ID: 1116919532

View in Genome Browser
Species Human (GRCh38)
Location 14:50558337-50558359
Sequence CAACAGAGGGAGACTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1118
Summary {0: 1, 1: 3, 2: 73, 3: 251, 4: 790}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116919527_1116919532 -3 Left 1116919527 14:50558317-50558339 CCACTGCACTCCGGCCTGGGCAA 0: 584
1: 69167
2: 178982
3: 227967
4: 190501
Right 1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG 0: 1
1: 3
2: 73
3: 251
4: 790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116919532 Original CRISPR CAACAGAGGGAGACTGTGTC TGG Intronic
900544514 1:3220992-3221014 CAAGAGAGGGAGACCCTGTCTGG + Intronic
900653686 1:3744438-3744460 CGACAGAGTGAGACTCCGTCAGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901385313 1:8904424-8904446 CAACAGAGCGAGACCCTGTGAGG - Intergenic
901567010 1:10125104-10125126 CGACAGAGTGAAATTGTGTCTGG + Intronic
901693936 1:10992479-10992501 CAACAGAGTGAGACTTCGTGGGG + Intergenic
901798164 1:11692214-11692236 AGACAAAGGGAGACTGGGTCAGG - Intronic
902507527 1:16947856-16947878 CAACAGAGCAAGACTCTGTCTGG - Intronic
902910226 1:19590587-19590609 CAACAGAGTGATACTCTGTCTGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903202545 1:21754139-21754161 CAACAGAGTGAGACTCCATCTGG + Intronic
903520395 1:23943070-23943092 TGACAGAGTGAGACTCTGTCTGG + Intergenic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
903979031 1:27171827-27171849 CGACAGAGCAAGACTCTGTCTGG + Intergenic
904136566 1:28317135-28317157 AAAGAGAGTGAGAATGTGTCAGG - Intergenic
904137859 1:28327991-28328013 CAACAGAGGGAGATCCTGTCTGG - Intergenic
904147678 1:28407142-28407164 CAACAGCCTGAGACTGTGCCAGG - Intronic
904410854 1:30324008-30324030 CATCAGAGGCAGCCTATGTCTGG - Intergenic
904591265 1:31616827-31616849 CAGGGGAGGGAGACTGTGTCTGG + Intergenic
904641441 1:31933701-31933723 CAACAGAGTAAGACTCTGTCTGG + Intronic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905218275 1:36425711-36425733 CAACAGAGCAAGACTCTATCTGG + Intronic
905844153 1:41212854-41212876 CAACAAAGTGAGACTCTGTCTGG + Intronic
905919778 1:41711722-41711744 CAACACAGAGAGCCTGTCTCTGG - Intronic
906031555 1:42724285-42724307 CGACAGAGTGAGACTGTCTCAGG + Intergenic
906246460 1:44278455-44278477 CAACAGAGCAAGACTGTCTCAGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906439753 1:45831008-45831030 CGACAGAGTGAGACCTTGTCTGG + Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907049409 1:51319708-51319730 TGACAGAGTGAGACTCTGTCTGG - Intronic
907130422 1:52092614-52092636 CGACAGAGTGAGATTGTCTCAGG - Intergenic
907361057 1:53915535-53915557 GAACACAGGGTGACTGCGTCAGG + Intergenic
907526094 1:55054983-55055005 CAATAGAGCGAGACTCCGTCTGG + Intronic
907536242 1:55161350-55161372 CAACAGAGCGAGACTCTGTCTGG + Intronic
908016378 1:59841858-59841880 AAACAGAGGGAGACAGAGACAGG + Intronic
908068646 1:60434404-60434426 CAGCAGAGGGACTCTGGGTCTGG + Intergenic
908125529 1:61026471-61026493 CAACACTGGGAGACTGAGGCGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908603794 1:65771169-65771191 CAGCAGAGGGAGGCTTAGTCTGG - Intergenic
908777135 1:67650921-67650943 CGACAGAGTAAGACTCTGTCTGG + Intergenic
909000410 1:70210693-70210715 CAACAGAGCGAGACCCTGTAGGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909882007 1:80891428-80891450 CAACAGAGCAAGACTATCTCAGG + Intergenic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910770161 1:90822885-90822907 CGACAGAGGGAGGCTCTGACTGG + Intergenic
912422762 1:109556953-109556975 CAACAGAGTGAGACTGTCTCGGG - Intronic
912651723 1:111445786-111445808 CAACAGAGTGAAACTGTCTCAGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912845970 1:113074886-113074908 AAACAGAGCGAGACTCCGTCTGG + Intronic
912882265 1:113427330-113427352 CCACAAAGGGAGACTGGGTTAGG - Intronic
912987905 1:114453342-114453364 CAACAGAGAGAGTCTGTCTCAGG + Intronic
913101689 1:115573565-115573587 CAACAGAGGGACCCTGGGCCCGG - Intergenic
913997371 1:143662200-143662222 CAACAGAGCGAGACTCCGTCTGG - Intergenic
914673602 1:149890614-149890636 TGACAGAGTGAGACTCTGTCTGG - Intronic
914817568 1:151074328-151074350 CGACAGAGCGAGACTCCGTCTGG - Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914943486 1:152043208-152043230 CAACAGAGGGAAACCCTGTCTGG + Intronic
915139633 1:153759252-153759274 CAACAGAGCAAGACCCTGTCTGG + Intronic
915150256 1:153825066-153825088 CAACAGAGTGAGACCTTGTCAGG + Intronic
915186797 1:154112834-154112856 CAACAGAATGAGACCCTGTCTGG + Intronic
915295276 1:154916867-154916889 CAACATAGTGAGACCTTGTCTGG - Intergenic
915338477 1:155162507-155162529 CTACAGAGGAAGACTCTGTCTGG - Intergenic
915426290 1:155829968-155829990 CCACAGAGCGAGACTCTGTCTGG - Intronic
915492171 1:156256944-156256966 CGACAGAGCGAGACTCTGTCTGG - Intronic
915841042 1:159213210-159213232 CGACAGAGTGAGACCTTGTCTGG + Intergenic
916141440 1:161702690-161702712 TGACAGAGTGAGACTCTGTCTGG + Intergenic
916228434 1:162514267-162514289 CAACAGAGTGAGACCATCTCTGG + Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917450925 1:175146738-175146760 CAGCAGAGGGCGCGTGTGTCCGG + Intronic
918301327 1:183206818-183206840 CAACAGAGACAGCCTGTGTAGGG + Intronic
918670025 1:187203335-187203357 CAACAGAGCAAGACTGTGTCTGG - Intergenic
918765108 1:188471976-188471998 AAACAGAGAGAGACTAAGTCTGG - Intergenic
918788414 1:188794252-188794274 GTACAGAGCGAGACTCTGTCTGG + Intergenic
918943431 1:191029517-191029539 TGACAGAGGGAGACTCTGTCAGG + Intergenic
919288527 1:195598426-195598448 CAACAGAGCAAGACTCTGTCAGG - Intergenic
919508492 1:198430399-198430421 CGACAGAGCAAGACTCTGTCCGG - Intergenic
919519555 1:198571013-198571035 TGACAGAGAGAGACTGTCTCAGG - Intergenic
919700510 1:200626694-200626716 CAACAGAGCAAGACTGTCTCGGG + Intronic
919896127 1:202010842-202010864 GAACAGAGAGAGATTGTCTCTGG + Exonic
919975984 1:202613098-202613120 CGACAGAGCGAGACTCTGTCTGG - Intronic
920044251 1:203123380-203123402 CAGCAGAGGGAGGCAGTGTTAGG - Intronic
920962789 1:210679236-210679258 CAACAGAGGGAGGCTGTCTGGGG + Exonic
921782323 1:219180014-219180036 CAACAGAGTGAGACTCTGTCTGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922657073 1:227394611-227394633 TGACAGAGCGAGACTCTGTCTGG + Intergenic
922731663 1:227951743-227951765 CAACAGAGTGAGACTCTGTCTGG + Intergenic
922831312 1:228555945-228555967 TCACAGAGCGAGACTCTGTCTGG - Intergenic
923154576 1:231267052-231267074 CTAAAGAGAGAGCCTGTGTCAGG - Intronic
923157828 1:231293969-231293991 CAACAGAGTGAGACTCTGTCTGG + Intergenic
924090949 1:240500316-240500338 CAACAGAGCAAGACTCTGTCTGG - Intronic
924184343 1:241471998-241472020 TGACAGAGGGAGACTCCGTCTGG - Intergenic
924237887 1:242014431-242014453 CAACAGAGCAAGACCCTGTCTGG - Intergenic
924704337 1:246487438-246487460 CAACAGAGCAAGACTCTGTCTGG + Intronic
924706661 1:246507925-246507947 CGACATAGGTAGACTGTCTCTGG - Intergenic
924780920 1:247146841-247146863 CAGCAGAGGGAGACAGATTCGGG - Intronic
924918430 1:248599168-248599190 CGACAGAGCGAGACTCTGTCTGG + Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062947625 10:1473400-1473422 CAACAGAGTGAGGCCCTGTCAGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063108799 10:3017383-3017405 CAGCAGAGTGAGACTCTGTTTGG + Intergenic
1063132361 10:3189191-3189213 CAACAGAGAGAGGCCCTGTCAGG - Intergenic
1063158434 10:3401019-3401041 CAACAAAGTGAGACTCTGTCTGG + Intergenic
1063237015 10:4127459-4127481 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1063545870 10:6980916-6980938 AAACAGAGGGGGCCTGGGTCTGG + Intergenic
1064040294 10:11956838-11956860 TGACAGAGTGAGACTGTGTCTGG - Intronic
1064060907 10:12136467-12136489 CAACAGAGCGAGACTTTAGCTGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064112958 10:12554175-12554197 CAACAGAGCGAGATTCTGTCAGG - Intronic
1064180642 10:13111674-13111696 CGACAGAGTGAGACTCTGTCTGG + Intronic
1064706048 10:18073730-18073752 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1065334961 10:24647855-24647877 GAACAGAGTGAGACTGTCTGGGG - Intronic
1065542678 10:26785703-26785725 CGACAGAGTCAGACTCTGTCTGG + Intronic
1065620126 10:27572333-27572355 CGACAGAGCAAGACTCTGTCTGG - Intergenic
1065691328 10:28336741-28336763 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1065777071 10:29130932-29130954 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1065914742 10:30344722-30344744 CAATAGAGTGAGACTCTGTCTGG - Intronic
1065915974 10:30355325-30355347 GGAGAGAGGGAGACTGTGTTGGG + Intronic
1065925283 10:30429626-30429648 CGACAGAGTGAGACTGTGTCTGG + Intergenic
1066360254 10:34723272-34723294 CAACAGAGCGAGGCTCTGTCTGG + Intronic
1066423649 10:35285033-35285055 CAACAGAGCAAGACTCTGTCTGG - Intronic
1067260946 10:44690940-44690962 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069017417 10:63445892-63445914 AACCAGAGTGAGACTCTGTCTGG - Intronic
1069099397 10:64299589-64299611 CAACAGCGTGAGACCCTGTCTGG + Intergenic
1070169461 10:73921741-73921763 CGACAGAGCAAGACTGTGTATGG - Intronic
1070306576 10:75243165-75243187 CAACAGAGGGAGACTCCATCTGG - Intergenic
1071114312 10:82199150-82199172 TGACAGAGTGAGACTCTGTCCGG + Intronic
1071386176 10:85123626-85123648 CAACAAAGGGAGACCATGTTGGG + Intergenic
1071548232 10:86545015-86545037 CAACACAGTGAGACCCTGTCTGG - Intergenic
1071882963 10:89919175-89919197 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1072028876 10:91497308-91497330 CAACAGAGCAAGACTGTCTTGGG - Intronic
1072095214 10:92171632-92171654 CAACAGAGTGAGACTCTCTCTGG - Intronic
1072185361 10:93032695-93032717 CAACAAAGGGGGACTGTGAGAGG - Intronic
1072341660 10:94458518-94458540 CAACATGGTGAAACTGTGTCTGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072606715 10:96990185-96990207 CGACAGAGTGAGACCCTGTCTGG - Intergenic
1073141375 10:101250551-101250573 CAACAGAGTGAGACTGTCTCAGG - Intergenic
1073337670 10:102722552-102722574 CGACAGAGTGAGACCCTGTCTGG - Intronic
1074215340 10:111378749-111378771 CAACAGAGTGAGACTCCATCTGG - Intergenic
1074851412 10:117442389-117442411 CAGCAGGGGGACACAGTGTCTGG - Intergenic
1074956823 10:118399138-118399160 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1075320340 10:121486460-121486482 CAACAGAGCGAGACTCTGTCTGG - Intronic
1075640590 10:124061543-124061565 CAACAATGGGAAACTGTGTGGGG - Intronic
1076403669 10:130198547-130198569 CGACAGAGCAAGACTCTGTCTGG + Intergenic
1076750571 10:132540524-132540546 CCACTGAAGGAGACTGGGTCTGG - Intronic
1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG + Intronic
1078125451 11:8557229-8557251 CAACAGAGGGGGACCTTGTGGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078297429 11:10088041-10088063 CAACAGAGTGAGACCTTGTCTGG - Intronic
1078676158 11:13416332-13416354 CAACACAGTGAGACCCTGTCTGG + Intronic
1078791422 11:14546455-14546477 CAACAGAGCGAGACTCTGTCTGG - Intronic
1078909168 11:15715002-15715024 CAACATATTAAGACTGTGTCAGG + Intergenic
1079255770 11:18828398-18828420 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1079431749 11:20396616-20396638 CAACAGAGCAAGACTTTGTCGGG + Intronic
1080626170 11:34032683-34032705 CAACAGTGGGGAACTGAGTCAGG - Intergenic
1082047322 11:47740611-47740633 CGACAGAGTGAGACTGTCTCGGG - Intronic
1083802432 11:65054216-65054238 CAACTGAGGGAGACCTGGTCTGG + Intronic
1083840171 11:65299709-65299731 CGACAGAGTGAGACTCTGTCGGG - Intronic
1083847141 11:65342424-65342446 TAACAGAGGGAGACCCTGTCTGG + Intronic
1083964605 11:66035747-66035769 CAACAGAGGGCGAAGGAGTCAGG - Intergenic
1085087647 11:73681787-73681809 CGACAGAGCAAGACTCTGTCTGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085634670 11:78149289-78149311 TGACAGAGCGAGACTGTCTCTGG - Intergenic
1085650502 11:78263611-78263633 CGACAGAGTGAGACTCTGTCTGG + Intronic
1086057110 11:82659505-82659527 CAACAGAGTGAGACTCTGTCAGG + Intergenic
1087403432 11:97697604-97697626 TGACAGAGCGAGACTCTGTCAGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087638839 11:100733803-100733825 CAACAGAGCAAGATTCTGTCTGG + Intronic
1087752287 11:102020061-102020083 CAACAGAGCAAGGCTGTGTCAGG + Intergenic
1088162375 11:106888039-106888061 CTTCAGAGAGAGACTTTGTCAGG - Intronic
1088546103 11:110960733-110960755 CAACAGAGAGAGACTCTGTCTGG - Intergenic
1088578728 11:111297373-111297395 CCACAGAGGGAGAGAGTGCCAGG - Intergenic
1088586941 11:111367689-111367711 CAATTGAGGGAGACTGGATCAGG - Intronic
1088707049 11:112473163-112473185 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1089727562 11:120495992-120496014 CAACAGAGTGAGACTCAGTCAGG - Intergenic
1090018209 11:123104402-123104424 CAACAGGGCGAGACTCCGTCTGG - Intronic
1090122772 11:124050247-124050269 CGACAGAGCGAGATTCTGTCTGG - Intergenic
1090456060 11:126850653-126850675 CAACAGAGGAAGACTTTACCAGG + Intronic
1090585426 11:128206823-128206845 CAAAAGGGGGAGAATGTGCCAGG - Intergenic
1090811152 11:130244645-130244667 CGACAGAGAGAGACTCTGTCTGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091457958 12:622100-622122 TGACAGAGCAAGACTGTGTCGGG + Intronic
1091506626 12:1075705-1075727 AAACAGAGCAAGACTGTCTCGGG + Intronic
1092124946 12:6068487-6068509 CAACAGAGCGAGACTGTCTCAGG - Intronic
1092213653 12:6665274-6665296 CCACAGAGCGAGATTCTGTCTGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092510868 12:9154759-9154781 CAGCAGAGGGAGCCTGGGTTTGG + Exonic
1092522323 12:9287633-9287655 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1092544960 12:9444229-9444251 TGACAGAGTGAGACTCTGTCTGG - Intergenic
1092675937 12:10919922-10919944 CTACAGAGCAAGACTCTGTCAGG - Intronic
1092793094 12:12086296-12086318 TGACAGAGTGAGACTCTGTCTGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093671923 12:21886760-21886782 GAACAGAGGGGCACTGTGGCTGG - Intronic
1093849533 12:24018776-24018798 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094427895 12:30334740-30334762 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1094432834 12:30388811-30388833 CACCAGAGAGAGAGTGTGTGTGG + Intergenic
1094534713 12:31310888-31310910 CGACAGAGTGAGACTCTCTCAGG - Intronic
1094564065 12:31583656-31583678 CAACAGAGCAAGACTGTGTCTGG + Intronic
1095443368 12:42260122-42260144 TGACAGAGAGAGACTTTGTCTGG + Intronic
1095473472 12:42561929-42561951 CAACAGAGCAAAACTCTGTCTGG - Intronic
1095887325 12:47202987-47203009 CAACAGAGCCAGACTGTCTCAGG - Intronic
1095964110 12:47855306-47855328 CATCAGAGCGAGAATCTGTCTGG + Intronic
1096347119 12:50859233-50859255 CAACAGAGCAAGACTCTGTCTGG - Intronic
1096394024 12:51252111-51252133 TGACAGAGCGAGACTCTGTCTGG - Intronic
1096623376 12:52878389-52878411 CAACAGAACGAGACCCTGTCTGG + Intergenic
1097677914 12:62622958-62622980 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098543933 12:71690173-71690195 CAACAGAGCAAGACTGTCTCGGG - Intronic
1098849698 12:75580813-75580835 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1099355585 12:81630914-81630936 CAACAGAGCTAGACTCTGTCTGG - Intronic
1099433897 12:82620358-82620380 TAACAGAGGCAGACTCTGTTTGG + Intergenic
1099786416 12:87269665-87269687 CAAGAGAGGGAGAGAGTGTGAGG + Intergenic
1100518358 12:95349878-95349900 TGACAGAGGGAGGCTGTCTCAGG + Intergenic
1100535629 12:95506075-95506097 CGACAGAGTGAGACTTCGTCTGG + Intronic
1100983368 12:100181766-100181788 CAACAGGATGAGACTCTGTCTGG + Intergenic
1101090872 12:101283794-101283816 CAACAGTGGGAGGCTGAGGCAGG - Intronic
1101179682 12:102201449-102201471 CGACAGAGCGAGACTCTGTCTGG + Intergenic
1101261809 12:103039834-103039856 CATAGCAGGGAGACTGTGTCTGG - Intergenic
1101916978 12:108903456-108903478 CGACAGAGCAAGACTCTGTCGGG - Intergenic
1101925567 12:108968811-108968833 CAACAGAGCGAGACTCTGTCTGG - Intronic
1102069806 12:110008863-110008885 CGACAGAGCGAGACTCAGTCTGG + Intronic
1102151379 12:110690772-110690794 CCACAGAGTGAGACTGTTGCCGG - Intronic
1102686014 12:114725273-114725295 CAACAAAGAGAGACCCTGTCTGG - Intergenic
1103406587 12:120680151-120680173 CAACAGAGTAAGACTCTGTATGG + Intergenic
1103640355 12:122346520-122346542 TGACAGAGTGAGACTCTGTCTGG - Intronic
1103662971 12:122536537-122536559 CCACAGAGCGAGACTGTCTCAGG - Intronic
1103694236 12:122801287-122801309 CAACAGATCGATACTGTGTTTGG + Exonic
1104038339 12:125114000-125114022 CAACAGAGCAAGACTGTAGCTGG - Intronic
1104137188 12:125951836-125951858 CAACACTGGGAGGCTGTGGCAGG - Intergenic
1104453403 12:128889792-128889814 CAACGGAATGAGACTCTGTCAGG - Intronic
1104869971 12:131988012-131988034 CAACAGAGCAAGACCCTGTCTGG - Intronic
1105356464 13:19664001-19664023 CGACAGAAGGAGACTGTTTATGG - Intronic
1105435039 13:20369381-20369403 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1105496180 13:20932929-20932951 CAACAGAGCAAGACTCTGTTGGG - Intergenic
1105659997 13:22483731-22483753 CAATAGAGGGCAACTGTGTCTGG - Intergenic
1105681081 13:22728305-22728327 CATAAGAGCGATACTGTGTCCGG + Intergenic
1106275590 13:28202980-28203002 CAACAGAGTGAGACCCTGTCTGG - Intronic
1106601990 13:31196219-31196241 CGACAGAGTGAGATTCTGTCTGG - Intergenic
1106646505 13:31639647-31639669 CAACAGAGGCAGACAGCCTCTGG + Intergenic
1106648733 13:31666068-31666090 CAACAGAGTGAGAATCCGTCTGG - Intergenic
1107184194 13:37497849-37497871 CAACAGAGTAAGACTATGTCCGG + Intergenic
1107702455 13:43061643-43061665 CAAGAGAGGGAGAGTGTGGTGGG + Intronic
1108270563 13:48755768-48755790 CAGCAGAGGGACCCTGGGTCTGG - Intergenic
1108953467 13:56119859-56119881 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1109244629 13:59938587-59938609 CAACAGAGGCAGACCTTGTTTGG + Intronic
1109534472 13:63698449-63698471 CAACAGAGTGAAACCCTGTCAGG + Intergenic
1110415948 13:75253002-75253024 AAATATAGGGAGACTTTGTCAGG - Intergenic
1110431267 13:75426854-75426876 CAACATGGGGAGACCCTGTCTGG + Intronic
1111216455 13:85149138-85149160 CAACAGAGCGAGACCCTGACTGG - Intergenic
1111683025 13:91467301-91467323 CCACAGAGGGAGAAAGGGTCTGG + Intronic
1111957587 13:94775536-94775558 CAACAGAGTGAGGCCTTGTCAGG + Intergenic
1112451953 13:99520586-99520608 CGACAGAGCAAGACTCTGTCTGG - Intronic
1112763856 13:102719856-102719878 CAACAGAGTAAGACCCTGTCTGG + Intergenic
1112923245 13:104641349-104641371 GGACAGAAGGAGGCTGTGTCTGG + Intergenic
1113189374 13:107726627-107726649 CAACAGAGTGAGACTCCATCTGG - Intronic
1113212579 13:108001039-108001061 CAACAGAGGGACCCTGGGCCCGG - Intergenic
1113225144 13:108151616-108151638 CAGCAGAGTGAGACCCTGTCTGG + Intergenic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113723707 13:112581463-112581485 CGACAGAGTGAGACCTTGTCTGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114446021 14:22788682-22788704 CGACAGAGTGAGACTCTGTCTGG + Intronic
1114470600 14:22958342-22958364 CAACAGAGCAAGACTCCGTCTGG - Intronic
1115237567 14:31222394-31222416 CCACAGAGCAAGACTGTCTCGGG + Intergenic
1115506223 14:34096699-34096721 CAACAGAGAGAGTGTGGGTCAGG - Intronic
1115560331 14:34577101-34577123 CAACAGAGCAAGACTTCGTCTGG - Intronic
1115564943 14:34617060-34617082 CAAGAGAGCAAGACTGTCTCGGG + Intronic
1115581025 14:34758558-34758580 CGACAGAGTGAGACTGTCTCAGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1116983106 14:51191789-51191811 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1117186251 14:53243726-53243748 CAGCAGAGGGACCCTGGGTCTGG - Intergenic
1118206159 14:63725352-63725374 CAACAGAGCGAGACTCCGTCAGG + Intronic
1118263107 14:64266899-64266921 TGACAGAGTGAGACTCTGTCTGG - Intronic
1118834306 14:69465459-69465481 CAACAGAACAAGACTCTGTCTGG + Intergenic
1119076247 14:71642374-71642396 CACCAGAGGTAGACTGTTTACGG - Intronic
1119113110 14:71994207-71994229 TAACAGCGGGAGACTGAGGCTGG - Intronic
1119458668 14:74779659-74779681 CAACAGAGTGAGACCCTGTCTGG - Intronic
1119548407 14:75490441-75490463 CAACATAGTGAGACTCTGTCTGG - Intergenic
1119815626 14:77564210-77564232 CAACAGAGGGAGACTCTGTCTGG + Intronic
1120907298 14:89631545-89631567 CGACAGAGCGAGACTCCGTCTGG + Exonic
1121036729 14:90711439-90711461 CAACAGAGCGAGACTCCATCGGG - Intronic
1121221419 14:92288356-92288378 CAGGAGAGGGTGACTGTCTCTGG - Intergenic
1121971428 14:98359997-98360019 TAACAGAGGGTGACTGTTTAGGG - Intergenic
1122233076 14:100316918-100316940 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122581613 14:102775401-102775423 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1122608698 14:102965935-102965957 CAACAGAGTGAGACTGTCGCGGG + Intronic
1122686770 14:103512253-103512275 CGACAGAGTGACACTCTGTCTGG - Intergenic
1123911112 15:24967786-24967808 CAACAGAATGAGACCCTGTCTGG + Intronic
1123966933 15:25468541-25468563 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1124379997 15:29157075-29157097 CGACAAAGCGAGACTCTGTCTGG + Intronic
1124844158 15:33274679-33274701 ACACAGAGGGAGACTTTGTTTGG - Intergenic
1124908087 15:33891081-33891103 CAACAGAGTGAGACTCTGTCTGG + Intronic
1125636387 15:41192313-41192335 CGACAGAGGAAGACTGCCTCAGG - Intronic
1125662808 15:41407630-41407652 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1125758296 15:42080913-42080935 CACCAGAGGGACACTTTGTGTGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126605561 15:50472575-50472597 AGACAGAGCGAGACTCTGTCTGG + Intronic
1126911585 15:53422564-53422586 CATCACGGGGAGACTGTGTGTGG + Intergenic
1127145881 15:56023245-56023267 CAACAGAGAGAGACTCCGTGTGG - Intergenic
1127287509 15:57544444-57544466 CAACACAGGGAGACTGTGAGGGG - Intronic
1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127785483 15:62351367-62351389 CCACAGAGTGAGACTCCGTCTGG + Intergenic
1128305696 15:66597671-66597693 TGACAGAGCGAGACTCTGTCTGG - Intronic
1128364600 15:66988801-66988823 CAACACAGAGAGACTCTGTTTGG + Intergenic
1128388658 15:67167971-67167993 CAACAGAGGGAGACTCTGTCTGG - Intronic
1128581156 15:68811040-68811062 CCACAGAGTGAGACTCTGTCTGG + Intronic
1128636290 15:69304609-69304631 GAAGAGAGGAAGACTGTGTAAGG - Intronic
1129145001 15:73639115-73639137 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1129339480 15:74875753-74875775 TGACAGAGTGAGACTTTGTCTGG - Intergenic
1129479364 15:75810822-75810844 CAAGAGAGGGAGACTGTGCTGGG - Intergenic
1129827934 15:78647118-78647140 CAACAAAGTGGGACTGTCTCAGG + Intronic
1130030841 15:80312103-80312125 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1130078193 15:80708333-80708355 CGACAGAGCAAGACTCTGTCTGG - Intronic
1130098076 15:80871021-80871043 CAACAGCTGGAAACTGTTTCAGG + Intronic
1130165120 15:81448100-81448122 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1130876321 15:88017721-88017743 CAACACAGGGAGCCTGTGCCTGG - Intronic
1131281264 15:91023305-91023327 CAAAAGGGCGAGACTCTGTCAGG - Intergenic
1131455635 15:92580455-92580477 CAGCAGAGGGGGTCTGTGGCTGG - Intergenic
1131486825 15:92827934-92827956 CGACAGATAGAGACTCTGTCGGG - Intergenic
1131912177 15:97219437-97219459 CAACAGAGTGAGACTCTATAGGG - Intergenic
1132837267 16:1960237-1960259 CAACAGAGTGAGACTGTCTCAGG - Intronic
1133011551 16:2915155-2915177 CAACAAAATGAGACTGTCTCAGG - Intronic
1133105885 16:3509227-3509249 CAACAGAACGAGACCTTGTCTGG + Intronic
1133124447 16:3636798-3636820 CAACAGAGTGAGACTCTGTCTGG + Intronic
1133262454 16:4559905-4559927 GAACAGAGAGAGACTGTAACAGG + Intronic
1133329240 16:4961346-4961368 CAACAGAGTGAGACTCAGTCTGG - Intronic
1133369468 16:5237125-5237147 CAAGAGAGTGAGACCCTGTCTGG + Intergenic
1133458267 16:5962287-5962309 GAACAGGGAGAGACTGAGTCTGG - Intergenic
1133561559 16:6955219-6955241 CAACAGAGTGAGACCTTGTCTGG + Intronic
1133819834 16:9226346-9226368 CAACAGAGCCAGACCCTGTCAGG - Intergenic
1133898775 16:9953629-9953651 CAAAAGAAGGAGAGTGTGTGTGG + Intronic
1133947999 16:10365341-10365363 CAACAGAGCAAGACTATCTCAGG + Intronic
1133987892 16:10682345-10682367 TGACAGAGTGAGACTCTGTCTGG - Intronic
1134014936 16:10881276-10881298 CAACAGAGCAAGACTGTCTCAGG + Intronic
1134068691 16:11247105-11247127 TGACAGAGTGAGACTCTGTCGGG - Intergenic
1134118524 16:11567398-11567420 CAACAGAGCAAGACTCCGTCTGG + Intronic
1134130416 16:11645867-11645889 TGACAGAGTGAGACTCTGTCTGG - Intergenic
1134154947 16:11835511-11835533 CAACAGAGAGAGACAGTCCCTGG - Exonic
1134241625 16:12510974-12510996 CGACAGAGTGAGACTCTGTGGGG - Intronic
1134375975 16:13673619-13673641 CATCAGAGTGAGACCCTGTCAGG + Intergenic
1134448929 16:14351597-14351619 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1134464703 16:14464734-14464756 CAACAGAGGAAGATTCTGTTTGG + Intronic
1134525881 16:14943174-14943196 CAACAGAGGGAGACTCCTTTTGG - Intronic
1135019825 16:18954211-18954233 CAACAGAGCCAGACTCTCTCGGG - Intergenic
1135036034 16:19077606-19077628 AGACAGAGTGAGACTGTGTCTGG - Intronic
1135079627 16:19422926-19422948 CCACAGAGCGAGACTCAGTCTGG + Intronic
1135176617 16:20235495-20235517 CAAGAGAGGAAGACTTTATCTGG - Intergenic
1135621396 16:23958915-23958937 GAACAAAGGCAGACTGGGTCTGG - Intronic
1135697307 16:24601216-24601238 CAACAGAGCTAGACTCTGTCTGG - Intergenic
1135706185 16:24677180-24677202 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1135760791 16:25136567-25136589 CAACAGAGTGAGACTCTGACGGG - Intronic
1136039115 16:27564042-27564064 CAACAGAGCAAGACCCTGTCTGG + Intronic
1136162929 16:28432588-28432610 CGACAGAGCAAGACTGTCTCAGG + Intergenic
1136200036 16:28682400-28682422 CGACAGAGCAAGACTGTCTCAGG - Intergenic
1136216384 16:28796576-28796598 CGACAGAGCAAGACTGTCTCAGG - Intergenic
1136465731 16:30442357-30442379 CAACAGAGTGAGACTTTGTCCGG + Intergenic
1136484909 16:30565449-30565471 CAACATAGTGAGACCCTGTCTGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136579028 16:31140942-31140964 CGACAGAGCAAGACTCTGTCTGG - Intronic
1137294788 16:47080352-47080374 CAACACTGGGACACTGTGTGGGG + Exonic
1137424860 16:48369700-48369722 CAACAGAGTGAGACCCTGTCTGG + Intronic
1137797659 16:51235885-51235907 CGACAGAGGGAGACCCTGTCCGG - Intergenic
1138185749 16:54976162-54976184 CAACAGAGCGACACCGTTTCTGG - Intergenic
1138472234 16:57246782-57246804 CGACAGAGCGAGACTCCGTCTGG + Intronic
1138494785 16:57401502-57401524 AAACAGAGCAAGACTCTGTCTGG + Intergenic
1138687548 16:58738942-58738964 CAACAGAGTGAGACGCTGTCAGG + Intergenic
1138693102 16:58787146-58787168 CAATAGAGCGAGACTCTGTCGGG - Intergenic
1139326644 16:66157618-66157640 CCAGGGAGGGAGACTGTGACGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139709794 16:68767212-68767234 CAACAGAGCGAGACTGTCTCAGG - Intronic
1139779770 16:69340740-69340762 CGACAGAGTGAAACTGTGTCAGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139902676 16:70340698-70340720 CGACAGAGCGAGACTCCGTCTGG - Intronic
1140045304 16:71436699-71436721 CAACAGTGGGTGACTGTGGGAGG + Intergenic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1140206846 16:72940156-72940178 CAACACAGGGAGGCTGAGGCAGG - Intronic
1140256657 16:73342876-73342898 CAACACAGTGACACTGTGTGGGG + Intergenic
1140366176 16:74382940-74382962 CAACAGAGGGAGACTCGTTTCGG - Intronic
1140460466 16:75135586-75135608 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1140571629 16:76113214-76113236 CTACAGAGCAAGACTCTGTCTGG + Intergenic
1140692577 16:77498711-77498733 TAACAGAGCGAGACCCTGTCTGG + Intergenic
1140784813 16:78330415-78330437 CAACAGAGCAAGACTTTCTCAGG - Intronic
1141251592 16:82363815-82363837 TAACAGTGGGAGAGTCTGTCTGG + Intergenic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1141485345 16:84335082-84335104 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1141713480 16:85713859-85713881 GGACAGTGGGAGACTGTGCCTGG + Intronic
1142238253 16:88932947-88932969 CGACAGAGTGAGATTGTGTCTGG + Intronic
1142570539 17:870733-870755 CAACAGAGTGAGACTCTGTCTGG + Intronic
1142643380 17:1297621-1297643 CGACAGAGCAAGACTCTGTCTGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143092740 17:4458702-4458724 CAACACAGGGAGACCCTGTCTGG - Intronic
1143133390 17:4695300-4695322 CAACAGAGTGAGACTCCGTCTGG + Intronic
1143361679 17:6376271-6376293 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1143774714 17:9190830-9190852 CAACAGAGCAGGACTGTGTCTGG + Intronic
1144962236 17:19051357-19051379 GGACAGAGCGAGACTTTGTCTGG + Intergenic
1144972925 17:19123163-19123185 GGACAGAGCGAGACTTTGTCTGG - Intergenic
1145930596 17:28682599-28682621 CAACAGAGCGAGACCGTCTCAGG + Intronic
1146068082 17:29653604-29653626 CAACAGAGTGAGACTCTGTCTGG - Intronic
1146153041 17:30493315-30493337 CTACAGAGAGAGACTGAGACAGG + Intronic
1146206701 17:30911085-30911107 CAAAAAAGTGAGACTGTCTCCGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146358144 17:32152419-32152441 AAGCAGAAGGAGACTGTGACTGG + Intronic
1146369271 17:32254958-32254980 CAGCAGAGGGAGGCTGTGCGTGG - Intergenic
1146392511 17:32435760-32435782 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146801994 17:35832056-35832078 CAACAGAGCAAGACTCCGTCTGG + Intronic
1146862680 17:36318154-36318176 CAACAGAATGAGACCCTGTCTGG + Intronic
1146973453 17:37091597-37091619 CAACAGGAGGAGACCCTGTCTGG - Intronic
1147005658 17:37401577-37401599 CAACAGAGTGAGACCTCGTCTGG - Intronic
1147021045 17:37533379-37533401 TGACAGAGTGAGACTCTGTCTGG + Intronic
1147093008 17:38122250-38122272 CAACAGAATGAGACCCTGTCTGG + Intergenic
1147104200 17:38198238-38198260 CAACAGAATGAGACCCTGTCTGG - Intergenic
1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG + Intronic
1147203046 17:38816702-38816724 CAACAGAGTGAAACTCTGTCTGG - Intronic
1147280109 17:39352659-39352681 CAACAGAGTGAAGCTCTGTCTGG + Intronic
1147288931 17:39425780-39425802 CGACAGAGTGAGACTCTGTCTGG + Intronic
1147658819 17:42106137-42106159 TAACAGAGTGAGACTCTGTCTGG + Intronic
1147781831 17:42948658-42948680 CAACAGAGTGAGACTATATCTGG + Intergenic
1147820229 17:43237170-43237192 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147822334 17:43249055-43249077 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147823258 17:43254501-43254523 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147823627 17:43256642-43256664 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147824086 17:43259406-43259428 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147824300 17:43260701-43260723 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147824787 17:43263537-43263559 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147824847 17:43263846-43263868 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147827964 17:43281365-43281387 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147829072 17:43287527-43287549 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147830168 17:43293667-43293689 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147831111 17:43298864-43298886 CGACAGAGCGAGAGTTTGTCTGG - Intergenic
1147833382 17:43312897-43312919 CAATAGAGTGAGACTGTGTTGGG + Intergenic
1148091630 17:45025769-45025791 CGACAGAGTGAGACTGTCTCAGG - Intronic
1148425293 17:47590175-47590197 CAACAGAATGAGACCCTGTCTGG + Intronic
1148944178 17:51244433-51244455 CAACAAGGGGAGACTGTCTCAGG - Intronic
1149748691 17:59124410-59124432 CAACAGAGTGAGACTCTGTCTGG + Intronic
1149968836 17:61195377-61195399 CAACAGAATGAGACCTTGTCTGG - Intronic
1150687349 17:67331493-67331515 CAGCAGAGGGACCCTGGGTCTGG - Intergenic
1150767286 17:68012218-68012240 CAACAGAGCAAGACCGTGTCTGG + Intergenic
1150912263 17:69400514-69400536 CACCAGAGTGAGACTGTCTCGGG + Intergenic
1150972038 17:70039802-70039824 CAACAGAGCAAGAATCTGTCTGG - Intergenic
1151011592 17:70504152-70504174 CAACAGAGCAAGACTCTATCTGG + Intergenic
1151538899 17:74754420-74754442 CAACAGAGCAAGACTGTCTCAGG - Intronic
1151735892 17:75940260-75940282 CAACAGAGCGAGACCCTGTCTGG - Intronic
1151861834 17:76770049-76770071 CGACAGAGCGAGACTCTGTCTGG - Intronic
1151862296 17:76773627-76773649 CAACTGAGCGAGACTCCGTCTGG - Intronic
1151882423 17:76903529-76903551 CACCTGAGGGAGACTCTTTCTGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152106795 17:78334897-78334919 CAGCAGAGTGAGACGCTGTCTGG - Intergenic
1152127301 17:78454927-78454949 TGACAGAGTGAGACTCTGTCAGG - Intronic
1152177096 17:78794986-78795008 CGACAGAGGGAGACTCTGTTCGG + Intronic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152398232 17:80048238-80048260 CAACAGAGCAAGACTCTGTCTGG + Intronic
1153009305 18:523373-523395 CCACAGAGTGAGACTCTGTCTGG + Intergenic
1153187097 18:2498185-2498207 CTCCAGAGTGAGACTCTGTCTGG - Intergenic
1153199757 18:2636005-2636027 CAACAGAGGGACTCCGTCTCGGG - Intergenic
1153323727 18:3797303-3797325 CAACACAGCAAGACTGTCTCAGG + Intronic
1154346343 18:13546386-13546408 CAACAGGGCAAGACTCTGTCAGG - Intronic
1154942761 18:21131433-21131455 TGACAGAGCGAGACTGTCTCAGG - Intergenic
1154946841 18:21170229-21170251 CAACAGTGCGAGACTCTGTCTGG + Intergenic
1154960613 18:21304997-21305019 CAACAGAGCGACACTCTGTCTGG - Intronic
1154992087 18:21607050-21607072 CAACAGAGCGAGACTCCATCTGG - Intergenic
1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG + Intronic
1155860495 18:30891559-30891581 AGACAGAGCGAGACTCTGTCTGG + Intergenic
1156082446 18:33354628-33354650 CGACAGAGTGAGACTCTGTCTGG - Intronic
1156296597 18:35797400-35797422 CCTTAGAGGGAGACTGTGTTGGG + Intergenic
1157358142 18:46953995-46954017 GAACAGAGGAAGACTTTGTGGGG + Intronic
1157462424 18:47911329-47911351 CAACAGAGCGAGACTCCATCTGG + Intronic
1157849863 18:51038235-51038257 CTACAGAGCGAGACTGTGGGGGG + Intronic
1157997713 18:52578958-52578980 CAACAGAGTGAGACTCCGTCTGG + Intronic
1158575702 18:58635769-58635791 CAACAAAGTGAGACTTTGTCTGG + Intergenic
1158954950 18:62528577-62528599 CGACAGAGTGAGACTGTCTCGGG + Intronic
1159052305 18:63432494-63432516 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1160284373 18:77526548-77526570 CACAAGAAGGAGGCTGTGTCTGG - Intergenic
1160779221 19:870539-870561 CAACAGAGTGAGACCCTGTCGGG + Intronic
1160894381 19:1395814-1395836 GCATAGAGGGAGACTGAGTCAGG - Intergenic
1160906529 19:1454023-1454045 CAGCAGAGGGAGGCAGGGTCTGG + Intronic
1161124570 19:2548459-2548481 CGACAGAGCGAGGCTCTGTCTGG + Intronic
1161188931 19:2942392-2942414 CAACAGAGCTAGACCCTGTCTGG - Intronic
1161327687 19:3671410-3671432 CCACAGAGGGAAACTGAGGCAGG - Intronic
1161424245 19:4193815-4193837 CGACAGAGCGAGACTCCGTCGGG + Intronic
1161616754 19:5275088-5275110 CGACAGAGTGAGACACTGTCTGG - Intronic
1161716439 19:5878708-5878730 CGACAGAGGGAGACTCCGTCTGG - Intronic
1161758646 19:6153826-6153848 CAACAGAGTGAGACCCTGTCTGG + Intronic
1162094932 19:8304715-8304737 CAACAGAGTAAGACTGTCTCAGG - Intronic
1162214612 19:9123013-9123035 CAACAGAGTGAGACTTTGTCTGG - Intergenic
1162280825 19:9696567-9696589 CAACAGAGTGAGACCCTGTCTGG - Intronic
1162313669 19:9923535-9923557 CAACAAAGTGAGACTGTCTCAGG + Intronic
1162451714 19:10758959-10758981 CAATAGAGCGAGACTCTGTGTGG - Intronic
1162455996 19:10785135-10785157 CAACAGAGCGAGACTCCATCTGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162759848 19:12882172-12882194 CAACAGAGCGAGATATTGTCCGG - Intergenic
1162761706 19:12892309-12892331 CAACAGAGCCAGACTCTGTTGGG - Intronic
1162807354 19:13144827-13144849 CAACAGCTGGAGATGGTGTCTGG - Exonic
1163261340 19:16192073-16192095 CAAGAGAGTGAAACTCTGTCTGG - Intergenic
1163589576 19:18184719-18184741 CAACAGAGCAAGACTCTTTCAGG - Intergenic
1163719263 19:18890759-18890781 CAACAGAGTAAGACCGCGTCTGG + Intronic
1163719417 19:18891595-18891617 CAACAGAGCGAGACCCTGCCTGG - Intronic
1163805214 19:19392410-19392432 TGACAGAGCGAGACTCTGTCTGG - Intronic
1163879411 19:19904037-19904059 CAACAGAGCGAGATTCTGGCTGG + Intronic
1164027782 19:21368754-21368776 CAACAGAGTAAGAATTTGTCTGG - Intronic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164979910 19:32606170-32606192 CGACAGAGCGAGACTCTGTCTGG - Intronic
1165131031 19:33632157-33632179 TGACAGAGGGAGACCCTGTCTGG - Intronic
1165243322 19:34483507-34483529 CTGGAGAGGGAGACTGTGTGAGG + Intronic
1165313273 19:35040935-35040957 CAGCCGAGGCCGACTGTGTCCGG + Intronic
1165323274 19:35099369-35099391 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1165771463 19:38382890-38382912 TGACAGAGCGAGACTCTGTCTGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166547330 19:43640986-43641008 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1166664066 19:44666648-44666670 CGACAGAGTGAGAATCTGTCAGG + Intronic
1166698647 19:44868890-44868912 CGACAGAGTGAGACTCTGTCTGG + Intronic
1166712902 19:44948678-44948700 CTGCAGGGGGAGAGTGTGTCAGG - Intronic
1166941604 19:46369904-46369926 CAGCAGAGCGAGACTCCGTCTGG + Intronic
1166946328 19:46399152-46399174 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1167067293 19:47196063-47196085 CAACAGAGCGAGACTCCGTCTGG - Intronic
1167127286 19:47558762-47558784 CAACAGAGTGAAACTGTCTCAGG - Intergenic
1167421461 19:49406394-49406416 CGACAGAGCGAGACTGTCTCAGG - Intronic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167765005 19:51476253-51476275 GGACAGAGTGAGACTCTGTCTGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168053601 19:53848289-53848311 TGACAGAGTGAGACTGTCTCCGG - Intergenic
1168218471 19:54943579-54943601 CGACAGAGCGAGACTCCGTCTGG + Intronic
1168349825 19:55669384-55669406 GAGCAGAGGGAGACTGGGTCTGG + Intronic
1168551333 19:57298488-57298510 TGACAGAGCGAGACTATGTCTGG - Intergenic
1168596305 19:57680546-57680568 CAACAGAGTGAGACTCCGTCTGG + Intergenic
1168672035 19:58247932-58247954 TGACAGAGTGAGACTCTGTCTGG - Intronic
925371031 2:3345603-3345625 CAATAGAGCGAGACTCTGTCTGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925429853 2:3781843-3781865 TGACAGAGAGAGACTCTGTCTGG + Intronic
925645950 2:6037242-6037264 CAACATCGGGAGACTGAGGCAGG - Intergenic
925772079 2:7292260-7292282 CTACAGAAGAAAACTGTGTCAGG - Intergenic
925930286 2:8701836-8701858 CAAGAGACGGTGACAGTGTCGGG + Intergenic
926249331 2:11145001-11145023 CGACAGTGCGAGACTCTGTCTGG - Exonic
926379780 2:12275379-12275401 CAACAAAGCGAGACTCCGTCTGG + Intergenic
926689929 2:15726070-15726092 CAACAGAGACAGACAGTGTGGGG - Intronic
927106238 2:19829854-19829876 CAGCAGAGGGGGAATGTCTCAGG + Intergenic
927632439 2:24786227-24786249 CAACAGAGTGAGACTTTGTCTGG - Intergenic
927812364 2:26187265-26187287 CAATAGAGGGAGTAGGTGTCCGG - Exonic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928344695 2:30480732-30480754 CAATAGAGTGAGACTGTTTCTGG + Intronic
928497571 2:31849578-31849600 CAACACAGGGAGACCGTCTTGGG + Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928667696 2:33567186-33567208 CAACAGAGCGACACACTGTCTGG + Intergenic
929184714 2:39081498-39081520 CAACAGAGTGAGACTGTCCTCGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930103635 2:47621970-47621992 CGACAGAGCAAGACTGTCTCAGG - Intergenic
930525972 2:52530108-52530130 CAACAGAATGAGACCCTGTCTGG - Intergenic
930565586 2:53015286-53015308 CAGAAGATGGAGACTGTGTGAGG + Intergenic
930609004 2:53520966-53520988 CAGCAGTTGGAGACTGTCTCAGG - Intergenic
931170235 2:59795406-59795428 CAGGAGAGAGAGACTGTGTTGGG - Intergenic
931670795 2:64644926-64644948 CAACAGGGAGAGACCGTCTCTGG + Intronic
931740048 2:65233920-65233942 CAACAGAGTGAGACCCTGTCAGG - Intronic
932256258 2:70289789-70289811 CAATAGAGCGAAACTGTCTCAGG + Intronic
932382639 2:71299198-71299220 CAACAGAGCGAGACCCTGTCTGG + Intronic
932672989 2:73754282-73754304 CATCACAGGGAGACAGGGTCAGG - Intergenic
932724729 2:74169646-74169668 CAACAGAGTGAGACCCAGTCGGG - Intronic
933592488 2:84248305-84248327 CAACAGAGTGAGACTCTGTCAGG - Intergenic
933914098 2:86971052-86971074 CGACAGAGTAAGACTGTCTCAGG - Intronic
933945548 2:87283366-87283388 TGACAGAGTGAGACTCTGTCTGG - Intergenic
934008895 2:87798846-87798868 CGACAGAGTAAGACTGTCTCAGG + Intronic
934706048 2:96481936-96481958 CAACAGAGCGAGACTCTGTCTGG + Intergenic
934976374 2:98805680-98805702 AAACAGAAGGACACTGTTTCTGG + Intronic
935213208 2:100955861-100955883 CAAAAGAGAGAGAGGGTGTCAGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935772541 2:106439844-106439866 CGACAGAGTAAGACTGTCTCAGG + Intronic
935907531 2:107856071-107856093 CGACAGAGTAAGACTGTCTCAGG - Intronic
936011067 2:108925635-108925657 CAACAGAAGGAGACTGTTTCAGG - Intronic
936129322 2:109821213-109821235 CGACAGAGTAAGACTGTCTCAGG - Intronic
936215375 2:110550272-110550294 CGACAGAGTAAGACTGTCTCAGG + Intronic
936334664 2:111578220-111578242 TGACAGAGTGAGACTCTGTCTGG + Intergenic
936424512 2:112404845-112404867 CGACAGAGTAAGACTGTCTCAGG + Intronic
936939482 2:117869785-117869807 CGAAAGAGTGAGACTCTGTCTGG - Intergenic
937202692 2:120215613-120215635 CGACAGAGCGAGACTCCGTCTGG - Intergenic
937291465 2:120784680-120784702 CAGCAGATGGAGGCTGTGTCTGG - Intronic
937802082 2:126092000-126092022 CAACATAGGGAGACCTGGTCTGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938275621 2:130018971-130018993 CAACAGAGTGAAACTCTTTCTGG - Intergenic
938399125 2:130974250-130974272 CAACAGAGTGAGATCTTGTCTGG + Intronic
938413351 2:131083922-131083944 CGACAGAGCGAGACTCCGTCTGG - Intronic
938413858 2:131088224-131088246 CAACAGAGCAAGACTCTGTCTGG + Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938612912 2:132967896-132967918 CAACAGAGTGAGGCTGAGTGAGG + Intronic
938894124 2:135733938-135733960 CAACAGAGCGAGACGCCGTCTGG + Intergenic
939359844 2:141156378-141156400 CAACACAGGGAGGCTGAGACAGG + Intronic
939531294 2:143364984-143365006 CAACAGAGCGAGACTCTGTGTGG + Intronic
939896256 2:147794396-147794418 TGACAGAGAGAGACTCTGTCTGG + Intergenic
940304134 2:152207607-152207629 CAACAGAGCCAGACTCTGTGTGG - Intergenic
940509842 2:154599298-154599320 CGACAGAGCAAGACTCTGTCTGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941061187 2:160849326-160849348 GAACAGTGGAACACTGTGTCAGG + Intergenic
942654269 2:178198320-178198342 CGACAGAGCGAGATTCTGTCTGG - Intronic
943446461 2:187993813-187993835 GAGCAGGGAGAGACTGTGTCTGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943753500 2:191534853-191534875 AAACAGTGGGAGACTCTGTGTGG + Intergenic
944704973 2:202279772-202279794 CAACAGAGCGAGACTCCTTCTGG + Intronic
944717167 2:202386698-202386720 CGACAGAGCAAGACTCTGTCTGG - Intronic
944936009 2:204568933-204568955 TGACAGAGTGAGACTGTCTCAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945280800 2:208033664-208033686 CAACAGAGTGAGACTCCATCTGG + Intergenic
945369330 2:208997426-208997448 CAACACAGCAAGACTGTCTCAGG - Intergenic
945388094 2:209228433-209228455 TGACAGAGTGAGACTCTGTCTGG - Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946730955 2:222709045-222709067 CAAAAGAGGCAGACTGGGCCTGG + Intronic
947078066 2:226365845-226365867 CGACAGAGTGAGACTCTATCTGG - Intergenic
947297178 2:228643894-228643916 CGACAGAGTGAGACTCTGTCTGG + Intergenic
947487159 2:230561826-230561848 TGACAGAGTGAGACTCTGTCTGG + Intergenic
947505174 2:230703285-230703307 CAACAGAGTGAGACTCTGTCTGG - Intergenic
947723772 2:232384391-232384413 CAACAGAGCAAGACCCTGTCTGG + Intergenic
947781062 2:232763717-232763739 CTACTGAGGGAGACTGAGGCAGG + Intronic
948008826 2:234634258-234634280 CGACAGAGCTAGACTCTGTCGGG - Intergenic
948418584 2:237836971-237836993 CTACTGAGGGAGGCTGAGTCAGG - Intronic
948742884 2:240059513-240059535 CGACAGAGCAAGACTCTGTCTGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169094229 20:2881978-2882000 AGACAGAGCGAGACTGTTTCAGG + Intronic
1169169617 20:3454270-3454292 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1169419898 20:5451471-5451493 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1169454682 20:5741838-5741860 CAACAGAGTGAGACCGTATCCGG + Intergenic
1170249010 20:14258960-14258982 TAACAGAGCAAGACTCTGTCTGG - Intronic
1172069815 20:32248425-32248447 CAATAGAGCAAGACTATGTCTGG - Intergenic
1172289826 20:33768140-33768162 CGACAGAGTGAGACTGCCTCGGG - Intronic
1172411570 20:34727741-34727763 CGACAGAGTGACACTCTGTCTGG - Intronic
1172551661 20:35805216-35805238 CAACAGAATGAGACCTTGTCTGG - Intronic
1172665219 20:36594473-36594495 CAACAGTGGGAAACTGAGTTTGG + Intronic
1173008381 20:39158360-39158382 CAACACAGTGAGACCCTGTCTGG - Intergenic
1173681036 20:44882035-44882057 CAACAGAGTGAGACTCTCTCTGG + Intergenic
1174014334 20:47475613-47475635 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1174427014 20:50439054-50439076 CTACAGAGGGAGGCAGTCTCAGG - Intergenic
1174602119 20:51733391-51733413 CAACAGAATTAGACTCTGTCTGG - Intronic
1174810370 20:53640368-53640390 CGACAGAGTGAGACTTTGTTTGG - Intergenic
1174825178 20:53762253-53762275 CAACAGAGTGAGACCCTGTCAGG - Intergenic
1175235331 20:57506321-57506343 CAACAGAGCGAGACTGTCTCAGG - Intronic
1175255620 20:57645176-57645198 CAACAGAGGGACCCTGGGGCTGG - Intergenic
1175709630 20:61208982-61209004 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1175848833 20:62075897-62075919 CAACAGAGTGAAACTTTGTCTGG + Intergenic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1176070380 20:63223183-63223205 CCACAGAGGAGGAGTGTGTCTGG + Intergenic
1177120600 21:17132834-17132856 CAGCAGAGGGAAACTGGGTCAGG + Intergenic
1177456433 21:21344927-21344949 AAATAGAGTGAGACTGTGTTTGG + Intronic
1177686374 21:24442452-24442474 AGACAGAGGGAGACAGTGTGAGG - Intergenic
1177846596 21:26296048-26296070 CAACAGAATGAGACTCTGTCTGG - Intergenic
1178608703 21:34061073-34061095 CAAAAGAGTGAAACTCTGTCTGG + Intergenic
1178628303 21:34236858-34236880 CAACAAAATGAGACTCTGTCTGG + Intergenic
1178839222 21:36125351-36125373 CGACAGAGTGAGACTGTCTCAGG + Intergenic
1179138775 21:38703673-38703695 CTACAGGGTGAGACTGTCTCAGG + Intergenic
1179663836 21:42896001-42896023 CAACAGAGTGAGACTGTCTCAGG - Intronic
1180166175 21:46031104-46031126 CCACAGAGTGAGACTCTGTCGGG - Intergenic
1180608444 22:17079475-17079497 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181754762 22:25016038-25016060 CAACAGAGCGAGACTCCGTCTGG - Intronic
1181776672 22:25164926-25164948 CAACAGAGTGAGACTGTCTCGGG + Intronic
1182182328 22:28363177-28363199 CAGCAGAGGGACCCTGGGTCCGG - Intronic
1182231779 22:28842947-28842969 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1182340346 22:29615162-29615184 CAACAAAGCAAGACTCTGTCTGG + Intronic
1182373589 22:29829677-29829699 CGACAGAGCAAGACTCTGTCTGG + Intronic
1182479963 22:30601790-30601812 AAACAGAGCGAGACTGTGTCTGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182655889 22:31889567-31889589 CAACAGAGCGAGACTCTGTCTGG - Intronic
1182686566 22:32124795-32124817 CAATAGAGCAAGACTCTGTCTGG - Intergenic
1182979636 22:34656970-34656992 CAACAGAGTGAGACTCCTTCTGG - Intergenic
1183361954 22:37387455-37387477 CTACAGAGGGGGAAGGTGTCAGG - Intronic
1183444039 22:37841060-37841082 CAACAAAGTGAGACTGTCTCAGG + Intronic
1183647720 22:39136068-39136090 CGACAGAGCGAGACTCTGTCTGG + Intronic
1183845922 22:40539927-40539949 CAACAGAGTGAGACCCTGTCTGG - Intronic
1183879887 22:40818684-40818706 CAACAGAGCAAGACCCTGTCCGG + Intronic
1183945585 22:41324048-41324070 CGACACAGCGAGACTCTGTCTGG + Intronic
1184200351 22:42964396-42964418 CGACAGAGCGAGACTCCGTCTGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184450728 22:44580993-44581015 CCACACAGGGACTCTGTGTCAGG - Intergenic
1184513904 22:44948669-44948691 TGACAGAGTGAGACTCTGTCTGG + Intronic
1184977954 22:48076418-48076440 CAAGAGAGGAAGGCTGAGTCCGG - Intergenic
1185220228 22:49625823-49625845 CAAAAGAGAGAGACTGGGCCAGG + Intronic
949152881 3:791680-791702 TGACAGAGTGAGACTCTGTCTGG + Intergenic
949183721 3:1165987-1166009 CAAGAGAGGGAGACTTTCTGTGG - Intronic
949268650 3:2188823-2188845 AAACAAAGGGAGACTCTGTTGGG + Intronic
949836851 3:8279263-8279285 GAAAAGAGGGAGACCGTGTAAGG + Intergenic
950001387 3:9659208-9659230 CAACAGAGGAAGACCTTGTTGGG + Intronic
950211015 3:11123357-11123379 CAACAGAGCAAGACCCTGTCTGG + Intergenic
950308718 3:11937180-11937202 CAACAGAATGAGACCCTGTCTGG - Intergenic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
951877338 3:27441732-27441754 CAACACTGGGAGACTGAGGCAGG - Intronic
952255054 3:31687823-31687845 CAACAGTGGGAGGCTGAGGCAGG + Intronic
952303341 3:32124083-32124105 CTACAGAGGAAGACTCTGTCTGG - Intronic
952768727 3:36977725-36977747 TGACAGAGGGAGACCCTGTCAGG + Intergenic
952792951 3:37214760-37214782 TAACAGAGTGAGACCCTGTCTGG + Intergenic
953306680 3:41837581-41837603 TGACAGAGTGAGACTCTGTCTGG - Intronic
953365800 3:42343875-42343897 CAACAGAGCGAGACTCTGTCTGG - Intergenic
953552639 3:43915929-43915951 CAACGGAGCAAGACTCTGTCTGG - Intergenic
953673899 3:44985308-44985330 CAAGATAGGGATATTGTGTCTGG + Intronic
954058602 3:48049916-48049938 CAACAGAGTGAGACTTCGTCTGG + Intronic
954070877 3:48142075-48142097 CGACAAAGCGAGACTCTGTCTGG - Intergenic
954349357 3:50030007-50030029 CAACAGAGTGAGACTTTGGGAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954526007 3:51271829-51271851 CAACAGAGCGAGACTGTCTCAGG + Intronic
954678712 3:52329803-52329825 CAACAGAGTGAGACTCCATCTGG + Intronic
954685868 3:52369870-52369892 CCACAGCGGGAGACTGTAGCTGG - Exonic
955328406 3:58027170-58027192 TGACAGAGGGAGACCCTGTCTGG - Intronic
955361060 3:58275347-58275369 TGACAGAGTGAGACTCTGTCTGG - Intronic
955391835 3:58527514-58527536 TGACAGAGTGAGACTGTCTCAGG + Intronic
956101736 3:65775427-65775449 CAACAGAGTGAGACCTTCTCTGG + Intronic
956651177 3:71505965-71505987 CCAGAGAGGCAGACTGTGCCTGG - Intronic
956863453 3:73347269-73347291 TGACAGAGCGAGACTCTGTCAGG - Intergenic
957305343 3:78450831-78450853 CAAGAGAGGGAGAAGGTGTCAGG + Intergenic
957701948 3:83726399-83726421 CAGGAGAGGGGGACTATGTCTGG + Intergenic
958058914 3:88452055-88452077 CAACAGTGGGATACTGTGAGAGG + Intergenic
958608675 3:96395080-96395102 TGACAGAGTGAGACTCTGTCTGG - Intergenic
958930361 3:100201447-100201469 CGACAGAGCAAGACTCTGTCTGG - Intergenic
959332829 3:105027419-105027441 CAACAGAGTGAGACTCTATCTGG - Intergenic
959374005 3:105565008-105565030 CAACAGAGCAAGACTCTGTCTGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959502942 3:107127360-107127382 CAACAGAGTGAGGTTGTTTCTGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960895500 3:122500513-122500535 CAACAGAGAGAGAGAGTATCTGG - Intronic
961186686 3:124921167-124921189 CAACAGAGTGAGACTCTGCCTGG - Intronic
961472160 3:127122294-127122316 CAAAGGAGGGAGATTGTTTCAGG - Intergenic
961952414 3:130763272-130763294 ACACAGAGGGAGACTCTGTTAGG + Intergenic
962425232 3:135263553-135263575 CAAAAGAGGAAGGGTGTGTCTGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963810162 3:149768559-149768581 CAACAGAGCAAGACTCTGTCTGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964113216 3:153108321-153108343 CAACAGAGTGAGACTCCGTCTGG + Intergenic
964356506 3:155855886-155855908 CGACAGAGTGAGACTCCGTCTGG + Intergenic
964573583 3:158139384-158139406 CAACAGAGCAAGACTTAGTCTGG + Intronic
964609906 3:158601734-158601756 CAAAAGAGCAAGACTGTGTTGGG + Intronic
965078442 3:164006928-164006950 CAATACAGCGAGACTGTCTCAGG + Intergenic
965701052 3:171459890-171459912 CAGCAGCGGGAGAATGCGTCGGG - Intronic
965724613 3:171700971-171700993 CAGCAGAGGTAGACTATGTCAGG + Intronic
965770175 3:172173798-172173820 CAACAGAGCAAGACCCTGTCTGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966872047 3:184297112-184297134 CGACAGAGCGAGACTCCGTCTGG + Intronic
967029245 3:185590527-185590549 CGACAGAGCAGGACTGTGTCAGG + Intronic
967423970 3:189304889-189304911 AAACAGAGGGAGGCTGTGAGTGG - Intronic
967718576 3:192790727-192790749 CAATATAAGGAGACTGGGTCTGG + Intergenic
968036346 3:195551333-195551355 CAATAGAGTGAGACTCAGTCTGG + Intergenic
968130163 3:196188557-196188579 CAACAGAGTGAGACTCCATCTGG - Intergenic
968181878 3:196601396-196601418 CCTCAGTGTGAGACTGTGTCTGG + Intergenic
968326213 3:197819104-197819126 CAACAGAGTGAGATTCCGTCTGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969112016 4:4850150-4850172 CAACAGAGTGAGACCCTGTCTGG + Intergenic
969397539 4:6932349-6932371 CGACAGAGCAAGACTCTGTCTGG + Intronic
969521548 4:7680723-7680745 CAACACAGGCAGACAGAGTCAGG - Intronic
969595270 4:8145201-8145223 CGACAGAGCGAGACTCTGTCTGG - Intronic
969656270 4:8500474-8500496 CAACAGAGCGAGACTCCCTCTGG + Intergenic
970081997 4:12298022-12298044 CAACAGAGTGAGACTGTCTCAGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971722236 4:30260228-30260250 CAGCAGAGAAAGACAGTGTCAGG + Intergenic
971753285 4:30678187-30678209 CAGCAGAGGGAGCCTGGGCCCGG - Intergenic
971849191 4:31961328-31961350 CCACAGAGTGAGACTCTGTCTGG - Intergenic
972090049 4:35270016-35270038 CAATAGAGTGAGACCTTGTCTGG - Intergenic
972425189 4:38926472-38926494 CAACAGAATGAGACTCTATCTGG - Intronic
972531182 4:39962774-39962796 CAACAGAGCGAGACTCCGTCTGG + Intronic
972646606 4:40973869-40973891 CGACAGAGTGAGACTCTGTCTGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973015768 4:45135117-45135139 CAGCAGAGGGAGCCTGGGCCTGG + Intergenic
973606143 4:52589438-52589460 CATCAGAGGGCGGCTGTCTCAGG + Intergenic
973677545 4:53280494-53280516 CGACAGAGGGAAACTCTGTCTGG + Intronic
974148416 4:57974513-57974535 CGACAGAGCGAGACTCTGTCTGG - Intergenic
974393111 4:61299272-61299294 CATCATAGTGAGGCTGTGTCAGG + Intronic
975068513 4:70100924-70100946 CGACAGAGCGAGACTCTGTCTGG + Intergenic
975572549 4:75832665-75832687 TGACAGAGCAAGACTGTGTCTGG + Intergenic
975581704 4:75912532-75912554 TGACAGAGGGAGACTCTGTCTGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976155149 4:82136060-82136082 TGACAGAGTGAGACTCTGTCTGG + Intergenic
976608170 4:87002121-87002143 CAACAGAGCAAGACCGTCTCTGG - Intronic
976664666 4:87577698-87577720 CAACAGAGCAAGACTCTGTCTGG - Intergenic
976753288 4:88472105-88472127 CCACAGAGGGAGGCTGAGACAGG - Intronic
977697812 4:99986153-99986175 CAACAGAGTGAGACTCTGTCTGG + Intergenic
977854814 4:101876352-101876374 GAACAGAGGGAGGCTTTGTTTGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
979079189 4:116312416-116312438 CAACAGAGGGACCCTGGGCCTGG + Intergenic
979177105 4:117679107-117679129 CAACAGAGGGATCCTGGGTCCGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979319079 4:119301405-119301427 CAACAGAGCGAGACTCCATCTGG + Intronic
979854973 4:125621203-125621225 CCACAGAGTAAGACTGTATCTGG + Intergenic
980677613 4:136109554-136109576 TGACAGAGGGAGTCTCTGTCTGG - Intergenic
980773088 4:137404316-137404338 CAACAGAGCGAAACTCCGTCTGG - Intergenic
980773509 4:137409539-137409561 TGACAGAGCGAGACTCTGTCTGG - Intergenic
981025798 4:140076050-140076072 CAACATAGGGAGGCTGGGTGTGG - Intronic
981130476 4:141153269-141153291 CCACAGATGGTGACTGTGTTTGG + Intronic
981194775 4:141906147-141906169 TGACAGAGTGAGACTGTCTCAGG - Intergenic
981570614 4:146147030-146147052 CAACAGAGGGATTCTGAGTTAGG + Intergenic
981759516 4:148178309-148178331 CAACAGAGTGAGACTCTGTCTGG + Intronic
981806762 4:148724994-148725016 CAACATAGGGAGACCCCGTCTGG - Intergenic
981923473 4:150112828-150112850 CAACAGAAAAAGACTCTGTCCGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982328662 4:154157199-154157221 CAACAGAGTGAGACCATCTCCGG - Intergenic
982453410 4:155578777-155578799 CTACAGAGTGAGACTCTGTCTGG + Intergenic
983467423 4:168112276-168112298 CAGCAGAGCAAGACTCTGTCTGG + Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983780667 4:171666402-171666424 CAACAGAGTGACACCCTGTCTGG + Intergenic
984280798 4:177667881-177667903 CGACAGAGGGAGACAGAGCCGGG + Intergenic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984950999 4:185007735-185007757 CAACAGAGCAAGACTCCGTCTGG - Intergenic
985226608 4:187768140-187768162 CAGCAGAGTGAGACTTCGTCTGG - Intergenic
985304279 4:188521858-188521880 CAACACAGGGATCCTGGGTCTGG - Intergenic
986362935 5:6999214-6999236 CAACATAGTAGGACTGTGTCCGG - Intergenic
986631052 5:9774780-9774802 GCACAGAGAGAGACTTTGTCTGG - Intergenic
986730806 5:10633490-10633512 CAACAGAGGGAACCAGTGTGAGG - Intronic
986874668 5:12093730-12093752 CAACAGAGTGAAACTCTGTTGGG + Intergenic
987071424 5:14340375-14340397 CAACAGAGCAAGACTCCGTCTGG + Intronic
987328634 5:16835155-16835177 CGACAGAGTGAGACTGTCTCGGG + Intronic
987376507 5:17240236-17240258 CAACAGAGTGAGGCTCTGGCCGG + Intronic
987586570 5:19863788-19863810 CAACATAGGGAGGCTGTGAGAGG + Intronic
987675720 5:21070418-21070440 CAAAAGGGAGAGACTGTGTCAGG - Intergenic
987711782 5:21510293-21510315 CAAGAGAGAGAGAGTGTGTTGGG + Intergenic
987916601 5:24223293-24223315 CACTAGAGCGAGACTCTGTCTGG - Intergenic
988302630 5:29450487-29450509 CAAGAGAGAGAGAGTGTGTTGGG - Intergenic
988502761 5:31797431-31797453 CAACAGAGTGAAACCCTGTCTGG + Intronic
989017502 5:36956208-36956230 CAACAGAGTAAGACTCCGTCTGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990173900 5:53085926-53085948 CAACAGAGCAAGGCTCTGTCTGG - Intronic
990225011 5:53640566-53640588 CAAGAGAGAGAGAATGTGTCAGG + Intronic
991058623 5:62346718-62346740 TAACAGAGCGAGACTGTCTCAGG + Intronic
991193341 5:63902082-63902104 TGACAGAGGGAGACTCTGTCTGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991676307 5:69092848-69092870 CAACAGAGCAAGACCGTCTCTGG - Intergenic
991762149 5:69929435-69929457 CAAGAGAGAGAGAGTGTGTTGGG + Intergenic
991785179 5:70188665-70188687 CAAGAGAGAGAGAGTGTGTTGGG - Intergenic
991841377 5:70804484-70804506 CAAGAGAGAGAGAGTGTGTTGGG + Intergenic
992199380 5:74368766-74368788 TGACAGAGTGAGACTCTGTCTGG - Intergenic
992436593 5:76760705-76760727 CAACAGAGCAAGATTCTGTCTGG + Intergenic
992739112 5:79755304-79755326 CGACAGAGTGAGACTCTGTGTGG - Intronic
992810024 5:80377374-80377396 CAACACAGCAAGACTCTGTCTGG + Intergenic
994196822 5:96931174-96931196 CAACAGAGTGAGATCCTGTCTGG - Intronic
994301593 5:98154517-98154539 CAACAGAGCAAGACTCTGACTGG + Intergenic
994542834 5:101121676-101121698 CAGCAGAGGGATCCTGGGTCTGG + Intergenic
994812299 5:104536255-104536277 CAATAGAAGGAGAATGTGCCTGG - Intergenic
995522320 5:113021346-113021368 GAACAGAGCAAGACTCTGTCTGG + Intergenic
995864710 5:116678770-116678792 CAACAGAGAGAGACTCTGTCTGG - Intergenic
996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG + Intergenic
997348562 5:133212123-133212145 CAGTAGAGGAAGACAGTGTCAGG - Intronic
997671598 5:135679287-135679309 CAACAGAGGTAAACTGGGCCGGG + Intergenic
997958463 5:138299171-138299193 TTACAGAGGGAGACTCTGTCTGG + Intronic
998225487 5:140323284-140323306 GAGCAGAGGGAGGCAGTGTCAGG + Intergenic
998659166 5:144216822-144216844 CCACAGAGGGAGACTCTGTCTGG + Intronic
998709367 5:144805108-144805130 TGACAGAGTGAGACTGTCTCAGG + Intergenic
998725338 5:145006521-145006543 CAACAGAGCGAGATGCTGTCTGG - Intergenic
998827249 5:146115021-146115043 CAACAGAGCAAGATTCTGTCGGG + Intronic
998835399 5:146198200-146198222 CAACAGAGCAAGACTCTTTCGGG - Intergenic
999813347 5:155150087-155150109 CAAGAGAGGGAGGAAGTGTCAGG + Intergenic
1000029718 5:157391090-157391112 CAGGAGAGGGAGGCTGTGTCTGG + Intronic
1000059920 5:157645640-157645662 CAACAGAGTGAGACCCTGTCTGG + Intronic
1002308991 5:178303018-178303040 CAACAGAGCTAGACTCTGTCAGG - Intronic
1002320487 5:178372590-178372612 CAATAGAGAGAGACTTTGTCTGG - Intronic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002490333 5:179571482-179571504 CAACAGAGCCAGACTCTGTCTGG + Intronic
1002772096 6:298742-298764 CCACAGAGGAAGACGGTCTCTGG - Intronic
1002807367 6:590093-590115 CGACAAAGCGAGACTCTGTCTGG + Intronic
1003577051 6:7306895-7306917 CGACAGAGCGAGACTCTGTCTGG + Intronic
1003595710 6:7472442-7472464 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1003652379 6:7973332-7973354 CGACAGAGCAAGACTCTGTCTGG - Intronic
1003885988 6:10521917-10521939 TGACAGAGTGAGACTATGTCTGG - Intronic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1004149936 6:13107135-13107157 CAACAGAGCAAGAGTCTGTCTGG - Intronic
1004415814 6:15423244-15423266 CAACAATGGGAGGCTGAGTCAGG - Intronic
1004476078 6:15973510-15973532 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1005400685 6:25430447-25430469 CAACAGTGCGAGACCCTGTCTGG - Intronic
1005515103 6:26547254-26547276 AGACAGAGTGAGACTCTGTCTGG - Intergenic
1005547013 6:26882361-26882383 CAACAGAACAAGACTCTGTCAGG + Intergenic
1005570862 6:27144440-27144462 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1005919321 6:30385182-30385204 CAACAGAGTGAGACTTCATCTGG + Intergenic
1006584099 6:35094418-35094440 CAAAAGAGTGAGACTTCGTCTGG + Intergenic
1006829047 6:36957939-36957961 CAACAGTGGGAGACTGGGAGTGG - Intronic
1006885621 6:37379931-37379953 CGACAGAGTGAGACACTGTCTGG - Intronic
1007471004 6:42090346-42090368 CAACAGAGTGAGACTTCATCTGG + Intergenic
1007611554 6:43152505-43152527 CGACAGAGTGAGACTCCGTCTGG + Intronic
1007792582 6:44320127-44320149 CAACAGAGCGAGACTCTGTCTGG + Intronic
1008132766 6:47737747-47737769 CGACAGAGCAAGACTCTGTCTGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008826530 6:55701454-55701476 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1009907217 6:69884874-69884896 CAACAGAGCGAGACTCAGTCTGG - Intronic
1011075508 6:83434323-83434345 CAACAGCGTGAGACTCTGTTGGG - Intergenic
1011219446 6:85038297-85038319 GAACAGGGGAAGACTGTGCCAGG - Intergenic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1012192432 6:96297051-96297073 CAGAAGAGGGAGACTGTGAGGGG + Intergenic
1012261350 6:97091187-97091209 CAATAGAGCGAGACCCTGTCTGG + Intronic
1012555161 6:100502523-100502545 AAACAGAGCAAGACTCTGTCTGG + Intergenic
1013052921 6:106554590-106554612 CAACAGAGCAAGACTGTCTCAGG + Intronic
1013266247 6:108502044-108502066 CAACAGAGTGAGACTCTGTCTGG - Intronic
1013931124 6:115534392-115534414 CAACAGAGTGAGACCCCGTCTGG - Intergenic
1013938510 6:115630817-115630839 CAGCAGAGGAAGCCTGTGTATGG + Intergenic
1014319710 6:119911771-119911793 TGACAGAGCGAGACTCTGTCTGG + Intergenic
1015338889 6:132074789-132074811 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1015764361 6:136700052-136700074 TGACAGAGCGAGACTCTGTCAGG + Intronic
1015950417 6:138547398-138547420 CAACAGAGTGAGACCCTCTCAGG - Intronic
1016827364 6:148400729-148400751 CGACAGAGTGAGACTTTGTCTGG + Intronic
1017290336 6:152728142-152728164 CAACAGAGTGAGCCTCTGTCTGG + Intergenic
1017471713 6:154744270-154744292 CAACAGAGCAAGACTCTGGCTGG + Intronic
1018359959 6:163057433-163057455 TGACAGAGTGAGACTCTGTCTGG - Intronic
1018656404 6:166041354-166041376 CCAGAGAGGAAGAGTGTGTCTGG - Intergenic
1018693601 6:166370809-166370831 CAACAGAGCAAGACCCTGTCTGG + Intronic
1019424919 7:970152-970174 CAATAGAGCGAGACTGTTTCTGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019919076 7:4151287-4151309 CTGCAGAGGGTGACTGTGCCAGG - Intronic
1020095240 7:5364782-5364804 CAACAGAGGGAGGCTGTCTCAGG + Intronic
1020185065 7:5952757-5952779 CAACAGAGAAAGACTCCGTCTGG - Intronic
1020213923 7:6174565-6174587 CAGCAGAGCGAGACTCTGTCTGG - Intronic
1020628348 7:10610560-10610582 CAACAGAGCGAGACTGCGTCTGG - Intergenic
1020995398 7:15257256-15257278 CAACATAGGAAGACTATCTCAGG + Intronic
1021703209 7:23340867-23340889 CGACAGAGCGAAACTCTGTCTGG - Intronic
1021712900 7:23434056-23434078 AGACAGAGTGAGACTCTGTCTGG + Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022419308 7:30205815-30205837 TAACATAGGGAGAATGTGTTGGG + Intergenic
1022549969 7:31229001-31229023 CAACAGAGGTAGACTGGGCGGGG + Intergenic
1023387592 7:39675711-39675733 CAACAGAGTGAGACCATGTCTGG + Intronic
1023476729 7:40587920-40587942 CGGCAGAGTGAGACTCTGTCTGG - Intronic
1023975983 7:45030454-45030476 AAACAGAGTGAGACCCTGTCTGG - Intronic
1024257188 7:47547918-47547940 CGACAGAGTGAGACTCCGTCAGG - Intronic
1024350834 7:48361074-48361096 CAACAGAGTGAGACCCTGTTTGG + Intronic
1024625289 7:51203019-51203041 TGACAGAGCGAGACTCTGTCTGG + Intronic
1025241354 7:57278827-57278849 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1025751051 7:64294191-64294213 TGACAGAGCAAGACTGTGTCTGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026004024 7:66586734-66586756 CGACAGAGTGAGACTCAGTCTGG - Intergenic
1026047677 7:66918689-66918711 CAACAGTGGGAGGCTGAGGCAGG - Intergenic
1026460466 7:70610453-70610475 CAACAGAATGAGACTCTGTCAGG - Intronic
1026472946 7:70709690-70709712 CAACAGAGCAAGATTCTGTCTGG + Intronic
1026629562 7:72026563-72026585 CGACAGAGCAAGACTCTGTCTGG + Intronic
1026771976 7:73208003-73208025 CAACAGAGCAAGACTGTCTCAGG - Intergenic
1026835656 7:73637453-73637475 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1026956466 7:74379307-74379329 CAACAGAGGGAGACTCCGTCTGG + Intronic
1027012844 7:74761395-74761417 CAACAGAGCAAGACTGTCTCAGG - Intergenic
1027075196 7:75184653-75184675 CAACAGAGCAAGACTGTCTCAGG + Intergenic
1027198895 7:76050049-76050071 CAACAGAGTGGGACTCTGTCAGG - Intronic
1027222192 7:76221075-76221097 CAACAAAGTGAGACCTTGTCTGG - Intronic
1027225946 7:76243749-76243771 CCACAGAGGGAGACAGAGACTGG - Intronic
1027478409 7:78663224-78663246 CGAGAGAGTGAGACTGTGTCTGG - Intronic
1027800456 7:82743730-82743752 CAACAGAACAAGACTCTGTCTGG + Intergenic
1028038705 7:86019616-86019638 AGACAGAGTGAGACTCTGTCTGG + Intergenic
1028397619 7:90389405-90389427 CAAGAGAGCGAGACTCCGTCTGG - Exonic
1028716575 7:93978089-93978111 CAACAGAGTGACACCCTGTCTGG - Intronic
1029030498 7:97461530-97461552 CAACGGAGTGAGACTCTGTCTGG + Intergenic
1029134752 7:98361335-98361357 CGACAGAGCAAGACTCTGTCTGG + Intronic
1029161594 7:98556223-98556245 CAACAGAGACAGACTGTTTCAGG + Intergenic
1029625829 7:101719591-101719613 TGACAGAGTGAGACTTTGTCTGG - Intergenic
1029733648 7:102453746-102453768 CGACAGAGTGAGACTCTATCTGG - Exonic
1029802541 7:102964420-102964442 CAACAGAGAGAGACTCAGTCTGG - Intronic
1030652169 7:112128007-112128029 CAACAGAGCGAGACTCTGTCGGG + Intronic
1032164433 7:129534279-129534301 CGACAGAGCGAGACTCCGTCTGG - Intergenic
1032248509 7:130233024-130233046 CAACAGAGTGAGACTCCATCTGG - Intergenic
1033114804 7:138615773-138615795 CGACAGAGTGAGACTCCGTCTGG + Intronic
1033138622 7:138805373-138805395 CAACAAAGTGAGACCCTGTCTGG + Exonic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033507942 7:142024392-142024414 CGACAGAGTGAGACCCTGTCTGG + Intronic
1033541146 7:142357247-142357269 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1034086748 7:148328954-148328976 CGACAGAGCAAGACTCTGTCTGG + Intronic
1034105831 7:148488984-148489006 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1034179888 7:149128819-149128841 CAACAGAGCAAGACTACGTCTGG - Intronic
1034399667 7:150854000-150854022 CTACAGAGCAAGACTGTCTCAGG + Intronic
1034482529 7:151333595-151333617 CAACAGAGTGAGACCTTGTCCGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035005983 7:155661425-155661447 CCACAGAGCAAGACTCTGTCTGG - Intronic
1035772412 8:2158389-2158411 CAACAGAGCGAGAATCTGTCAGG - Intronic
1036003869 8:4639284-4639306 CATCAGAGGCAGACTGTTACAGG - Intronic
1036404884 8:8445906-8445928 CGACAGAGTGAGACCCTGTCTGG + Intergenic
1037174645 8:15932598-15932620 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1037317119 8:17609453-17609475 CGACAGAGCGAGACTCTGTCTGG + Intronic
1037847322 8:22295057-22295079 CAACAGAGCGAGACTTCGTCTGG + Intronic
1037856750 8:22376856-22376878 CAACAGAGTGAGACAATGTCTGG + Intronic
1037942236 8:22960336-22960358 CAACAGAGCAAGACTCTGTCAGG - Intronic
1038095105 8:24300434-24300456 CGACAGAGCGAGACTCTGTCTGG - Intronic
1038136288 8:24789928-24789950 CAACAGAGTGAGACTCTGACTGG - Intergenic
1038281216 8:26166806-26166828 TAACAGAGTGAGACCCTGTCTGG + Intergenic
1038507895 8:28101607-28101629 CAACAGAACAAGACTGTCTCAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039105745 8:33987545-33987567 CAAGAGATGTTGACTGTGTCAGG + Intergenic
1039231533 8:35454104-35454126 CAAAAGAGGGAAAGTCTGTCAGG - Intronic
1039372789 8:37003519-37003541 CAATGCAGGGAGACTGTGTTGGG - Intergenic
1039430964 8:37524766-37524788 CACCAGGGAGTGACTGTGTCCGG - Intergenic
1039991909 8:42495767-42495789 CAACAGAACAAGACTCTGTCTGG - Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041075713 8:54167751-54167773 CAACAGAGCTAGACTCTCTCTGG + Intergenic
1041174181 8:55177054-55177076 TAACAGAGCAAGACTCTGTCTGG - Intronic
1042557393 8:70044803-70044825 CAACAGAGCCAGACTCCGTCTGG - Intergenic
1042562594 8:70084209-70084231 AGACAGAGTGAGACTCTGTCTGG - Intergenic
1042657431 8:71115328-71115350 CATCAGGAGGAGACTGTATCAGG + Intergenic
1043110567 8:76175087-76175109 CAACAGAGCGAGACTCTTTCTGG - Intergenic
1043352317 8:79376373-79376395 CAGGAGATGGAGACTGTGTCCGG + Intergenic
1043413453 8:80024207-80024229 CAACAGAGCAAGACCCTGTCTGG + Intronic
1043461697 8:80466777-80466799 TGACAGAGCGAGACTGTCTCAGG + Intergenic
1043653832 8:82635671-82635693 TGACAGAGGGAGACTCTGTCTGG + Intergenic
1043673916 8:82925369-82925391 CGACAGAGAGAGACTCAGTCTGG - Intergenic
1044434921 8:92150806-92150828 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1044777584 8:95707951-95707973 CAATAGAGGGAGTCTATTTCTGG + Intergenic
1044778622 8:95720840-95720862 CAACAGAGTGAGACTCTGCCAGG - Intergenic
1044973152 8:97639317-97639339 CGACAGAGTGAGACCTTGTCTGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045764027 8:105646029-105646051 CAACAGAGTGAGACTCCATCTGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047281048 8:123446011-123446033 TGACAGAGTGAGACTCTGTCTGG - Intronic
1047412704 8:124637313-124637335 CTAGAGAGGGAGACAGAGTCAGG + Intronic
1047523888 8:125616163-125616185 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1048337487 8:133513877-133513899 TAACAGAGCAAGACTCTGTCTGG + Intronic
1049498203 8:142946610-142946632 CCTCCGAGTGAGACTGTGTCTGG - Intergenic
1049824243 8:144657438-144657460 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1050562504 9:6848647-6848669 CGACAGAGTGAGACTGTCTCAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050573294 9:6964932-6964954 CTACAGAGTGAGACTTCGTCGGG + Intronic
1051414490 9:16824734-16824756 CCACAGAGGGAACCTGTTTCAGG + Intronic
1051650941 9:19323408-19323430 CGACAGAGCTAGACTCTGTCTGG + Intronic
1051936529 9:22448126-22448148 CAACAGAGTGAGATCCTGTCTGG - Intronic
1052116861 9:24659645-24659667 CAACTCAGGGAGGCTGTGTGGGG + Intergenic
1053139513 9:35673976-35673998 CAACAGAGGGAGCCAGGGGCTGG - Exonic
1053321060 9:37099225-37099247 GGACAGAGTGAAACTGTGTCTGG - Intergenic
1053358609 9:37466906-37466928 CAACAGAGTGAGATTTCGTCTGG + Intergenic
1054257980 9:62834072-62834094 CAGCAGAGGAAGACTGGGGCAGG - Intergenic
1055191232 9:73527409-73527431 CAACAGAGTGAGACCCTGTCTGG - Intergenic
1055214398 9:73840820-73840842 CGACAGAACGAGACTCTGTCTGG + Intergenic
1055574001 9:77644852-77644874 CAGCATAGGGAGAAAGTGTCAGG - Intronic
1056165018 9:83932604-83932626 CAACAGAAGGAGACTCTGTCTGG + Intergenic
1056256996 9:84809860-84809882 CAACAGAGCAATACTCTGTCTGG + Intronic
1056394607 9:86170094-86170116 CGACAGAGTGAGACTCTGCCTGG - Intergenic
1056537393 9:87541527-87541549 CAACAGAGCAAGACTCTGTCTGG + Intronic
1056637224 9:88341343-88341365 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1056987991 9:91382341-91382363 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1057308510 9:93926575-93926597 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1057352155 9:94308030-94308052 CAACAAAGGGAAACTGGGCCGGG + Intergenic
1057432810 9:95010350-95010372 CAACAGATGGTGACTGTGGTAGG + Intronic
1057465986 9:95315243-95315265 CAGCAGACTGAGACCGTGTCTGG - Intronic
1057523083 9:95775550-95775572 CAGCAGAGGAAGACAGTGTTGGG + Intergenic
1057620465 9:96630111-96630133 CCACAGAGTGAGACTCTATCGGG + Intergenic
1057655487 9:96948060-96948082 CAACAAAGGGAAACTGGGCCGGG - Intronic
1057684939 9:97222708-97222730 CAGCAGAGGAAGACCGGGTCAGG - Intergenic
1058458057 9:105156530-105156552 CAACAGAGTGAGACTCCATCTGG + Intergenic
1058759979 9:108121056-108121078 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1058891681 9:109366456-109366478 CAACAGAGCCAGACCCTGTCTGG - Intergenic
1059079612 9:111234183-111234205 CAACAGAGTGAGACCCTATCAGG + Intergenic
1059262112 9:112987733-112987755 TAACAGAGCAAGACTCTGTCTGG - Intergenic
1060470503 9:123944107-123944129 CAACAGAGCAAGACTGTGTCAGG + Intergenic
1060648282 9:125301466-125301488 CAACAAAGCAAGACTCTGTCTGG - Intronic
1060775431 9:126370400-126370422 CAACAGAACGAGACTCTGTCTGG - Intronic
1060841634 9:126798228-126798250 CCACAGAGCAAGACTGTCTCGGG - Intergenic
1061334568 9:129923556-129923578 TGACAGAGCGAGACTCTGTCTGG + Intronic
1061556414 9:131372736-131372758 CGACAGAGCGAGACTCCGTCTGG - Intergenic
1061568922 9:131463959-131463981 CAACAGAGCGAGACTCCATCTGG - Intronic
1062029599 9:134356217-134356239 CAAGGGAGGGGAACTGTGTCAGG + Intronic
1062515336 9:136931234-136931256 CAACAGAGAGACCCTGTCTCCGG - Intronic
1062593490 9:137286419-137286441 CAACCGAGTGAAACTCTGTCTGG - Intergenic
1062676034 9:137744564-137744586 CAACACTGGGAGACTGAGGCGGG - Intronic
1062719476 9:138029628-138029650 CGACAGAGCGAGACCCTGTCTGG - Intronic
1202800793 9_KI270719v1_random:174308-174330 CAGCAGAGGAAGACTGGGGCAGG + Intergenic
1185602363 X:1349025-1349047 CAACAGAGCAAGACCGTGTCAGG - Intronic
1185687155 X:1938755-1938777 CAAGAGAGAGAGAGTGTGTGTGG - Intergenic
1185713632 X:2324035-2324057 TAACAGATGGAGACCCTGTCTGG + Intronic
1185767703 X:2739066-2739088 CAACATAGTGAGACCCTGTCTGG - Intronic
1186829384 X:13375707-13375729 CAACAGAGCGGGACCCTGTCTGG - Intergenic
1186873426 X:13794202-13794224 TAACAGAGTGAGATTGTATCTGG - Intronic
1187134528 X:16534322-16534344 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1187315246 X:18186945-18186967 CAACAGAGCAAGACCCTGTCTGG + Intronic
1187390219 X:18881388-18881410 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1187707222 X:22020755-22020777 TGACAAAGTGAGACTGTGTCAGG - Intergenic
1187717128 X:22113967-22113989 CAATAGAGTGAGACTCTGTCTGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188721412 X:33527955-33527977 ACACAGAGAGAGACTCTGTCTGG - Intergenic
1189365553 X:40385196-40385218 AAACAGTGGGAGACTCTTTCTGG + Intergenic
1189464782 X:41270088-41270110 CGACAGAGTGAGACCCTGTCCGG - Intergenic
1189828394 X:44944330-44944352 CAACAGAGTGAAACTCTGTTAGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190023767 X:46903665-46903687 CAGCAGAGTGAGACTGAGTAGGG + Intergenic
1190076075 X:47318087-47318109 CAACACAGGGAGGCTGAGACGGG + Intergenic
1190178069 X:48167747-48167769 CACCAGAGGGAGAAGGTGCCAGG + Intergenic
1190180080 X:48184680-48184702 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190184034 X:48219391-48219413 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190189961 X:48268840-48268862 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190193097 X:48293900-48293922 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190197188 X:48329533-48329555 CACCAGAGGGAGAGGGTGCCAGG + Intergenic
1190199070 X:48344879-48344901 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190204895 X:48394778-48394800 CACCAGAGGGAGAGGGTGCCTGG + Intergenic
1190205641 X:48400625-48400647 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190290958 X:48991854-48991876 CAACAGAGCAAGACTGTCTAGGG - Intronic
1190341651 X:49301609-49301631 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1190489718 X:50969541-50969563 CAACATAGCGAGACTGTGGCAGG - Intergenic
1190642521 X:52494667-52494689 CAACAGAGTGACACTCTGTCTGG + Intergenic
1190645152 X:52518200-52518222 CAACAGAGTGACACTCTGTCTGG - Intronic
1190659602 X:52642513-52642535 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190663925 X:52679911-52679933 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190665829 X:52695349-52695371 CACCAGAGGGAGAGGGTGCCTGG - Intronic
1190673589 X:52763061-52763083 CACCAGAGGGAGAGGGTGCCTGG + Intronic
1190675497 X:52778511-52778533 CACCAGAGGGAGAGGGTGCCAGG - Intronic
1190774283 X:53540346-53540368 CGACAGAACGAGACTGTCTCAGG - Intronic
1190890587 X:54563764-54563786 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1192302334 X:69918174-69918196 TGACAGAGGAAGACTCTGTCTGG - Intronic
1192331176 X:70176487-70176509 CGACACAGTGAGACTCTGTCTGG + Intergenic
1192467872 X:71370364-71370386 TGACAGAGAGAGACTCTGTCAGG - Intronic
1192887112 X:75347485-75347507 CAACAGAGGGACCCTGGGCCCGG - Intergenic
1194715989 X:97287283-97287305 CAACAGAGTGAAACTCCGTCGGG + Intronic
1195865809 X:109431677-109431699 CGACAGAGCTAGACTCTGTCTGG + Intronic
1196421589 X:115527750-115527772 CAACAGAGCAAGACCATGTCTGG + Intergenic
1197731229 X:129812101-129812123 CAACAGAATGAGACTCTGTCTGG - Intronic
1197755265 X:129989484-129989506 CAACAGAGCTAGACTGTCTCCGG - Intronic
1197930282 X:131687698-131687720 CAACAGAGCGAGACTCCATCCGG - Intergenic
1198248155 X:134851514-134851536 CAACAGAGTAAGACTCTGTCTGG + Intronic
1198258160 X:134943219-134943241 CGACAGAGCGAGACTCCGTCTGG + Intergenic
1198375174 X:136031637-136031659 CAACAGAGCGAGACTCTGTCTGG + Intronic
1199274028 X:145921570-145921592 TAAAACAGGGAGACTGAGTCAGG - Intergenic
1199295928 X:146158497-146158519 CAACAGAGCGAGACTCCATCTGG + Intergenic
1200069929 X:153523713-153523735 TGACAGAGCGAGACTGTCTCAGG - Intronic
1200127415 X:153822696-153822718 CAATGGAGCCAGACTGTGTCTGG - Intronic
1201342207 Y:12946923-12946945 CAACAGAGTGAGACTCCATCTGG - Intergenic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic
1201564818 Y:15354866-15354888 CAATAGAGCGAGACTCTGCCCGG + Intergenic