ID: 1116918473

View in Genome Browser
Species Human (GRCh38)
Location 14:50548278-50548300
Sequence TAGGGTGTACAATGGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116918473_1116918482 5 Left 1116918473 14:50548278-50548300 CCCTCAGCCCATTGTACACCCTA 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1116918482 14:50548306-50548328 GAAGAGTAAAAAATGGGATTGGG 0: 1
1: 0
2: 2
3: 43
4: 468
1116918473_1116918479 -2 Left 1116918473 14:50548278-50548300 CCCTCAGCCCATTGTACACCCTA 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1116918479 14:50548299-50548321 TAATGAAGAAGAGTAAAAAATGG 0: 1
1: 0
2: 6
3: 111
4: 1090
1116918473_1116918481 4 Left 1116918473 14:50548278-50548300 CCCTCAGCCCATTGTACACCCTA 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1116918481 14:50548305-50548327 AGAAGAGTAAAAAATGGGATTGG 0: 1
1: 0
2: 3
3: 47
4: 679
1116918473_1116918480 -1 Left 1116918473 14:50548278-50548300 CCCTCAGCCCATTGTACACCCTA 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1116918480 14:50548300-50548322 AATGAAGAAGAGTAAAAAATGGG 0: 1
1: 0
2: 6
3: 112
4: 1160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116918473 Original CRISPR TAGGGTGTACAATGGGCTGA GGG (reversed) Intronic
907576044 1:55526573-55526595 GAGGCTGCACAATGGGCAGAAGG + Intergenic
907952727 1:59199151-59199173 TCAGGTATACAAAGGGCTGAAGG - Intergenic
911133415 1:94414500-94414522 CAGTGTGTAGAGTGGGCTGAAGG - Intergenic
913202705 1:116508864-116508886 AAGGATGTGCAATGGGCTGCTGG - Intergenic
919799656 1:201345947-201345969 TAGGATCCACCATGGGCTGAAGG - Intergenic
920685306 1:208104656-208104678 TAGGGTGTACAGTGGGTGGGAGG + Intronic
923906324 1:238389184-238389206 TAGGGTCTATAATGGGTAGAAGG - Intergenic
1067554147 10:47256065-47256087 TAGGGTGTGCAATGGACAGCTGG - Intergenic
1068408687 10:56626415-56626437 TAGAGTGCATAATGGGCAGAGGG + Intergenic
1069820625 10:71225473-71225495 TGGGGTGTGCAATGGGGTCAGGG - Intronic
1070829061 10:79407671-79407693 TGGGCTGTAGAATGGGCAGATGG - Intronic
1071839500 10:89454432-89454454 TTGGGTGTAGAATGTACTGAAGG - Intronic
1076455018 10:130586025-130586047 TTTGGTGTAAAATGGGCTGCTGG + Intergenic
1077498723 11:2899248-2899270 AAGGGTGTACAGTGGGGTGACGG - Intronic
1078733724 11:14000644-14000666 TTGGGGGGAAAATGGGCTGAGGG - Intronic
1081852708 11:46284966-46284988 TAGGGTGTGAAATGGGATGTGGG - Intronic
1090745867 11:129704344-129704366 TAATGAGTAAAATGGGCTGATGG - Intergenic
1092910355 12:13140369-13140391 TTGGGTGTAGGATGGGATGAGGG - Intronic
1093312600 12:17608954-17608976 TAGGGTTTAGAACGTGCTGAAGG + Intergenic
1094220035 12:27982896-27982918 TGGAATGTACAATGTGCTGATGG - Intergenic
1095258818 12:40074689-40074711 AAGGGGGAAAAATGGGCTGAAGG - Intronic
1102704663 12:114870639-114870661 TCGTCTGTATAATGGGCTGATGG + Intergenic
1109360943 13:61293898-61293920 TAGGGTATATAATGGGCAGAGGG + Intergenic
1110371904 13:74750070-74750092 TAGGGTGTCTAATGGGTGGAAGG - Intergenic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1114653791 14:24303803-24303825 TGAGGTGTACTATGGACTGACGG + Exonic
1116003522 14:39268542-39268564 TAGAGTGTAAAGTGGGCTTAGGG + Intronic
1116918473 14:50548278-50548300 TAGGGTGTACAATGGGCTGAGGG - Intronic
1118426196 14:65665930-65665952 GAGGGTGGACAATGGGAGGAGGG + Intronic
1124375008 15:29124211-29124233 CAGGCTGGACACTGGGCTGAGGG + Intronic
1125305486 15:38307626-38307648 TAGGAAGTACTATGGACTGAAGG - Intronic
1125454424 15:39842836-39842858 AAGTCTGTACAAGGGGCTGAGGG + Intronic
1129521132 15:76186928-76186950 TAGTGTGTACAAGGGCCAGAGGG - Intronic
1130858138 15:87860204-87860226 GAGGGTGAAGAATGGGGTGATGG + Intronic
1132699091 16:1214669-1214691 CAGGGTGTGAAATGGGCTGGGGG + Intronic
1135627651 16:24010198-24010220 TAGGGTGTTCAATGGGCCAATGG - Intronic
1139590528 16:67930573-67930595 TAGGGTGTGTAATGGCCTGTGGG + Exonic
1142905277 17:3037115-3037137 TGGGGTGTACAAGGGGCTGGCGG - Exonic
1144916885 17:18731111-18731133 TAGTGTTTACATAGGGCTGAAGG + Exonic
1146554862 17:33814593-33814615 TTGGGTGTACAAGTGGCAGAGGG + Intronic
1148536426 17:48442799-48442821 TAGGGTGGAAAATGGGTTGGTGG - Intergenic
1151728946 17:75899730-75899752 TAGGGTGTGCATGGAGCTGAGGG - Intronic
1155784497 18:29880066-29880088 TTTGGTGTTCAATGGCCTGAAGG + Intergenic
1156204830 18:34873960-34873982 TGGGGTGCCCAATGGGCTGAGGG - Intronic
1157184322 18:45525167-45525189 TAGGATGGACAAGGAGCTGAAGG - Intronic
1164658392 19:29941270-29941292 GAGGCTGTACAAAGGGCTGTAGG + Intronic
1164698064 19:30261829-30261851 TGAGGTGTGGAATGGGCTGAGGG + Intronic
1165059579 19:33198569-33198591 TAGGGTGGAGAAGGGGCTGGGGG - Intronic
1168126533 19:54286410-54286432 CAGGGTCTGCACTGGGCTGAGGG + Intergenic
1168175360 19:54624453-54624475 CAGGGTCTGCACTGGGCTGAGGG - Intronic
931823233 2:65973376-65973398 TAGTGTGTTCCATGGGCTCAGGG - Intergenic
934052203 2:88220373-88220395 TAGGGTGTGCATGGGGGTGAGGG - Intergenic
935319750 2:101874559-101874581 TATTGAGTATAATGGGCTGATGG - Intronic
939132230 2:138250122-138250144 GAGGCTGTAAAATAGGCTGATGG - Intergenic
942727731 2:179027872-179027894 TTGGGTGAACAATGGGATGAGGG - Intronic
947273945 2:228370485-228370507 TAGGGTGTACCATGGGTGGAGGG - Intergenic
1170810119 20:19667731-19667753 TACGGAGTGAAATGGGCTGATGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173336730 20:42118201-42118223 GAGGGTGTAAAAAGGGATGAAGG + Intronic
1182072938 22:27476170-27476192 TAGGCTCTGCCATGGGCTGAGGG + Intergenic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1183170091 22:36181382-36181404 TAGAGTGTATAATGGGCAAAGGG + Intergenic
1185120917 22:48969478-48969500 TAGGGTGTATAATGGGTAGAGGG + Intergenic
949966410 3:9360373-9360395 TTGACTTTACAATGGGCTGATGG - Intronic
959853984 3:111126185-111126207 TTGGATGGACAATGGCCTGATGG + Exonic
960347204 3:116547816-116547838 TAGTGGTTACTATGGGCTGAGGG + Intronic
961207187 3:125093843-125093865 TAGGGTGTGAAATAGTCTGATGG - Intronic
963134247 3:141886219-141886241 TAGGGTGCATAATGGGGTGTGGG - Intronic
965080590 3:164025873-164025895 TAGGGTGTAGAACTGGCTCAGGG + Intergenic
965450686 3:168833972-168833994 TAGCATGAACAATGGGCTAATGG + Intergenic
966838871 3:184072051-184072073 TAGTGGTTACCATGGGCTGAGGG + Intergenic
969423752 4:7111904-7111926 TAGGGAGGACAAGGGGCTCACGG + Intergenic
973606884 4:52596655-52596677 TAAGTTGTACAACGTGCTGATGG + Exonic
989997623 5:50854599-50854621 GAAGGTGTAGAATGGGCTGCTGG + Intergenic
993110536 5:83651777-83651799 GAGGGTGGACATTGGGCAGAGGG + Intronic
993979423 5:94526879-94526901 GAGTGTGTACAATGTGCTAAGGG + Intronic
994384153 5:99108637-99108659 TAGGGTTTACGAAGGGCTCACGG + Intergenic
994957069 5:106545842-106545864 TAGGGTGTGCTGTGGGATGAAGG + Intergenic
1000075890 5:157785429-157785451 AAGGGTATAGGATGGGCTGAAGG + Intergenic
1003542608 6:7031768-7031790 TAGGGTGAGCACTGGGCTGATGG - Intergenic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1015192793 6:130489921-130489943 TAGGGTCTAAAATAGGCTTAGGG - Intergenic
1015789827 6:136955272-136955294 TAGGGTGTAGAGAGGGCTGTGGG + Intergenic
1022390778 7:29942753-29942775 AAGGGTGTAGAATGGGCTAGTGG - Intronic
1026149623 7:67776921-67776943 CAGGATGTGCAAAGGGCTGAAGG - Intergenic
1027427704 7:78078300-78078322 TAGTGTCTATAATGGGCTGCTGG + Intronic
1028373512 7:90120042-90120064 TAGGGAGTATATTGGTCTGAAGG + Intergenic
1033491130 7:141845059-141845081 GAGGGTGTATAATGGGCAGAGGG - Intergenic
1036236504 8:7043570-7043592 GCGGGTGGACAAAGGGCTGAGGG - Intergenic
1036586342 8:10127410-10127432 TATGGAGTACAAAGGGATGAAGG + Intronic
1037036918 8:14179845-14179867 TGGGGTGTATAATGGGTAGAGGG - Intronic
1041125506 8:54634280-54634302 TAACATATACAATGGGCTGAAGG + Intergenic
1042664220 8:71188805-71188827 TAAGGAGTAGAATGAGCTGAAGG - Intergenic
1045427419 8:102080874-102080896 TAGAGTGTGCAAAGGCCTGAGGG + Intronic
1046833718 8:118776509-118776531 TAAGGTGTCCACTGGGCTGCTGG - Intergenic
1050062721 9:1727291-1727313 CAGGGTGCACAATGGGCTCAAGG + Intergenic
1055838296 9:80472170-80472192 TAGGGTGAACAATGGACTATAGG + Intergenic
1060546710 9:124466228-124466250 TAAGGTGGACAAGGGGGTGAGGG - Intronic
1187488633 X:19728629-19728651 TAGGAGCTAGAATGGGCTGATGG + Intronic
1189592468 X:42529725-42529747 TTGGGGGTAGAATGGGCTGTGGG - Intergenic
1190093940 X:47463828-47463850 GAGGCTGTAGAATGGGCAGAGGG - Intronic
1198012858 X:132576789-132576811 TAGGGTGAAAAATGGGCTTTGGG + Intergenic
1199274065 X:145921887-145921909 TAGGATATGTAATGGGCTGAGGG - Intergenic
1199952643 X:152717618-152717640 AAGGATGTACAAGTGGCTGATGG - Exonic
1199957040 X:152750830-152750852 AAGGATGTACAAGTGGCTGATGG + Intronic