ID: 1116913674

View in Genome Browser
Species Human (GRCh38)
Location 14:50499360-50499382
Sequence TAGAAGCAGTATTGGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116913674 Original CRISPR TAGAAGCAGTATTGGGGGCC AGG Intronic
901517613 1:9759575-9759597 TAGAAACTGTATTTGAGGCCAGG - Intronic
902397846 1:16142195-16142217 TAGATGCCCTAATGGGGGCCGGG - Intronic
903179190 1:21597007-21597029 TGGAAGCAGGACTGGGGGTCTGG - Exonic
903487818 1:23704542-23704564 TAGAATCAGCATTAGGGGCCGGG - Intergenic
904284372 1:29444484-29444506 TAGAGGCAGGACTAGGGGCCTGG + Intergenic
904476856 1:30770562-30770584 TAGAAGCTTTAAGGGGGGCCCGG - Intergenic
904705233 1:32385281-32385303 TAAAAACAGTATTGGGGGAGGGG + Intronic
905490898 1:38343012-38343034 TAGAAAAGGTATTGAGGGCCAGG + Intergenic
910562918 1:88611979-88612001 TAGAAGGAGTCTTGGAGGCTGGG - Intergenic
910884979 1:91954658-91954680 TAGAAGCAATAGTGGAGGCTGGG + Intronic
911040586 1:93588148-93588170 CAGCAGCAGTTTTGGGGTCCAGG - Intronic
913045490 1:115070465-115070487 TAGAAGAATGATTTGGGGCCGGG - Intronic
913224572 1:116687513-116687535 TAGAGGCAGTATTTGGGACAGGG - Intergenic
913267611 1:117060296-117060318 CGGAAGCAGAATTGGGGGCGGGG + Exonic
914070330 1:144281060-144281082 AAGAAGCAGAATGGGAGGCCGGG + Intergenic
914108825 1:144685294-144685316 AAGAAGCAGAATGGGAGGCCGGG - Intergenic
915316426 1:155031419-155031441 TAGGACCAGTATTGGGGGTGGGG - Intronic
916974863 1:170065316-170065338 TAAAAGAAATATTGGTGGCCGGG + Intronic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
917568639 1:176238620-176238642 TAGAAGGATTATTTGAGGCCAGG - Intergenic
921348042 1:214207318-214207340 AAGAAGCAGAGTTGGGGTCCAGG + Intergenic
921997463 1:221436714-221436736 TAGAAACAGGATGGGAGGCCAGG - Intergenic
922201771 1:223409065-223409087 ATGAATCAGTATTTGGGGCCAGG - Intergenic
1063439499 10:6061135-6061157 TACCAGCAGTATGGGAGGCCAGG + Intronic
1063536598 10:6890319-6890341 TAGAAACAGTATTGGGGCACTGG + Intergenic
1063681477 10:8191948-8191970 TAGAAGGATTGTTTGGGGCCAGG + Intergenic
1064065993 10:12181945-12181967 TAGAGGCAGTGTTGTTGGCCAGG - Intronic
1064337755 10:14458975-14458997 TGGAAGCAGTACTGAGGTCCTGG + Intronic
1064407918 10:15080944-15080966 GAGAAGAAGTATGGGGGGCAGGG - Intronic
1065360796 10:24887263-24887285 TAGAAGGAGTATTAACGGCCGGG - Intronic
1065738646 10:28776656-28776678 TAGCAGCACTTTTGGAGGCCAGG + Intergenic
1066192957 10:33072585-33072607 TGGAAGCAGTTGTGGGGGACAGG - Intergenic
1066746670 10:38608239-38608261 TAAAAGAAGTATTAGTGGCCAGG + Intergenic
1068363597 10:56013214-56013236 TAGAAGCTGCATTGGGATCCAGG - Intergenic
1069018091 10:63454016-63454038 TACAAACAGAATTGGAGGCCGGG - Intronic
1069069978 10:63983164-63983186 AAGAAGTTGTATTGTGGGCCGGG + Intergenic
1070520791 10:77251394-77251416 CTGAAGCAGTAATGGGGGGCTGG - Intronic
1072162309 10:92780025-92780047 TAGAAGAATCATTTGGGGCCAGG + Intergenic
1073786644 10:106897323-106897345 CATAAACAGTTTTGGGGGCCAGG - Intronic
1075108089 10:119555928-119555950 AAGAATCAGCATTTGGGGCCAGG + Intergenic
1078157781 11:8813642-8813664 TTTAAGCAGTATGAGGGGCCAGG + Intronic
1078265166 11:9750040-9750062 AAGAAACAGCTTTGGGGGCCGGG + Exonic
1079542011 11:21587843-21587865 TAGCAGCATTATTGGGGGTGGGG + Intergenic
1082953513 11:58844071-58844093 TAGAAGCAGGATTGGAGGCAAGG + Intronic
1082969913 11:59009327-59009349 TAGAAGCAGGATTGGAGGCAAGG + Intronic
1083485969 11:62983337-62983359 TAAAAACAGGATTGCGGGCCAGG - Intronic
1083735689 11:64679340-64679362 AAGAATCAGGATTGAGGGCCAGG + Intronic
1083956403 11:65985861-65985883 TAGAAGCAGTATAGAAGGCTGGG + Intergenic
1084563100 11:69915007-69915029 GAGAAGCAGTCTCGGGGGCAGGG - Intergenic
1086102174 11:83112487-83112509 TATAAACAGCATTGGTGGCCAGG + Intergenic
1089181831 11:116588545-116588567 TAGAAGTAGAAATGGGGGCTGGG + Intergenic
1089838211 11:121390746-121390768 TAAAAGAAGTACTGGAGGCCAGG + Intergenic
1090670902 11:128944568-128944590 AAAAAGGAGTGTTGGGGGCCAGG - Intergenic
1092155515 12:6279328-6279350 TAGAAGCAGAAGTGGGCGCGGGG - Intergenic
1097352553 12:58564368-58564390 TAGAAGCAGTCTAGCAGGCCAGG + Intronic
1098940391 12:76528025-76528047 TATAAGCATTATTGTTGGCCAGG + Intronic
1100702647 12:97164429-97164451 TAGAACAAGTTTTGTGGGCCTGG + Intergenic
1102699982 12:114830631-114830653 TACAAGAAGTATTTGAGGCCAGG - Intergenic
1103643234 12:122369865-122369887 TAGAAACAGCAAAGGGGGCCAGG + Intronic
1105548361 13:21368575-21368597 TAGAAGCAATGTTTGGGGCTGGG + Intergenic
1106958248 13:34967930-34967952 TGGAAGCAGTCTTGTGGGACTGG - Intronic
1107804302 13:44140100-44140122 TAGAAGGAGCCATGGGGGCCTGG - Intergenic
1108065908 13:46577391-46577413 TAAAAGAAGAACTGGGGGCCAGG - Intronic
1110244715 13:73309884-73309906 GAGAGGCAGTATTTTGGGCCGGG + Intergenic
1111870018 13:93819550-93819572 TGGAAGCAGATTTGCGGGCCAGG + Intronic
1113494702 13:110717529-110717551 TACAAGTAGTATTGTTGGCCAGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114654893 14:24310224-24310246 AGCAAGCAGGATTGGGGGCCTGG - Exonic
1114666162 14:24378231-24378253 TGGGACCAGGATTGGGGGCCAGG + Exonic
1115429600 14:33300917-33300939 TAGAAATAGGATTGAGGGCCAGG + Intronic
1116913674 14:50499360-50499382 TAGAAGCAGTATTGGGGGCCAGG + Intronic
1116966925 14:51024727-51024749 GAGAAGCATTATTGTGGGTCAGG + Intronic
1119002006 14:70890744-70890766 GAAAAGCAGAATTGGGGCCCTGG + Intergenic
1122562883 14:102629444-102629466 TAGAAGCAGTGGTGGGGGGGGGG - Intronic
1123147446 14:106146726-106146748 TAGAAGCAGGGTTGGGAACCAGG - Intergenic
1123995436 15:25714852-25714874 TAGAAGGATTATTTGGGGACTGG - Intronic
1124648931 15:31460729-31460751 TAGAAACACTAGTTGGGGCCAGG - Intergenic
1125530489 15:40410128-40410150 AAGAAGCAGGACTGGAGGCCAGG - Intronic
1126456191 15:48864740-48864762 TAAAAGTGGTATTGGAGGCCGGG - Intronic
1129011650 15:72423805-72423827 AAAAAGGAGTATTTGGGGCCAGG - Intergenic
1129323844 15:74789305-74789327 CAGCAGCAGAATTGGGCGCCAGG - Intronic
1130506064 15:84543424-84543446 TAGAAGCATTGTTTGGGCCCGGG + Intergenic
1130974973 15:88767151-88767173 TATCAGAAGTATTGTGGGCCGGG - Intergenic
1131183029 15:90253436-90253458 GAGTAGCAGTCTTGGGTGCCTGG - Intronic
1131635259 15:94226542-94226564 TAGAGGCAGTAATGGGAGACTGG + Intergenic
1132129551 15:99263012-99263034 AAGAAGTAGTTGTGGGGGCCGGG + Intronic
1132404875 15:101536161-101536183 CAGAAGCAGGATCTGGGGCCAGG + Intergenic
1132871908 16:2119053-2119075 CAGAAGGGATATTGGGGGCCTGG + Intronic
1133015502 16:2937718-2937740 TAGAAGCAGTGTGGGTGGCGTGG - Intronic
1134018211 16:10903926-10903948 TAGAAGCAGGATCGAGGCCCTGG + Intronic
1134144047 16:11745756-11745778 TAGAAAAAGTATAGTGGGCCGGG - Intergenic
1135031910 16:19045264-19045286 TAGAAGGTGTCTTGGGAGCCTGG + Intronic
1136192166 16:28623079-28623101 TGGGACCAGTATTGGGGGACTGG - Intronic
1136225172 16:28855514-28855536 TAGAAACAATCATGGGGGCCGGG - Intronic
1136360203 16:29774499-29774521 CAGAAGCAGAGATGGGGGCCTGG + Intergenic
1136691296 16:32032716-32032738 TAGAAGCAGGGTTGGGAACCAGG + Intergenic
1136736392 16:32471394-32471416 TAAAAGAAGTATTAGTGGCCAGG - Intergenic
1136791884 16:32976281-32976303 TAGAAGCAGGGTTGGGAACCAGG + Intergenic
1136877933 16:33877627-33877649 TAGAAGCAGGGTTGGGAACCAGG - Intergenic
1138677309 16:58660946-58660968 TAAAAACAAAATTGGGGGCCGGG - Intergenic
1138728825 16:59172113-59172135 TGGAATCTGTATTGGGGCCCAGG - Intergenic
1140130456 16:72156321-72156343 AAGAATCAGTATTGGAGGCCGGG + Intronic
1140245131 16:73241493-73241515 TAAAAGGAGGGTTGGGGGCCGGG + Intergenic
1140948316 16:79791978-79792000 TAGATGCAGAAATGGAGGCCTGG - Intergenic
1141082164 16:81061916-81061938 TGGAAGCAGTGCTGGGGCCCTGG + Exonic
1141997860 16:87646698-87646720 AAGAAGCAGTTTTGGGGGCTGGG + Intronic
1203016678 16_KI270728v1_random:358184-358206 TAAAAGAAGTATTAGTGGCCAGG + Intergenic
1203035013 16_KI270728v1_random:631342-631364 TAAAAGAAGTATTAGTGGCCAGG + Intergenic
1203094095 16_KI270728v1_random:1237745-1237767 TAGAAGCAGGGTTGGGAACCAGG + Intergenic
1143038520 17:4015467-4015489 TAAAAGCGCTAATGGGGGCCAGG + Intronic
1143384952 17:6523642-6523664 TACAAGCACTATTGTGGGGCAGG + Intronic
1144644764 17:16964634-16964656 TAGAACCAGCATGGGAGGCCGGG - Intronic
1144875978 17:18397486-18397508 GAGAAGCAGTCTGGGTGGCCAGG + Intergenic
1145156250 17:20546934-20546956 GAGAAGCAGTCTGGGTGGCCAGG - Intergenic
1145413273 17:22692647-22692669 GTGAAGCAGTCTTGGGCGCCGGG - Intergenic
1146160665 17:30557794-30557816 GAGAAGCAGTCTGGGTGGCCAGG + Exonic
1146843724 17:36171021-36171043 GAGAAGCAGTCTGGGTGGCCAGG - Intronic
1146856031 17:36258955-36258977 GAGAAGCAGTCTGGGTGGCCAGG - Intronic
1146864589 17:36329420-36329442 GAGAAGCAGTCTGGGTGGCCAGG + Intronic
1146871937 17:36382866-36382888 GAGAAGCAGTCTGGGTGGCCAGG - Intronic
1146879299 17:36433951-36433973 GAGAAGCAGTCTGGGTGGCCAGG - Intronic
1146883229 17:36455096-36455118 GAGAAGCAGTCTGGGTGGCCAGG - Intergenic
1147067448 17:37930008-37930030 GAGAAGCAGTCTGGGTGGCCAGG + Intronic
1147074824 17:37983490-37983512 GAGAAGCAGTCTGGGTGGCCAGG - Intronic
1147078979 17:38009569-38009591 GAGAAGCAGTCTGGGTGGCCAGG + Intronic
1147086347 17:38063036-38063058 GAGAAGCAGTCTGGGTGGCCAGG - Intronic
1147094916 17:38133504-38133526 GAGAAGCAGTCTGGGTGGCCAGG + Intergenic
1147621739 17:41872622-41872644 TACAAACAGTATTTGGGGCCGGG - Intronic
1148702839 17:49600774-49600796 CATAGGCAGTGTTGGGGGCCTGG - Intronic
1149571807 17:57677453-57677475 TGGAAGCAGGGATGGGGGCCAGG + Intronic
1149846881 17:60013506-60013528 GAGAAGCAGTCTGGGTGGCCAGG - Intergenic
1150575756 17:66429709-66429731 TACAGGCAGGATTGGGGGCAGGG - Intronic
1151994929 17:77602499-77602521 AAGAAGGAATAGTGGGGGCCGGG + Intergenic
1152560175 17:81074193-81074215 CAGCTGCAGTATTGGGGGCAGGG + Intronic
1155197443 18:23488261-23488283 TAGAGGCAGTCCTGGGGCCCTGG - Intergenic
1156794756 18:41030642-41030664 GAGAAGAAATATTTGGGGCCTGG - Intergenic
1159016829 18:63107815-63107837 TAGAAGCACTCCTGGGAGCCAGG - Intergenic
1162784521 19:13025936-13025958 CAGAAGAAGTATTGAGGGGCAGG + Intronic
1165374704 19:35433545-35433567 TAGAAAGTGTAATGGGGGCCAGG - Intergenic
1165654119 19:37518421-37518443 TAGAAATAGTAGTGGAGGCCAGG - Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166850072 19:45755739-45755761 CAGAAGCTGTAATGGGGGCTGGG - Intronic
1167901729 19:52627364-52627386 AAGAAAAACTATTGGGGGCCAGG + Intronic
1168270958 19:55249535-55249557 TAGAAGGAATATTGGGAGTCTGG - Intronic
927828081 2:26323599-26323621 AAGAAGAAGTAATGGAGGCCAGG - Intronic
928116553 2:28549179-28549201 CAGAGGCAGCATTTGGGGCCAGG - Intronic
930840620 2:55841234-55841256 AAGAAGCCTTATTGGGGACCTGG - Intergenic
933663515 2:84946274-84946296 TATAAGAAGTAATGTGGGCCTGG - Intergenic
933979052 2:87535844-87535866 CAGAAGTAAGATTGGGGGCCAGG + Intergenic
934309076 2:91847427-91847449 TAAAAGAAGTATTAGCGGCCAGG + Intergenic
936314775 2:111414948-111414970 CAGAAGTAAGATTGGGGGCCAGG - Intergenic
936994399 2:118398307-118398329 TAGAAGTAGTTTTGTGGGCCAGG + Intergenic
940108013 2:150119906-150119928 CAGAACCAGGATTGGGGACCAGG - Intergenic
943631159 2:190253952-190253974 AAGAAGCAGAATTGGGGGAAGGG - Intronic
944559195 2:200918202-200918224 TAGAAGCAGCATTGGCAGCCAGG - Intronic
944592137 2:201227852-201227874 TAGAAACCGGTTTGGGGGCCGGG - Intronic
944908392 2:204285427-204285449 AGGAAGCAGAAGTGGGGGCCTGG + Intergenic
945326797 2:208491674-208491696 TAAAAGCAGACTTGGGGGGCGGG - Intronic
946381263 2:219350622-219350644 TGGAGGCAGAATTGGTGGCCGGG - Intergenic
946594872 2:221295353-221295375 TAAAAACAGCATTGGAGGCCTGG - Intergenic
947790261 2:232862356-232862378 TAGAAGTAGTATTTGTCGCCGGG - Intronic
948230608 2:236346463-236346485 CAGAAGCAGGACTGGAGGCCAGG + Intronic
948863115 2:240762538-240762560 TGGAAGCAGCATTGGGGGAGGGG - Intronic
1168777306 20:458607-458629 TAAAAGTAGAATTGGAGGCCAGG - Intronic
1172078433 20:32317934-32317956 TAAAAACAGTATTGTGGGCTGGG - Intronic
1173234792 20:41234823-41234845 TAGAAGCAGCATGCAGGGCCAGG + Intronic
1173263013 20:41453151-41453173 GACAAGCAGCACTGGGGGCCAGG - Intronic
1174207615 20:48852186-48852208 TAGAACCATTTTTGGGGTCCTGG - Intergenic
1174602623 20:51737109-51737131 TAGAAGCAGGAATGGAGCCCAGG + Intronic
1175243093 20:57564128-57564150 GAGAAGCAGTAGTGAGTGCCAGG - Intronic
1177484993 21:21745799-21745821 AAAAAGCAGTTTTGTGGGCCGGG + Intergenic
1179443920 21:41418393-41418415 TACAAGAAGTATTTGGGGCTGGG - Intergenic
1179526153 21:41977198-41977220 TGGAGGCAGTATAGGGGTCCTGG - Intergenic
1181590861 22:23884064-23884086 TAGAAGGAGTGATGGGTGCCTGG + Intronic
1181791479 22:25270623-25270645 TAGATGAAGTCATGGGGGCCAGG - Intergenic
1181827170 22:25526734-25526756 TAGATGAAGTCATGGGGGCCAGG - Intergenic
1184093645 22:42305196-42305218 TACCAGCAGCCTTGGGGGCCAGG - Intronic
1184363512 22:44033335-44033357 TCAAAAAAGTATTGGGGGCCGGG - Intronic
949277574 3:2303336-2303358 TGGAAGCAATTTTGGGGGGCAGG - Intronic
950535450 3:13575679-13575701 AAGAGGCAGGACTGGGGGCCAGG + Intronic
952211073 3:31229958-31229980 TAGAAAGAGTACTGGGGGCATGG + Intergenic
952382314 3:32815325-32815347 ATGAAGCCGTCTTGGGGGCCAGG - Intergenic
953971558 3:47352424-47352446 TAGAAGCTGGATTATGGGCCGGG + Intergenic
954039112 3:47870884-47870906 GAGCAGAAGTATTGGTGGCCAGG + Exonic
956627257 3:71278894-71278916 TAGAAACAGGAATTGGGGCCGGG + Intronic
957327231 3:78711782-78711804 TAGAAACAGCACAGGGGGCCGGG - Intronic
964950453 3:162285324-162285346 TAAAAGCAGTCTTGAGGGACTGG - Intergenic
964983885 3:162716478-162716500 GAGATGCAGTCATGGGGGCCAGG - Intergenic
965067095 3:163864143-163864165 TAGGAGCAGGATGGGGGGCCTGG - Intergenic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
970335522 4:15036691-15036713 GAGCAGAAGTATTGGTGGCCAGG + Intronic
970819876 4:20199086-20199108 TAGGAGCAATTTTGGGGGGCAGG - Intergenic
971340814 4:25766994-25767016 CAGAAGAAATGTTGGGGGCCAGG + Intronic
971502201 4:27329528-27329550 TTGAAGCAGTTTTTGGAGCCTGG - Intergenic
972365668 4:38372085-38372107 CAGAAGCAGTGCTGGGGGACTGG - Intergenic
972449272 4:39180711-39180733 AAAAAGAAGTATTGGTGGCCAGG - Intergenic
972652539 4:41032488-41032510 TACATTCAGTATTGGGGGCGGGG + Intronic
973608562 4:52611589-52611611 TAGAAGTACAAATGGGGGCCAGG + Intronic
974487925 4:62527476-62527498 TTGCAGCAGTATTGGGGGGAGGG - Intergenic
974885103 4:67809082-67809104 TAAAAGTACTATTGGGGGGCGGG + Intergenic
975137937 4:70892651-70892673 TAGAAACAGCGTTGTGGGCCGGG + Intergenic
975859256 4:78658675-78658697 TAGAAGTAGATTTGTGGGCCAGG - Intergenic
976834656 4:89357561-89357583 GAGAAGCAGGATTGGGCTCCAGG - Intergenic
977521311 4:98087853-98087875 TAAAAGAATTATTGGAGGCCGGG - Intronic
977631921 4:99252546-99252568 CAGAAGCAGTGTAAGGGGCCAGG - Intergenic
977717579 4:100199290-100199312 TAAAAGCTGTATTTGGGGACAGG - Intergenic
978471905 4:109077437-109077459 TAGCAGGAGTGTTGGGGGCGGGG - Intronic
980411253 4:132422803-132422825 TAAAATCCTTATTGGGGGCCAGG + Intergenic
980893447 4:138838548-138838570 CAGGAGCAGTCTTGGGGGACTGG - Intergenic
981176900 4:141692239-141692261 TAAAAACAGTTTTGTGGGCCAGG - Intronic
982853470 4:160349364-160349386 TAAAAGCCGTTTGGGGGGCCAGG - Intergenic
982973703 4:162024399-162024421 TAGAAACAGTGTTAGGTGCCAGG - Intronic
983232549 4:165143729-165143751 AAAAAACAGTATTGGTGGCCGGG - Intronic
984253853 4:177366692-177366714 TTGAAAAAGTATTGGAGGCCTGG - Intergenic
985014388 4:185618268-185618290 TTAATGAAGTATTGGGGGCCAGG - Intronic
985077144 4:186226864-186226886 TAGATAGAGTCTTGGGGGCCAGG + Intronic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
988478277 5:31607412-31607434 TAGAAGCAGTAATGCTGGCTGGG + Intergenic
989191141 5:38670911-38670933 TAGGTGCAGTATGGTGGGCCTGG + Intergenic
989392144 5:40912041-40912063 TTGAAGAAGTATGTGGGGCCGGG - Intronic
989613064 5:43313540-43313562 TAGAAGCCGGACTGGGGGGCGGG - Intergenic
993704897 5:91158683-91158705 TAGAAGCAGGAAGGGTGGCCAGG + Intronic
994082786 5:95726861-95726883 TACAAGGAGTGTTGGGGGCATGG - Intronic
997768068 5:136525003-136525025 GAGAAGCAGAATTGGGATCCAGG - Intergenic
999313930 5:150571870-150571892 TAGAAGTATTACTGGGGGACAGG - Intergenic
999711240 5:154320477-154320499 TTGAAGCAGGGTTGGGGGCGGGG - Intronic
1000088714 5:157911467-157911489 TAGAAGGAGCAGTGGTGGCCGGG + Intergenic
1002329726 5:178433159-178433181 TGGGAGCAGTCTTGGGGGACTGG - Intronic
1003973294 6:11320000-11320022 TAGAAGCAGCAATGGGTGACAGG + Intronic
1004481488 6:16023629-16023651 TAGAAAAAGTCATGGGGGCCGGG - Intergenic
1006412678 6:33884356-33884378 GAGAAGCAGTTTTTGGGGACTGG + Intergenic
1006564116 6:34939550-34939572 AATAAGAAGTATTTGGGGCCAGG + Intronic
1009530899 6:64813850-64813872 TAGCACCATTATTGGGGGCAGGG - Intronic
1012299596 6:97569404-97569426 TAGAAGGTGTTTTGGGAGCCGGG - Intergenic
1013511849 6:110851755-110851777 TAGAACCAATTTTGAGGGCCAGG - Intronic
1014188801 6:118467571-118467593 TAGAAGGAGTATTGGGAGGTGGG + Intronic
1014881952 6:126734460-126734482 TAGAAAAAGTATTGGTAGCCAGG + Intergenic
1015137655 6:129891686-129891708 TAGAAGCAGGATTGAGGAACAGG - Intergenic
1015909873 6:138160405-138160427 TAGAAGCATCCTTGGGGGCTGGG + Intergenic
1016393520 6:143598569-143598591 TAAAAGCAGAAGTGTGGGCCAGG + Intronic
1020409071 7:7870602-7870624 TGGAAGCAGTGGTGGGGGCTGGG - Intronic
1021569269 7:22048164-22048186 TAAGTGCAGTGTTGGGGGCCAGG + Intergenic
1022802865 7:33792524-33792546 TTGCAGCAGGAGTGGGGGCCAGG - Intergenic
1026344680 7:69464007-69464029 TAAAAAGAGTATTGGTGGCCGGG + Intergenic
1027060757 7:75084003-75084025 TAAAAACAGTAGTGGTGGCCAGG + Intergenic
1028154635 7:87415913-87415935 AAGAAGCAGGATTGAGGGGCAGG + Intronic
1029595802 7:101537118-101537140 AAGAAGGGGCATTGGGGGCCAGG + Intronic
1031350727 7:120727838-120727860 TAGAAAGAGTATGGGGGGCCGGG + Intronic
1031663198 7:124453181-124453203 TAGAAGCAGTAGTGGGTGTCTGG - Intergenic
1032634838 7:133695115-133695137 TAGAAAGGGTAGTGGGGGCCGGG - Intronic
1032781719 7:135169575-135169597 TTGAAGCAGCAATAGGGGCCCGG + Intronic
1033148724 7:138894289-138894311 TATAAGCAGTTTTGTGGGGCAGG - Intronic
1033916536 7:146333238-146333260 TACAAGAAGAAATGGGGGCCGGG - Intronic
1035951848 8:4030551-4030573 TAAAAGTAGTTTTGAGGGCCGGG - Intronic
1037737309 8:21578081-21578103 AAGAATCAGCACTGGGGGCCAGG + Intergenic
1041356514 8:57006160-57006182 TAGAAGCTGTTTAGGGGGCCGGG + Intergenic
1043585001 8:81758712-81758734 TAGAATCAGTGATGGAGGCCAGG + Exonic
1043941764 8:86204404-86204426 TTTAAGAAGGATTGGGGGCCAGG + Intergenic
1048168194 8:132082061-132082083 GAGATACAGTAATGGGGGCCAGG + Intronic
1049924421 9:394797-394819 TAGAAACACTAGTGGAGGCCTGG - Intronic
1051175091 9:14352627-14352649 TAGAAACAGCACTGAGGGCCCGG - Intronic
1051329505 9:16008959-16008981 CAAAAGAAGTGTTGGGGGCCTGG - Intronic
1051759463 9:20445257-20445279 AAGAAGAAGTATTGTGGGCAGGG - Intronic
1051978421 9:22983125-22983147 AGAAAGCAATATTGGGGGCCAGG + Intergenic
1052007290 9:23363558-23363580 TAGAAACTGTATTTGAGGCCGGG + Intergenic
1053002265 9:34583717-34583739 TGGAATCAATATTGGGGGCTGGG - Intronic
1056197379 9:84241269-84241291 TAGAGGCAGTGTTGGGGGAGAGG + Intergenic
1056664513 9:88571037-88571059 TCAAAACAGTATTGGGGACCTGG - Intronic
1056846577 9:90043117-90043139 TGGAACCAGTATTGAGGGCCTGG - Intergenic
1056971508 9:91208683-91208705 TAGTACCAATTTTGGGGGCCAGG - Intergenic
1057003690 9:91536476-91536498 TAGAAGCACTATGGAAGGCCAGG + Intergenic
1058657562 9:107237452-107237474 CAGAAACATTATTGGGGGTCAGG + Intergenic
1058744242 9:107974419-107974441 GAGCTGGAGTATTGGGGGCCAGG - Intergenic
1060499962 9:124145742-124145764 TAGAAGCAAGATGGGGTGCCAGG - Intergenic
1061303284 9:129718468-129718490 CAGAGGCTGTACTGGGGGCCGGG - Intronic
1186115742 X:6303629-6303651 TATAAGCAGCATTGAAGGCCAGG + Intergenic
1186607270 X:11105431-11105453 CAGAAGCAGAAATGGGGGCGGGG - Intergenic
1188183808 X:27088887-27088909 TAGGTGCAGTATAGGGGGCATGG + Intergenic
1189832863 X:44992516-44992538 AAAAAGCAGTATTGCTGGCCAGG - Intronic
1189908382 X:45784882-45784904 TAGAAGCAGTATTTGAGGAAGGG - Intergenic
1190959005 X:55227124-55227146 TAGAAGCAGATGTGGGCGCCAGG + Intronic
1194338118 X:92674422-92674444 GAGAAGCAGTGTTGGGAGGCAGG - Intergenic
1197155416 X:123264912-123264934 TAGTGGCAGAGTTGGGGGCCTGG - Intronic
1198112428 X:133513679-133513701 TAGAAGCAATCATGGGGTCCTGG - Intergenic
1198174936 X:134145777-134145799 TTGAAGCAGAGTTGAGGGCCAGG - Intergenic
1200112319 X:153747385-153747407 TAAAAGAAGTATTAGCGGCCAGG + Intergenic
1200646521 Y:5791157-5791179 GAGAAGCAGTGTTGGGAGGCAGG - Intergenic
1202363904 Y:24141197-24141219 TAGAAGCATTGTTTGGGCCCGGG - Intergenic
1202506876 Y:25528925-25528947 TAGAAGCATTGTTTGGGCCCGGG + Intergenic