic
1154983405 18:21523533-21523555 CTGGAAACACATTTAAAGAGTGG - Exonic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157418803 18:47527591-47527613 CTGGAGACACTTTTGCAGAGAGG + Intergenic
1157502680 18:48202428-48202450 CAGGAGGCACAGTCGCAGGGCGG + Intronic
1157550824 18:48580784-48580806 GTGGAAACCAAGCTGCAGGGCGG - Intronic
1157693160 18:49700174-49700196 ATGGAAACTGAGATGCAGGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159865800 18:73703199-73703221 CTGGAAAGACAGGTGCATTGAGG - Intergenic
1160910062 19:1470112-1470134 CTGGGCACATAGTTGAAGGGGGG - Exonic
1161642859 19:5435301-5435323 CTGGACCCACAGTGGCAGGAGGG - Intergenic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1165140793 19:33698844-33698866 GTGGAAACGCAGGTGCAGAGGGG - Intronic
1166037655 19:40180808-40180830 CTGTAATCCCAGTTACAGGGAGG - Intergenic
1166810486 19:45511423-45511445 CTGGAAACTGAGTTTCAGAGAGG + Intronic
925256670 2:2495534-2495556 CTGCAAGCACAGCTGCCGGGTGG + Intergenic
926889438 2:17626565-17626587 CTGCAGACACAGGGGCAGGGTGG - Intronic
928100858 2:28436743-28436765 CTGGAATCACAGGAGCAGGAAGG + Intergenic
928925787 2:36577687-36577709 CTGGAAATACAGTTCTAGGATGG - Intronic
933716557 2:85365738-85365760 CAGGAACCACAGTGGCAAGGGGG - Intronic
934613996 2:95760306-95760328 ATGGAAATGCAGCTGCAGGGAGG - Intergenic
934928261 2:98397163-98397185 CTGGAAAGCCAGGTGAAGGGTGG + Exonic
940756925 2:157693998-157694020 ATGGAGTCACATTTGCAGGGTGG + Intergenic
942280484 2:174358359-174358381 CTGTAATCACAGCTGCTGGGAGG - Intronic
942363455 2:175197181-175197203 CTGGAAATACATTTCCAGGTTGG + Intergenic
946306089 2:218857850-218857872 CTGCAATAACAGTAGCAGGGTGG + Intergenic
946484101 2:220084514-220084536 CTGGAAACACAAATCCAGGCTGG + Intergenic
946605068 2:221394963-221394985 CTCCACACACAGATGCAGGGAGG - Intergenic
947098254 2:226591431-226591453 CTGGAAGCTCAGTCCCAGGGAGG + Intergenic
947615950 2:231557123-231557145 CTCCAAACCCAGTTGCTGGGTGG + Intergenic
948029408 2:234804797-234804819 CAGGAAACAGAGGTGCAGGAGGG + Intergenic
948657615 2:239486483-239486505 CTGGACCCACAGGTGCAGAGTGG - Intergenic
948936652 2:241169585-241169607 ATGGAAACACTGTCCCAGGGAGG + Intronic
1168835266 20:873405-873427 CTGGAAAGACAGGTTCAGTGAGG - Intronic
1170943203 20:20866315-20866337 CTGGGAAAACACTTGGAGGGAGG - Intergenic
1171087074 20:22247345-22247367 CTGGAGCCACAGTAGCAGGTGGG + Intergenic
1172402523 20:34662070-34662092 TTGGAAAAACAGTTGGCGGGGGG - Intronic
1172431131 20:34892799-34892821 CAGGGAACACAGTAACAGGGTGG - Intronic
1172965240 20:38829737-38829759 CTGCAAACACAGCAGCGGGGTGG - Intronic
1174708666 20:52682838-52682860 CTGAAAAAGCAGTTGCAGGTGGG + Intergenic
1174925159 20:54751049-54751071 CTGGAAACAGACTTTGAGGGAGG - Intergenic
1175663131 20:60834832-60834854 GAGGAAAAACAGTTGCAGGAGGG - Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180288852 22:10778449-10778471 CTGAAAACATTGTTGCAGGATGG - Intergenic
1180918989 22:19508818-19508840 CTGGAATCACAGTGCCAGTGTGG + Intronic
1181041929 22:20196410-20196432 CTGGAGACGCAGGTGCAGGTGGG - Intergenic
1181431471 22:22884343-22884365 GTGGAAACACAGTCTCAGAGAGG - Intronic
1181713468 22:24706673-24706695 ATGGAAACAGAGTAGAAGGGTGG - Intergenic
1182398428 22:30054881-30054903 CTGGACAAACAGATGCAGTGTGG + Intergenic
1183525182 22:38318420-38318442 CCGGAAGCACAGTTCCTGGGAGG + Intronic
1184467167 22:44675605-44675627 CAGGAAACTGAGATGCAGGGAGG - Intronic
1184500766 22:44870272-44870294 CAGGAAACAGAGATGCATGGCGG + Intergenic
1184526780 22:45028727-45028749 CTGGGAACACAGTTCCAAGGGGG - Intergenic
1184821957 22:46916082-46916104 CTGGAAACAAAGTGTCAGAGGGG - Intronic
950548394 3:13652569-13652591 CTGGAGCCAGAGTTGAAGGGAGG + Intergenic
951944020 3:28114054-28114076 CTGAAAACACAGGTTCAGAGAGG - Intergenic
951966785 3:28395711-28395733 ATGGAAACAAAGTAGAAGGGTGG + Intronic
952616439 3:35278708-35278730 CTGGAAGCTCTGTTCCAGGGCGG - Intergenic
952661520 3:35855715-35855737 CTGGATACTCAGTAGCAGAGAGG - Intergenic
953678261 3:45020195-45020217 CTGGATACACAGTTGTAGATAGG - Intronic
953874678 3:46659895-46659917 CTGGGAAATGAGTTGCAGGGAGG - Intergenic
955029568 3:55203316-55203338 GTGGAAACAGAGGGGCAGGGTGG + Intergenic
961181612 3:124882423-124882445 CTAGAAAAAGGGTTGCAGGGTGG + Intronic
961196232 3:125003743-125003765 CTGGACACACTGTTGCCAGGAGG + Intronic
962347395 3:134628205-134628227 ATGGAAACAAAGATGCAGGAAGG + Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965793060 3:172410745-172410767 CTGGAAAACCAGCTGCAGAGAGG - Intergenic
966058827 3:175731024-175731046 CAGGAAACACAGTAGTAGAGTGG + Intronic
966151964 3:176875364-176875386 CTGGAAGCCCAGTTACAGGGAGG + Intergenic
966879494 3:184342000-184342022 CAGGGAGCACAGGTGCAGGGAGG - Intronic
967766866 3:193290604-193290626 CTGGATACACAGGTGAATGGGGG + Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
968810770 4:2798806-2798828 CTAGGAACACAGGTGCTGGGTGG + Intronic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
969109925 4:4838272-4838294 CTGGAGACACAGTTGTGAGGGGG - Intergenic
970157922 4:13160041-13160063 TTGGAAACACTGTTTCAGGCCGG - Intergenic
971133103 4:23835413-23835435 CTGGAAACACAATGAGAGGGAGG + Intronic
971139330 4:23906639-23906661 ATGGAAACACAGTTGTAGCATGG - Intergenic
971507642 4:27383802-27383824 ATGGAAACACAGTGGAATGGTGG + Intergenic
974083905 4:57239455-57239477 ATGTAACCACAGCTGCAGGGGGG - Intergenic
974100340 4:57409551-57409573 CTGGTACCACAGTGGCAGGGAGG - Intergenic
974771045 4:66414064-66414086 CAGGAAACACAGATGCTGGAGGG + Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
980694287 4:136336400-136336422 CTGGAGACCCCATTGCAGGGAGG - Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985963800 5:3324626-3324648 CTGGGATCACAGTAGGAGGGAGG - Intergenic
989454296 5:41624544-41624566 CTGGAAACTTAGTTGCACAGTGG + Intergenic
990510215 5:56482557-56482579 CTGGAAACACTGTAGCAAAGAGG - Intergenic
992137113 5:73758050-73758072 CTGGGAACACAAGTGGAGGGAGG - Intronic
992733535 5:79696171-79696193 CTGGAAAGACAGTAGCTTGGAGG + Intronic
994828075 5:104742415-104742437 CTGGAAAAACAGTAGCAAAGAGG - Intergenic
995597443 5:113763170-113763192 CTGGACATGCAGTTGCAGGCTGG + Intergenic
997522577 5:134532693-134532715 CTGCAAACACACTTGGGGGGTGG - Intronic
1000019197 5:157304109-157304131 CAGGAATCACAGCTCCAGGGAGG - Intronic
1000208568 5:159087778-159087800 CTGGAAGCATAGTGGCAGTGTGG - Intronic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1003482763 6:6547962-6547984 CTGAAAACTGAGTTGCAGTGAGG - Intergenic
1005626448 6:27666947-27666969 CGGGAAACACAATTGAAGGTGGG + Intergenic
1005645625 6:27835136-27835158 CTTGAAAAACAGTTTGAGGGAGG - Intergenic
1006612912 6:35305693-35305715 CTGTAATCCCAGTTACAGGGAGG - Intronic
1006613546 6:35310145-35310167 CTGGAAACACAGTGACAGATTGG - Intronic
1006920909 6:37626441-37626463 CCAGGAACACAGATGCAGGGAGG - Intergenic
1008267721 6:49451433-49451455 CTGAAAACAAAGTTGCAAAGTGG + Intronic
1009606359 6:65873838-65873860 CTGAAAACACCATTGCAGTGGGG - Intergenic
1010737032 6:79454783-79454805 CTGTAATCCCAGTTACAGGGAGG - Intergenic
1012511496 6:100007557-100007579 GTGGAAACCCAGGTGCAGAGCGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013804478 6:113982267-113982289 CTGGACACAGAGTGGGAGGGTGG - Intronic
1021870776 7:25004117-25004139 CTGGGAACTCAGATGTAGGGAGG - Intergenic
1022550816 7:31237448-31237470 CTGAGGAAACAGTTGCAGGGAGG - Intergenic
1024165082 7:46722851-46722873 CTGGAAACTCTGTCTCAGGGAGG - Intronic
1025306435 7:57863818-57863840 CTGGAAACATAGTAGAAGTGAGG + Intergenic
1025318921 7:58069675-58069697 CTGGAAACATAGTAGAAGTGAGG - Intergenic
1028991271 7:97051275-97051297 GTGGAAACAAAGCCGCAGGGAGG + Intergenic
1029300697 7:99580357-99580379 CTGGAAACGCAGTTGGCGGCGGG + Intronic
1031743999 7:125470029-125470051 CTGGACACACAGTTCAAGGTTGG + Intergenic
1034615312 7:152411307-152411329 CTGAAAACATTGTTGCAGGATGG - Intronic
1035349596 7:158236738-158236760 CTGGTAACAGAGTGGCTGGGTGG - Intronic
1035727599 8:1834409-1834431 CTGGAGACACAGGCCCAGGGAGG + Intronic
1036793703 8:11740495-11740517 CTGCAAACACAGCAGCTGGGAGG + Intronic
1040296318 8:46150928-46150950 GTGAAAACAGAGTGGCAGGGTGG - Intergenic
1041727447 8:61031307-61031329 CAGGAAACCCACCTGCAGGGTGG + Intergenic
1042114269 8:65414248-65414270 CTAGAAACATATTTGCAGGTAGG + Intergenic
1044817856 8:96131324-96131346 TTGGAGACAGAGATGCAGGGAGG - Intergenic
1045544242 8:103113889-103113911 CAGCAAACACAGTAGAAGGGAGG + Intergenic
1045548672 8:103150964-103150986 CTCCAAACAAAGTAGCAGGGAGG - Intronic
1047052299 8:121126335-121126357 CTGGAAATCCAGTAGCAGAGTGG + Intergenic
1047053889 8:121143191-121143213 TTGGTAACCAAGTTGCAGGGTGG + Intergenic
1047204297 8:122791049-122791071 CTGGAGCCACAGGTGCATGGAGG - Intronic
1048421012 8:134278300-134278322 ATGGAAACAGAAGTGCAGGGTGG + Intergenic
1051012117 9:12429927-12429949 CCGGAACCACAGTTCCAGGGTGG + Intergenic
1051638457 9:19202755-19202777 TTGGACAGACAGATGCAGGGGGG - Intergenic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054144802 9:61554395-61554417 CTGGACACGCAGGTGCAGAGAGG + Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1055373772 9:75626728-75626750 AGGGAAATACAGTTTCAGGGAGG + Intergenic
1056790487 9:89622302-89622324 CTGCAGGCACAGTTGCATGGTGG - Intergenic
1058430213 9:104911760-104911782 ATAGGAACACAGTTTCAGGGGGG - Intronic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059627629 9:116084416-116084438 CTTAAAACACAGTTGTTGGGTGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060660023 9:125399856-125399878 TAGGAAACTCAGTTGCTGGGCGG - Intergenic
1061032141 9:128091776-128091798 CTGGCTACACAGCTGCTGGGAGG - Intronic
1061626833 9:131845482-131845504 CGGGGAACACAGTGGCAGGGAGG + Intergenic
1062568292 9:137172925-137172947 CTGGAATAGCAGGTGCAGGGAGG - Intergenic
1188753567 X:33933072-33933094 CTGGCAACACTGTTGCACAGGGG + Intergenic
1188795683 X:34461581-34461603 ATAGAAACACAGTTGAATGGTGG - Intergenic
1189472803 X:41327377-41327399 GTGGAAGCACAGGTGCCGGGAGG + Intergenic
1189865920 X:45326942-45326964 TTGGAAGAACAGTGGCAGGGTGG + Intergenic
1192254335 X:69443018-69443040 CTGGAAAGGCAGTGGCAGAGAGG + Intergenic
1193295738 X:79829586-79829608 CTGCAGAGGCAGTTGCAGGGAGG + Intergenic
1193508671 X:82372862-82372884 CTGCAATCACAGGTGGAGGGAGG + Intergenic
1196136267 X:112212694-112212716 ATGCAAACACATTGGCAGGGTGG + Intergenic
1197402193 X:126006041-126006063 CTGGAAGCTCAGTCTCAGGGAGG - Intergenic
1199686674 X:150271344-150271366 CAGGAAACTGATTTGCAGGGAGG - Intergenic
1199688893 X:150291132-150291154 CTGCAAGCACAGTTGCTGGCTGG - Intergenic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic