ID: 1116919714

View in Genome Browser
Species Human (GRCh38)
Location 14:50560346-50560368
Sequence CCACAGAAGCAGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 10, 3: 88, 4: 570}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116919714_1116919726 19 Left 1116919714 14:50560346-50560368 CCCTCCACTTTCTGCTTCTGTGG 0: 1
1: 0
2: 10
3: 88
4: 570
Right 1116919726 14:50560388-50560410 CTGCTAGGTGCCTGCGTCCACGG 0: 1
1: 0
2: 1
3: 11
4: 110
1116919714_1116919722 -5 Left 1116919714 14:50560346-50560368 CCCTCCACTTTCTGCTTCTGTGG 0: 1
1: 0
2: 10
3: 88
4: 570
Right 1116919722 14:50560364-50560386 TGTGGAGACAGGGAGGGCCAAGG 0: 1
1: 0
2: 8
3: 76
4: 724
1116919714_1116919727 23 Left 1116919714 14:50560346-50560368 CCCTCCACTTTCTGCTTCTGTGG 0: 1
1: 0
2: 10
3: 88
4: 570
Right 1116919727 14:50560392-50560414 TAGGTGCCTGCGTCCACGGCTGG 0: 1
1: 0
2: 1
3: 224
4: 4466
1116919714_1116919728 24 Left 1116919714 14:50560346-50560368 CCCTCCACTTTCTGCTTCTGTGG 0: 1
1: 0
2: 10
3: 88
4: 570
Right 1116919728 14:50560393-50560415 AGGTGCCTGCGTCCACGGCTGGG 0: 1
1: 0
2: 3
3: 41
4: 301
1116919714_1116919723 -4 Left 1116919714 14:50560346-50560368 CCCTCCACTTTCTGCTTCTGTGG 0: 1
1: 0
2: 10
3: 88
4: 570
Right 1116919723 14:50560365-50560387 GTGGAGACAGGGAGGGCCAAGGG 0: 1
1: 0
2: 4
3: 65
4: 504
1116919714_1116919724 4 Left 1116919714 14:50560346-50560368 CCCTCCACTTTCTGCTTCTGTGG 0: 1
1: 0
2: 10
3: 88
4: 570
Right 1116919724 14:50560373-50560395 AGGGAGGGCCAAGGGCTGCTAGG 0: 1
1: 0
2: 6
3: 60
4: 514
1116919714_1116919730 30 Left 1116919714 14:50560346-50560368 CCCTCCACTTTCTGCTTCTGTGG 0: 1
1: 0
2: 10
3: 88
4: 570
Right 1116919730 14:50560399-50560421 CTGCGTCCACGGCTGGGAGACGG 0: 1
1: 0
2: 0
3: 19
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116919714 Original CRISPR CCACAGAAGCAGAAAGTGGA GGG (reversed) Intronic
900317167 1:2062960-2062982 TCACAGAAACAGAAAGCGGCGGG - Intronic
900352898 1:2245120-2245142 TCACAGAAACAGAAAGCGGCGGG - Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901186736 1:7378553-7378575 CCACAGACACAGAAAGCGGGTGG + Intronic
901219596 1:7575888-7575910 CCAGGGAAGCAGGAACTGGAGGG - Intronic
902643410 1:17781093-17781115 CCCCAGAAGCTGGAAGAGGAAGG - Intronic
902819321 1:18933957-18933979 CCACAGAGACAGAAAGTAGAAGG - Intronic
903020992 1:20394179-20394201 CTACAAAAGGAGAAAGAGGATGG + Intergenic
903479335 1:23641704-23641726 AGACAGAAGCAGAGACTGGAGGG - Intergenic
903774271 1:25782769-25782791 CCACAGAACCTGACTGTGGAGGG - Intronic
903784468 1:25849125-25849147 CCACAGAAGCAGGAAGTATAAGG - Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905299328 1:36975748-36975770 GCACCAAAGGAGAAAGTGGAGGG - Intronic
905701087 1:40014983-40015005 CCACAGAAGGAGAAAGAGCATGG + Intergenic
905973199 1:42156151-42156173 AGACAGAAGGAGAGAGTGGAGGG + Intergenic
906240776 1:44240924-44240946 CCACAGTAGCTGCAGGTGGAAGG + Intronic
906323995 1:44832985-44833007 CCACTCAGGCAGAAAGTGCATGG + Intronic
906721914 1:48012906-48012928 CAACAGATGCAGAAAATGCAAGG - Intergenic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
908167022 1:61468736-61468758 CCAAAGAGGCAGAACGTGGATGG - Intergenic
908304653 1:62799952-62799974 CCATGGAGGCAGAGAGTGGAAGG - Intronic
908885579 1:68784895-68784917 CCACAGGAGCAAAAACTGGGAGG - Intergenic
909021609 1:70437539-70437561 CCACATAGGCAGTATGTGGAAGG + Intronic
909912404 1:81277315-81277337 TCACAGAGGCAGAAAGTGATAGG - Intergenic
910315776 1:85882126-85882148 CCACAGTAACAGAAAATGGCTGG - Intronic
910475751 1:87604427-87604449 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
910720895 1:90285221-90285243 TCACAGAAGCAGAATTTGGAGGG + Intergenic
911040145 1:93584753-93584775 CCACACAAGGAAAAGGTGGAAGG + Intronic
911426452 1:97720287-97720309 TCACAGATGCAGTAAGTGAAAGG - Intronic
911646288 1:100340605-100340627 TCTCATAAGCAGTAAGTGGAGGG + Intergenic
912086911 1:106018387-106018409 ACACAGAGGCAGAAAGTAAATGG + Intergenic
912264365 1:108141066-108141088 ACACATAAGCTGAAAGTGAAAGG + Intronic
912885504 1:113468084-113468106 ACACAAAGACAGAAAGTGGAAGG - Intronic
913182724 1:116337712-116337734 CCCTAGAAGCAGAAAAGGGAAGG - Intergenic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913303133 1:117394567-117394589 AAACAGAAGAAGAAAGTGAATGG - Intronic
914402263 1:147333167-147333189 CCACACAAGCAGGAAGAGAATGG + Intergenic
914956322 1:152165886-152165908 AAACAGAAACAGGAAGTGGAGGG - Intergenic
915039358 1:152955061-152955083 TCATGGAAGCAGAAAGTAGAAGG + Intergenic
915128282 1:153680327-153680349 CCACAGCAGGAGAAAGTCGAAGG - Intronic
915807674 1:158871544-158871566 CTACTGAATCAGAAACTGGACGG - Intergenic
916392968 1:164352439-164352461 ACACACAAGCTGAAAGTGAAGGG + Intergenic
917826663 1:178829210-178829232 TCATAGAAGCAAAAAGTAGAAGG + Intronic
918578766 1:186099562-186099584 CCACAGATGGAGGAAGTTGAGGG - Intronic
918625944 1:186656128-186656150 TCACATAAGCATAAAGAGGAGGG - Intergenic
919057245 1:192586389-192586411 CCACAGGAGCAGAAGGAGAAGGG - Intergenic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
919559814 1:199102510-199102532 TCATAGAAGCAGAAAGTAGAAGG - Intergenic
920498631 1:206472662-206472684 TCACAGCAGCAGGAAGTGGTGGG + Intronic
920825987 1:209424666-209424688 CCACCCAAGGAGTAAGTGGAAGG - Intergenic
921530735 1:216279444-216279466 CCAAAGAAGCTGAATGTAGATGG - Intronic
922132271 1:222791566-222791588 GCACAGCAACAGAAATTGGAAGG - Intergenic
923766849 1:236900458-236900480 CCACAGAAGGAGGAAGTGGAAGG + Exonic
924148003 1:241097258-241097280 CCACAGATGTAAAAAGTGCAAGG + Intronic
924537131 1:244945308-244945330 TCATAGAAACAGAAAGTGGAAGG + Intergenic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
924746930 1:246844423-246844445 CCACAAAAGGAGAAAGTGCCAGG + Intronic
924763968 1:247014201-247014223 TCACAAAAGCTAAAAGTGGAAGG - Intergenic
1063260713 10:4386330-4386352 CCACTCAACCATAAAGTGGAGGG - Intergenic
1063441069 10:6073642-6073664 TCACAGAAGTAGAAAGTAGAAGG - Intergenic
1063835859 10:10010926-10010948 GCAAAGAAGCAGAAAGTGCCAGG + Intergenic
1063881338 10:10535788-10535810 CCACAGGAGCAGAATGGGGAGGG + Intergenic
1064115174 10:12571516-12571538 CCACTGAATCAGAATGTGCATGG + Intronic
1064234064 10:13557187-13557209 TCATAGAAGTAGAAAGTGAAAGG + Intergenic
1065827884 10:29588449-29588471 CCAGAGAAGCAGAGAATGAATGG - Intronic
1066302327 10:34107990-34108012 CCACAGAAAGAGAAGGTGGATGG + Intergenic
1066374331 10:34843846-34843868 CCAATGAAGATGAAAGTGGAAGG + Intergenic
1068123595 10:52810772-52810794 CCACGGAACTAAAAAGTGGATGG + Intergenic
1068681021 10:59820133-59820155 CCAAAGAAGCAGAAAGGGAGTGG + Intronic
1069059541 10:63881088-63881110 ACACAGAGGCTGAAAGTGAAGGG - Intergenic
1069160360 10:65084639-65084661 CCTCAGAAGCAGATTCTGGAGGG + Intergenic
1069312633 10:67057451-67057473 ACACAGAAGCAGAGAGTAGAAGG - Intronic
1069778631 10:70941254-70941276 CCAGAGAAGCATGGAGTGGAGGG - Intergenic
1070040581 10:72774672-72774694 ACACATAAGCTGAAAGTGAAGGG + Intronic
1070568865 10:77625545-77625567 TCATAGAAACAGAAAGTAGAAGG - Intronic
1070837958 10:79462938-79462960 CCACAGGAGCAGAGAGGGGAGGG + Intergenic
1071672175 10:87618918-87618940 CCTCAGAAACACAAAGTGGGAGG - Intergenic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1073707138 10:105997666-105997688 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1074693730 10:116029475-116029497 CCACAGCCCCAGAAGGTGGAGGG + Intergenic
1074917666 10:117972770-117972792 CCACAGAACCAGAGAGCAGAAGG - Intergenic
1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG + Intronic
1075425368 10:122337939-122337961 CCCCAGAAGGGGAAAGAGGAAGG - Intronic
1076333114 10:129686146-129686168 CAGCAGAAACAGAAACTGGAGGG + Intronic
1076479623 10:130776383-130776405 CAACAAAGGCAGAAAGTGAAGGG - Intergenic
1076664699 10:132079772-132079794 TCATAGAAACAGAAAATGGAAGG - Intergenic
1077202713 11:1319581-1319603 TCACAAAAGCAGAAATTGGGGGG - Intergenic
1077388811 11:2289737-2289759 CCATAGAGACAGAAAGTGGATGG + Intergenic
1077549502 11:3193778-3193800 TCTCAGAAGCAGAAAGTCCAGGG + Intergenic
1077750740 11:4965805-4965827 CCACAGTAGAAGAAAGTCCATGG - Intronic
1077831922 11:5882161-5882183 CCACAGTAGCAGACAGTGTATGG - Intronic
1077922591 11:6652881-6652903 GGAGAGAAGGAGAAAGTGGATGG - Intronic
1078312155 11:10255048-10255070 TCACAGAAGCAGAGGGTGAATGG + Intronic
1080841228 11:35985263-35985285 CCACAGAACCAGACAGTGGAAGG - Intronic
1080848056 11:36043653-36043675 CAACAGAGGCAGAGACTGGAGGG + Intronic
1080986373 11:37471557-37471579 TCACAGAAGCAGAAAGTATAAGG + Intergenic
1084401652 11:68947364-68947386 CCCCAGAAGCTGGAAGTGGCAGG + Intergenic
1086096478 11:83054920-83054942 CCTCAGAAGCAGCAAGAAGATGG + Intronic
1086490202 11:87351914-87351936 CCAAAGAGGAAGAAAGAGGAAGG - Intergenic
1086543135 11:87936615-87936637 ACAAAGAAGAATAAAGTGGAAGG - Intergenic
1087298114 11:96400728-96400750 CCACATGAGCAGAAGGTGAAAGG - Intronic
1087459412 11:98425829-98425851 CCACAGAAACAGAGAGTATAAGG - Intergenic
1087882076 11:103428668-103428690 TCACAGAGACAGAAAGTAGATGG - Intronic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1088391997 11:109324618-109324640 ACACTGTACCAGAAAGTGGATGG + Intergenic
1088456340 11:110036570-110036592 CCACAGAGACAGAGACTGGATGG - Intergenic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089002885 11:115067040-115067062 CCTCAGGAGCAGACAGTGTACGG - Intergenic
1089081004 11:115776141-115776163 CCAACGAAGCAGAAAGTGTGTGG - Intergenic
1089524487 11:119088036-119088058 CCAGAGAAGCAGAGACTAGAGGG - Intronic
1090331567 11:125936391-125936413 CCACAGAGACAGAAGGTAGAAGG - Intergenic
1090345651 11:126067899-126067921 CCACAGAAGAACAATGTGAATGG + Intergenic
1090423910 11:126594025-126594047 CCAATAAAGCAGAAAGTGAAAGG - Intronic
1090448269 11:126783250-126783272 CCACAGAGGCAGAGATTGTAGGG - Intronic
1090500237 11:127254146-127254168 ACCCAGAAGCCGAAGGTGGAGGG - Intergenic
1091229240 11:133977148-133977170 CCACTTGAGCAGAAAGGGGAGGG + Intergenic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1093682279 12:22016449-22016471 CCACAGAAAGAGTAAGAGGATGG + Intergenic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1096196882 12:49654319-49654341 CCAGAGAAGCAGCAACAGGAAGG + Intronic
1096559527 12:52425573-52425595 TCACAGAAACAGAGAGTGGAGGG + Intronic
1098012749 12:66071758-66071780 CAAGAGAAGCAAGAAGTGGAGGG - Intergenic
1099280227 12:80634949-80634971 CGACAGAAGCAGAAAGAAGGTGG + Exonic
1099574090 12:84359607-84359629 ACACAGAAGAGGAAAGTGGCAGG + Intergenic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1099946817 12:89254499-89254521 GGACCGAACCAGAAAGTGGAAGG + Intergenic
1100972300 12:100083402-100083424 ACATAGAAGTAGAAAGTGAAGGG + Intronic
1101739878 12:107492584-107492606 ACACAGAAGCAGAAGTGGGAGGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102522431 12:113486920-113486942 CCACAGAGGCAGCAGGTGTAGGG - Intergenic
1102642312 12:114377980-114378002 CCACCCAACCAGAGAGTGGATGG - Intronic
1102688746 12:114744075-114744097 CCAAAGAAACAGATATTGGAGGG - Intergenic
1102907618 12:116688844-116688866 CCACAGAAGCAGGCGGTGGTGGG + Intergenic
1103041771 12:117701753-117701775 AGACAGAAGCAGAGATTGGAAGG + Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103687444 12:122743223-122743245 ACACAGAGGCAGATACTGGAGGG - Intergenic
1103980677 12:124735007-124735029 TCACAGAACCAGAAGATGGAAGG + Intergenic
1104063476 12:125287174-125287196 CCACAGAAGCAGAGGAGGGAGGG - Intronic
1104269568 12:127270737-127270759 CCACTCAAGCAGATAGTGGAGGG - Intergenic
1104493656 12:129216536-129216558 CCACAGAAGCTGGAAGAGGTAGG + Intronic
1105977420 13:25484381-25484403 CCACAGAGCCAAAAAGTTGATGG - Intronic
1106001356 13:25726552-25726574 CAACAGAAGCAGAGAATGAAGGG - Intronic
1106041961 13:26102230-26102252 TCACAGAGACAGAAAGTAGATGG - Intergenic
1106212980 13:27668078-27668100 CCACAGAAACAGGAGGTGGCTGG - Intergenic
1106664502 13:31837460-31837482 ACAAGGAAGGAGAAAGTGGAGGG + Intergenic
1107965456 13:45593738-45593760 CCACAGGAGCAGAGAGTGAAGGG - Intronic
1108167662 13:47709955-47709977 CCACAGAGGCAGAGGGTGGGTGG - Intergenic
1109154541 13:58889980-58890002 GCAGAGAAGAAGAAAGTGGAGGG + Intergenic
1109996475 13:70133867-70133889 ACACAGTACCAGAAAGTGGGTGG - Intergenic
1110439967 13:75516880-75516902 CCATAGTGGCAGAAGGTGGAAGG - Intergenic
1110688844 13:78407411-78407433 CCACAGAAGCAGGAAAAAGAGGG + Intergenic
1111808995 13:93074280-93074302 ACACAGTTGTAGAAAGTGGAGGG + Intergenic
1112297419 13:98200396-98200418 CCACTGAATCACAAAGGGGAGGG - Intronic
1112347033 13:98598423-98598445 GCACAGAAGGAGGAAATGGATGG - Intergenic
1112374690 13:98828064-98828086 CCACGGAGGCAGGAACTGGAGGG + Intronic
1112883295 13:104135804-104135826 CCACACAAGCAGGAAGCAGAAGG - Intergenic
1113486696 13:110658327-110658349 TCATAGAAACAGAAAGTAGAAGG + Intronic
1113510546 13:110850963-110850985 CCACAGACCCCGAAAATGGAGGG + Intergenic
1113778307 13:112961534-112961556 CCACAGCAGCAGGAAGGGAACGG - Intronic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1113900452 13:113793931-113793953 CCACAGCAGCAGAAGGCGGGGGG - Intronic
1114409807 14:22490036-22490058 CCTCAGGAGCAGAGAATGGAGGG + Intergenic
1114774461 14:25465511-25465533 CCACAGCAGTGGAAAGGGGAAGG + Intergenic
1116081870 14:40184926-40184948 TCATAGAAGCAGAGAGTAGAGGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117190671 14:53287817-53287839 TCATAGAGGCAGAAAGTAGAAGG - Intergenic
1117589438 14:57251338-57251360 CCACAGAGGCATAAAGAGGCTGG + Intronic
1117606029 14:57430280-57430302 CCACAGATGAGGAAAGGGGAGGG + Intergenic
1117663139 14:58029131-58029153 CCATAGAGACAGAAAGTGAATGG - Intronic
1117904698 14:60572305-60572327 CCACAGAAGCAACAAGATGAAGG - Intergenic
1118924721 14:70181651-70181673 GCACAAAAGCAGAAAGGGCAAGG + Intronic
1119014961 14:71040865-71040887 TCACGGAAATAGAAAGTGGAAGG - Intronic
1119788810 14:77331225-77331247 CCACAGGAGCAGAAGCTGGGTGG + Exonic
1120032251 14:79655283-79655305 TCACAGAGCCAGAAAGTGGCAGG - Intronic
1120061515 14:79988891-79988913 CCACATAAATAGAGAGTGGAGGG + Intergenic
1120559801 14:85976831-85976853 CTACAGAAGCTGAAATTGAATGG + Intergenic
1120673988 14:87397482-87397504 CCACAGAATTAGAAGGAGGAAGG - Intergenic
1120918519 14:89731592-89731614 TCATAGAAACAGAAAGTAGAAGG - Intergenic
1121111602 14:91316788-91316810 CCACAGAATGAGAAAGATGAGGG - Intronic
1121489578 14:94348305-94348327 CCACAGCAGAGGACAGTGGAAGG - Intergenic
1121512657 14:94523755-94523777 CGACAGAGGCAGAGATTGGACGG - Intergenic
1121674250 14:95739594-95739616 CCTCAGATGATGAAAGTGGAAGG + Intergenic
1121688399 14:95856719-95856741 CCACAGAAGCAGAGAGAGATTGG - Intergenic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1122317440 14:100834554-100834576 CAACAGAAGCAGAAAAAGCAGGG - Intergenic
1123626312 15:22229169-22229191 CTACAGGGACAGAAAGTGGATGG + Intergenic
1123700844 15:22913856-22913878 CCACAGCCACAGAGAGTGGAAGG + Intronic
1124424045 15:29548030-29548052 TCATAGAAACAGAAAGTAGAAGG + Intronic
1126392541 15:48175271-48175293 ACTCAGAAGCAGAGAGTAGAAGG + Intronic
1127131848 15:55874273-55874295 CCAAACAAGCAGAAACTGGAGGG + Intronic
1127493762 15:59490297-59490319 CAAAAGAAGAACAAAGTGGAGGG + Intronic
1127521487 15:59747094-59747116 TCTCAGAAGAAGAAAGTGGGAGG - Intergenic
1128719480 15:69936864-69936886 ACACATAAGCTGAAAGTGAAGGG + Intergenic
1129057286 15:72829680-72829702 CCACAGAAGCAGAGACTGATGGG - Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1132234595 15:100209748-100209770 CCAGCGTGGCAGAAAGTGGATGG + Intronic
1132464186 16:70167-70189 CCACACAGTCAGAAAGGGGATGG + Intronic
1132999455 16:2841690-2841712 CCACAGCAGCAGAAGCAGGATGG + Intergenic
1133465480 16:6023008-6023030 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1133530719 16:6652719-6652741 CCACAGAGACAGAAAGCAGAAGG + Intronic
1133735370 16:8610994-8611016 CCACAGAATCAGACTGAGGATGG + Intergenic
1134305280 16:13026259-13026281 TCAAAGAAACAGAAAGTAGAAGG - Intronic
1134374987 16:13663807-13663829 ACAAAGAAGCAGAATGTGAAAGG - Intergenic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134527839 16:14957957-14957979 CCACAGAGGCAGAAAGTATGGGG + Intergenic
1135928930 16:26720134-26720156 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1135978164 16:27124749-27124771 TTACAGAAGCAGAAAGGGGTGGG + Intergenic
1136079033 16:27839458-27839480 AAACAGAAGCAGAAAGCGCAAGG + Intronic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1137774827 16:51045980-51046002 CCCCAGAAGCAGAAGCTGGGAGG + Intergenic
1138240023 16:55419895-55419917 CACCAGAAGCAGCAAGTGCAAGG - Intronic
1138707754 16:58935078-58935100 CCACAGAATCAGAAACTCCAGGG + Intergenic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140317575 16:73913903-73913925 CCACAGATACAGAAAGTCTAGGG + Intergenic
1140647348 16:77047166-77047188 CATCAGAAGAAGAAAATGGAAGG + Intergenic
1140796393 16:78442481-78442503 TCACAGAAGCAGAGAGTAGAGGG - Intronic
1141278768 16:82611744-82611766 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1141368890 16:83469121-83469143 CAGCAGAAGCAGAAAGTTCAAGG + Intronic
1141469277 16:84227876-84227898 CCACAGAGACAGAAAGCAGAGGG + Intronic
1141969964 16:87474570-87474592 CAAGACAAGCAGAAACTGGAGGG + Intronic
1141977664 16:87528202-87528224 CTACAGGGACAGAAAGTGGATGG - Intergenic
1142151334 16:88513787-88513809 CCCCAGAAGCTGAGAGTGGCAGG - Intronic
1142336514 16:89492737-89492759 CGACAGAAGTAGAACGTGTATGG + Intronic
1142484880 17:240483-240505 GCACAGAGGCAGACAGTAGATGG - Intronic
1142799972 17:2338531-2338553 CCACAGAGGCAGGCAGGGGAAGG - Intronic
1142880723 17:2880664-2880686 CCATAGAGACAGAAAGTAGATGG - Intronic
1142917754 17:3155917-3155939 CCACAGAATGAGAAAAAGGAAGG + Intergenic
1143087773 17:4429271-4429293 TCACAGAAACAGAAAGTAAATGG - Intergenic
1143296287 17:5874405-5874427 CCACTGCAGCAGCAAGTGGCTGG - Intronic
1143889425 17:10091201-10091223 CCACAGAGACAGAAAGCAGATGG + Intronic
1144135925 17:12294644-12294666 CCACTGAAGAAGAAAGTGGTGGG - Intergenic
1144707537 17:17379511-17379533 ATACAGAAACAGAAAGCGGATGG - Intergenic
1144856716 17:18272997-18273019 CCACAGAGACAAAAAGTGGTTGG + Intronic
1145886346 17:28384833-28384855 CCCCAGGAGCAGCAGGTGGATGG + Exonic
1147497061 17:40926829-40926851 CAACAGAACCAGACAGTGTAGGG - Intronic
1148994601 17:51698744-51698766 TCACAGAAGCAGAGAGTAGGTGG - Intronic
1149550804 17:57537978-57538000 CCACGGAAGCAGAAAGGGAGTGG + Intronic
1151240269 17:72751972-72751994 GCACAGAGGCAGGAAGTAGAAGG - Intronic
1151372901 17:73660240-73660262 CCACTGAAACAGGCAGTGGAGGG - Intergenic
1151902874 17:77028662-77028684 CCACAGAGACAGAAAGCAGATGG + Intergenic
1152526967 17:80893875-80893897 CCTCGGAAGCAGAAAGGGGCAGG - Intronic
1153039155 18:794742-794764 CAACAGAGGCAGAAATTGGTGGG - Intronic
1153958626 18:10121240-10121262 TCACAGAAGCAGAGAGCAGAAGG + Intergenic
1154408607 18:14121135-14121157 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1157682137 18:49615458-49615480 CCACAGACACAGAAAGCAGAGGG - Intergenic
1158769127 18:60493424-60493446 CCACTGAACCAGGAAGTGGGAGG - Intergenic
1159679800 18:71334991-71335013 ACACAGAAGGAGTAGGTGGAGGG + Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1161010549 19:1957643-1957665 CCACACAGGCAGAGACTGGAGGG + Intronic
1162813506 19:13179253-13179275 CCACAGAGACAGAAAGTAGATGG - Intergenic
1162876424 19:13624098-13624120 CCACAAAAGCAGACACTGAACGG + Intergenic
1163901933 19:20109980-20110002 TCATAAAATCAGAAAGTGGAAGG - Intronic
1163947118 19:20548456-20548478 TCATAAAATCAGAAAGTGGAAGG + Intronic
1163985258 19:20940691-20940713 TCATAAAAACAGAAAGTGGAAGG - Intronic
1163995027 19:21036969-21036991 TCATAAAAACAGAAAGTGGAAGG - Intronic
1164008321 19:21172948-21172970 TCATAAAAACAGAAAGTGGAAGG - Intronic
1164068289 19:21741208-21741230 TCATAAAAACAGAAAGTGGAAGG + Intronic
1164239382 19:23370344-23370366 TCATAAAAACAGAAAGTGGAAGG + Intronic
1164285602 19:23813392-23813414 TCATAAAAACAGAAAGTGGAAGG - Intronic
1165393309 19:35550483-35550505 CTACAGAAGCAGATACTGGTGGG + Exonic
1165779724 19:38425530-38425552 CCACAGAGGCAGATGGTGGGTGG - Intronic
1166437927 19:42785420-42785442 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166456881 19:42949212-42949234 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166472965 19:43096159-43096181 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166491835 19:43267081-43267103 CCCCAGAAGCAGAAACAGAAGGG - Intronic
1166493746 19:43283145-43283167 TCACAGACGGAGAAAGAGGAGGG - Intergenic
1166594005 19:44028252-44028274 CCAGCTAAGCAGAAAGTGGGAGG - Intronic
1167165548 19:47797527-47797549 AGACAGAAGAAAAAAGTGGAAGG + Intergenic
1167197004 19:48036473-48036495 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1167353575 19:48990698-48990720 ACACACAGGCAGCAAGTGGAGGG + Intronic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925119858 2:1409898-1409920 TCATGGAAGCAGAGAGTGGATGG + Intronic
925273669 2:2633854-2633876 TCACAGAAGCAGAGAGTAGATGG - Intergenic
925340697 2:3133554-3133576 TCATAGAGACAGAAAGTGGAAGG + Intergenic
925518296 2:4709572-4709594 ACTCAGAAGCAGAGAGTAGAGGG + Intergenic
925779147 2:7364453-7364475 TCACTGAAACAGAAAATGGAGGG + Intergenic
925897739 2:8486365-8486387 TCACAGAAGCAGAGTGTGAATGG - Intergenic
925909055 2:8560306-8560328 ATACAGAAGCTGAAAGTGAAGGG + Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926329242 2:11811107-11811129 CCACAGAAGCAGAGGGTGCTTGG - Intronic
926638743 2:15212398-15212420 CACCAAAAGAAGAAAGTGGAAGG - Intronic
927105622 2:19821140-19821162 TCACTGCAGCAGAAAGGGGAGGG + Intergenic
927205664 2:20608800-20608822 GCACTGAATCAGAAAGTGGAGGG - Intronic
927405733 2:22764264-22764286 TCACAGAAGCAGAGAGAGAATGG - Intergenic
927542233 2:23923315-23923337 TCACAGAAGCAGAGAGTAGAAGG + Intronic
928075117 2:28257385-28257407 CTAGAGAAACAGAAAGTGGTCGG - Intronic
928491822 2:31792340-31792362 ACTCAGAAGCAGAAAGTCAATGG + Intergenic
928553530 2:32398237-32398259 GCACAGAGGCATAAAGTGGATGG + Intronic
929123097 2:38499517-38499539 CTACAGAAGCAGAATCTGTAGGG + Intergenic
929128541 2:38543227-38543249 CCACAGAAACAGCATGTGGTCGG - Intergenic
929998605 2:46846055-46846077 CCACAGAATCAGGAAGTGCCAGG - Intronic
930749738 2:54922850-54922872 TCACAGAAGTAGAGAGTAGAAGG + Intronic
931465123 2:62479251-62479273 TCATAGAAGTAAAAAGTGGAAGG - Intergenic
932145555 2:69313000-69313022 CCACAGAGGTAGAAACTGGAGGG - Intergenic
932206676 2:69889513-69889535 CCACACAGGCAGAGATTGGATGG - Intergenic
933264731 2:80169578-80169600 CCACAGAAACAGATAGAGCAGGG - Intronic
935410981 2:102761825-102761847 CCACAGAAGTAGAAAGAAGATGG - Intronic
935724809 2:106014233-106014255 GCACAGAAGCAGAGAGTAGAAGG - Intergenic
935810023 2:106788574-106788596 TCACATGAGCAGAAAGTGGGCGG - Intergenic
936013131 2:108938127-108938149 CCACAGAGGCAGGAAGAGCATGG + Intronic
936590546 2:113799754-113799776 ACAAAGAAGCAGGAAGTGGGGGG - Intergenic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
937540962 2:122952919-122952941 TCATAGAGGCAGAAAGTAGATGG + Intergenic
938130541 2:128711953-128711975 GAACAGAATCAGAAAGTAGAAGG - Intergenic
938870706 2:135473185-135473207 TCATAGAAACAGAAAATGGAAGG - Intronic
939114027 2:138040157-138040179 CCACAGAAACAGAAAGGACAAGG - Intergenic
939116085 2:138062418-138062440 CCACAGGAGCAGTAAGTGGAAGG + Intergenic
939135227 2:138285673-138285695 CCACAGAGGCAGAGATTGGATGG - Intergenic
939155135 2:138516146-138516168 TCAAAGAAGCAGATAGTGGGTGG + Intronic
939486188 2:142814094-142814116 ACACGGAATCAGAAAGTGGGAGG + Intergenic
939643491 2:144668666-144668688 ACACAGAATGAGGAAGTGGAGGG + Intergenic
940463890 2:154003816-154003838 TCACAGAAGGAGGAAGAGGAGGG - Intronic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
942650327 2:178160173-178160195 TCATAGAAACAGAAAGTAGAAGG - Intergenic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
944032246 2:195249406-195249428 TCACAGAAGCAGAAAGTAGAAGG + Intergenic
944175204 2:196821160-196821182 CAACAGAAGCTGGAAGAGGAAGG + Intergenic
946530270 2:220563263-220563285 TCAGAGAGGCAGAAAGTAGACGG + Intergenic
947133121 2:226950225-226950247 TCACAGAAGCAGAGAGCAGAAGG - Intronic
947220409 2:227786353-227786375 CCATAAAAGGAGAAAGTTGATGG - Intergenic
947412665 2:229857799-229857821 GCAAAGAAACAGAAAGTAGATGG - Intronic
947602208 2:231460477-231460499 GCCAAGAAACAGAAAGTGGAAGG - Exonic
948327514 2:237137859-237137881 CCACACAGGCAGAATGTTGAGGG - Intergenic
948912831 2:241013266-241013288 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1169027906 20:2385581-2385603 CCACAGAGTGAGAAAGAGGAGGG - Intronic
1169529450 20:6468627-6468649 CCACAGAAGCATAAATAGCATGG + Intergenic
1170631347 20:18068928-18068950 TCATAGAAGGAGAAAGTAGAAGG - Intergenic
1171341048 20:24430084-24430106 CCAGAGAACAAGAAAGAGGATGG + Intergenic
1172394167 20:34587678-34587700 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1172770467 20:37379380-37379402 CCCCAGAACCAGGAAGTGCAAGG + Intronic
1173236287 20:41248819-41248841 CCACTGAAGCAGGAATTGGCTGG + Intronic
1173274335 20:41566502-41566524 CCACAGGAGCAGAGTGGGGAAGG - Intronic
1173612347 20:44378988-44379010 TCACAGAGACAGAAAGTAGAAGG - Intronic
1174295827 20:49544349-49544371 CTACAGAAGCAGGCAGTGGCTGG - Exonic
1174409181 20:50322450-50322472 CCACAGAGGCAGAACATGGTAGG + Intergenic
1176290004 21:5038640-5038662 ACACAGAAGCACAGCGTGGAAGG + Intronic
1176375506 21:6085220-6085242 CCACAGCAGCAGACACTGGACGG + Intergenic
1176926487 21:14756103-14756125 CCACACAGGCTGAAAGTGAAAGG + Intergenic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1177665515 21:24151991-24152013 ACATAGAAACAGAAAGTGGGAGG - Intergenic
1177760645 21:25399303-25399325 CTCCAGCAGCAGCAAGTGGAGGG + Intergenic
1178112373 21:29381613-29381635 CCACAGAATCAGAAACTCTAGGG - Intronic
1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG + Intronic
1178895935 21:36556978-36557000 TCACAGAAGCAGAGAGTAGATGG - Intronic
1178935221 21:36856021-36856043 CCATAGAAACAGAAAGTAGATGG + Intronic
1179166372 21:38938321-38938343 TCACAGAGACAGAAAGAGGAGGG - Intergenic
1179496317 21:41773567-41773589 CCACAGAGGCAGCAAGTAGATGG + Intergenic
1179747968 21:43453024-43453046 CCACAGCAGCAGACACTGGACGG - Intergenic
1179867250 21:44224999-44225021 ACACAGAAGCACAGCGTGGAAGG - Intronic
1180014191 21:45072305-45072327 CCAGAGCAGCAGAGAGCGGATGG - Intergenic
1180139288 21:45881747-45881769 TCACAGAAGCAGAGGGTGGGAGG - Intronic
1181600900 22:23951407-23951429 ACACAGAAGCAGTCTGTGGAGGG + Intergenic
1181607613 22:23989919-23989941 ACACAGAAGCAGTCTGTGGAGGG - Intergenic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183867462 22:40715155-40715177 TCATAGAAACAGAAAGGGGAAGG + Intergenic
1184486385 22:44782528-44782550 CCACAGAGACAGAAAGCAGATGG - Intronic
1185228832 22:49668540-49668562 CCACAGCAGCAGCAAGGGCAGGG + Intergenic
949269265 3:2195107-2195129 TCACAGAAGCAGAGAGTATAAGG - Intronic
949968989 3:9386319-9386341 CCACAGAACCAGGAAGTTCAAGG + Exonic
950021347 3:9789848-9789870 CCCAAGAAGCAGAAACTGGAAGG - Exonic
950579930 3:13855494-13855516 CCACAGAAGAAGGGAGGGGATGG - Intronic
950694267 3:14685699-14685721 TCATAGAAGCAGAGAGTGAATGG - Intronic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
951820101 3:26798601-26798623 CCCCAGAAGAAGAAAATGAAAGG - Intergenic
951921650 3:27861215-27861237 CCACAGAAGCCAAAAGTAGCAGG + Intergenic
952129331 3:30342006-30342028 ACACAGATGGAGACAGTGGAAGG - Intergenic
952207058 3:31190795-31190817 CCACAGAAGCCTAAAGTGAGGGG + Intergenic
953100487 3:39820931-39820953 CAACCCAAGCAGAAAGTGGATGG - Intronic
953890643 3:46749760-46749782 CCACAGAAAATGAAAGAGGAGGG + Intronic
954485682 3:50849141-50849163 TCTCAGAAGCCTAAAGTGGAGGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954940174 3:54364774-54364796 GCAAAGAAGCGGAAAGAGGAAGG + Intronic
955871016 3:63438319-63438341 ACACTGAAGCTGAAAGTAGAGGG - Intronic
956225053 3:66947861-66947883 AAAATGAAGCAGAAAGTGGAAGG - Intergenic
956319853 3:67984693-67984715 CCACAGAGGCAGAGACTAGAAGG - Intergenic
956589720 3:70901384-70901406 GCACAGAAGAATAAAGTGAAAGG + Intergenic
957145986 3:76424463-76424485 ACATAGAAGCAGAGAGTAGAAGG + Intronic
957947061 3:87078465-87078487 TAACAGAAGCAGAAATGGGAAGG + Intergenic
959369781 3:105508905-105508927 ACACAGAAACAGAGAGTGGATGG - Intronic
959428737 3:106224958-106224980 CTACAGAGACAGAAAGTAGATGG - Intergenic
959654224 3:108782768-108782790 TCATAGAAACAGAAAGTAGAAGG - Intergenic
959721238 3:109491780-109491802 CCACAGAAACAGAAATGGTAGGG + Intergenic
960738462 3:120805951-120805973 CCACAGAAGAAGAATGTGAATGG + Intergenic
961128807 3:124446359-124446381 CCACAGCAGCAGATTGGGGATGG + Intronic
961201086 3:125046088-125046110 CCACAGAGGCAGAAAGCAGAAGG + Intronic
961560153 3:127723204-127723226 TCAAAGAGGGAGAAAGTGGAGGG - Intronic
961597466 3:128029901-128029923 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
963225368 3:142856609-142856631 CCACAGAAGCAGGAAGGCTAAGG + Intronic
964453937 3:156839947-156839969 ACACAGGTGGAGAAAGTGGAAGG - Intronic
964502034 3:157358532-157358554 CCCCAGAAGCATTAAGTGGATGG + Intronic
964757925 3:160105551-160105573 CCTCAGAAGCACAAAGTGCCAGG + Intergenic
965002896 3:162980578-162980600 AGACAGAGGCAGAAATTGGAGGG - Intergenic
965099279 3:164276195-164276217 ATACAGACGCTGAAAGTGGATGG + Intergenic
965193881 3:165568688-165568710 ACTCAGAAACAGAAAGTGGAAGG + Intergenic
965632107 3:170743625-170743647 TCATAGAAGCAGAGAGTAGACGG - Intronic
967462073 3:189759234-189759256 CTACTGAATCAGAAACTGGAGGG + Intronic
968202928 3:196771267-196771289 TCACAGAAGCAGTAATTGAATGG - Intronic
969485002 4:7467291-7467313 GGACAGCAGCAGAGAGTGGAAGG + Intronic
969868041 4:10087895-10087917 CCCCAGAAGCAGAAAGCAAATGG + Exonic
970972062 4:21996486-21996508 TCATAGAAACAGAAAGTTGAAGG + Intergenic
970995157 4:22259115-22259137 TCATAGAGACAGAAAGTGGAGGG + Intergenic
971541150 4:27818206-27818228 CAACAGAGACAGAAATTGGAGGG + Intergenic
971607878 4:28681971-28681993 CCACAAAACTAGAAAGTGGTAGG + Intergenic
972391680 4:38619503-38619525 CCTCAGAACCAGAAAAGGGAAGG - Intergenic
973842150 4:54873322-54873344 TCACAGAAGCAGACTGGGGAGGG - Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
974278000 4:59751584-59751606 CCCCAGCAGCAGAGAGTGGTTGG - Intergenic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
975967171 4:79987155-79987177 ACACAGAATCAGAATCTGGATGG + Intronic
975994196 4:80295578-80295600 CCACAGAGGCAGAAACTTGCAGG - Intronic
976287964 4:83388318-83388340 CCACAGAAAAAGAAATGGGATGG - Intergenic
979006190 4:115300294-115300316 TCACAGAAGCAGAAGTGGGAGGG - Intergenic
979515563 4:121605853-121605875 ACACATAAGCAGAGAGTGGAGGG - Intergenic
980044794 4:127975337-127975359 TCATAGAAGCAGAAAGTAGAAGG - Intronic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980455833 4:133041601-133041623 ACACAAAAGCTGAAAGTGAAGGG + Intergenic
980562355 4:134493812-134493834 CAACAAAAGAAGAAAGTTGAAGG + Intergenic
980934082 4:139209711-139209733 TCATAGACGCAGAAAGTAGAGGG - Intergenic
981283475 4:142988333-142988355 ACACAGAGGCTGAAATTGGAAGG - Intergenic
981356183 4:143791849-143791871 TCACAGAAACAGAAAGTAAAAGG - Intergenic
981476701 4:145194430-145194452 CCATAGAGACAGAAAGTAGAGGG + Intergenic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
983081141 4:163386944-163386966 CCAGAGAAGCAGAACCTGTAGGG + Intergenic
984386238 4:179061951-179061973 AGACATAAGCAGAAAGTGAAGGG + Intergenic
984414985 4:179446615-179446637 ACAAAGAAGCACAAACTGGATGG + Intergenic
984638838 4:182142601-182142623 GCTCTGAAGCTGAAAGTGGAGGG + Intergenic
984830100 4:183964931-183964953 CCTCAGAAACAGGAAATGGAAGG + Intronic
984914173 4:184705911-184705933 TCATAGAAACAGAAAGTAGAAGG + Intronic
984957686 4:185061964-185061986 TTACAGAAGCAGAAAGCAGATGG + Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
985581102 5:695596-695618 CCACAGAAGCTGGAAGAGGTGGG - Intergenic
985595726 5:786928-786950 CCACAGAAGCTGGAAGAGGTGGG - Intergenic
985768046 5:1791329-1791351 CCACAGAAGCTGGAAGAGGCAGG + Intergenic
986058847 5:4168610-4168632 TCACAGAAGCAGAAAGTAAATGG + Intergenic
986349021 5:6859715-6859737 ACACAGAGGCAGAAATTGGAGGG - Intergenic
986658387 5:10037510-10037532 AAACAGAGGCAGAAATTGGAGGG + Intergenic
986662162 5:10068970-10068992 TCATAGAAGCTGAGAGTGGAAGG - Intergenic
986952434 5:13105809-13105831 GCAGAGAAGTAGAAACTGGAAGG + Intergenic
987791356 5:22572441-22572463 TCACAAAAGCAGTTAGTGGAAGG + Intronic
989169125 5:38457906-38457928 CCACAGAGTCAGAAGGTAGAAGG + Intronic
990764528 5:59167511-59167533 TCACAGCATGAGAAAGTGGAGGG - Intronic
991309198 5:65216388-65216410 CCACAGAGACAGAAAGCAGATGG + Intronic
992072048 5:73157269-73157291 CAACAGAAACAGAATGTGGCAGG + Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992203909 5:74411330-74411352 GAAAAGAAACAGAAAGTGGAAGG - Intergenic
992925764 5:81585070-81585092 CCACAAAAGCAGAAAATATATGG + Intronic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
993897586 5:93556109-93556131 CTACAGAAGCAGAAAGAACATGG - Intergenic
994044085 5:95288543-95288565 CAACACAAGCAGAAAGTGAATGG + Intergenic
995145787 5:108786023-108786045 CCACAGAAACTGAAATTAGAAGG - Intronic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
996028336 5:118676713-118676735 CCACTGAGGAAGTAAGTGGAGGG - Intergenic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
997239841 5:132298418-132298440 TCACAGAAGCAGAAAGTAAATGG + Intronic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
998323123 5:141251375-141251397 GAACAGAATCAGAAAGTGAACGG + Intergenic
998384664 5:141749885-141749907 TCACAGGAGCAGAAAGAAGAAGG - Intergenic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
999072248 5:148757396-148757418 ACACATAAGCTGAAAGTGAAAGG - Intergenic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000087574 5:157901411-157901433 CTCCTGAAGCAGAAACTGGAGGG + Intergenic
1000147720 5:158469456-158469478 GCACAGAAGCAGAGACCGGAAGG - Intergenic
1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG + Intronic
1001260802 5:170226945-170226967 CCACAGAATCAGAAAGCAGATGG + Intergenic
1001307700 5:170587643-170587665 TGACAGAAGCAGAGATTGGAGGG - Intronic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1003126450 6:3360065-3360087 TCATAGAAACAGAAAGTAGAAGG + Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003597221 6:7484760-7484782 CCATAGAGACAGAAAGTAGAAGG - Intergenic
1003775165 6:9352280-9352302 CCAGAGCAGGAGAAAGAGGAGGG - Intergenic
1004275814 6:14234180-14234202 CCACAGAAGCAGAGGCAGGAAGG + Intergenic
1004451533 6:15752530-15752552 GAACAGAAGTAGAAATTGGAGGG - Intergenic
1004581981 6:16963206-16963228 GCACAGGTACAGAAAGTGGAAGG - Intergenic
1004767976 6:18752923-18752945 CCACAGAAGCAGAAGGGGAGAGG - Intergenic
1004815787 6:19310649-19310671 TCACAGAAGCAAAGAGTAGAAGG + Intergenic
1004993522 6:21165163-21165185 CTCCTGAAACAGAAAGTGGAAGG - Intronic
1006583866 6:35092720-35092742 ACACAGAGGCAGAATGTGTAAGG - Intergenic
1006729753 6:36228105-36228127 GCACAGAAGCAGAATGTAGCTGG - Intronic
1006987714 6:38187613-38187635 CGACAGAAGCACACAGTGGGGGG + Intronic
1008374317 6:50773889-50773911 GCACAAAAGCAGAAAAAGGAAGG - Intergenic
1011037396 6:82992630-82992652 CCACAGAAGAAGAAAAAAGAAGG - Intronic
1011610397 6:89145785-89145807 CCACAGCAGCAGAATGAGAACGG - Intergenic
1012008916 6:93754745-93754767 CCATAGAGGCAGAGATTGGAGGG + Intergenic
1013311657 6:108900385-108900407 GCAAAGAGGGAGAAAGTGGAGGG - Intronic
1013443582 6:110197623-110197645 TCATAGAAGCAGAGAGTGAATGG - Intronic
1014372823 6:120633899-120633921 TCACAGAAGCAGAGAGGGAATGG + Intergenic
1015521378 6:134134999-134135021 CCTCAGAAGCTGCAAGTAGAGGG + Intergenic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1016930410 6:149401342-149401364 ACACATAGGCAGAAAGTGAAGGG + Intronic
1017294616 6:152779207-152779229 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1017657604 6:156645169-156645191 CCAAAGGAGGAGAAAGTGAATGG + Intergenic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1018332235 6:162742087-162742109 TCACAGAAGCAAAGAGTAGAAGG - Intronic
1018444803 6:163845901-163845923 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1018453321 6:163929303-163929325 CCACAAAAGCAAGAAGTGAAAGG - Intergenic
1018519677 6:164633479-164633501 TCACAAAAGCAGAGAGTAGAAGG - Intergenic
1019046547 6:169153609-169153631 TTACAGAAGCAGAGAGTAGAAGG - Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019742832 7:2683313-2683335 CCCCAGAAGCAGGAAGAGGCAGG - Intronic
1020203930 7:6101203-6101225 CCACAGCAGCAGACAAGGGATGG + Intergenic
1020378226 7:7512171-7512193 TCACAGAAGCACAGAGTAGAAGG + Intronic
1020811643 7:12856224-12856246 CAAAAGAAGGAGGAAGTGGAGGG + Intergenic
1021057146 7:16063269-16063291 TCACAGAGGCAAAAAGAGGAAGG + Intergenic
1021675636 7:23077802-23077824 ACACAGAGGTAGAAAGTGGCAGG - Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1023079875 7:36516443-36516465 CCACACACACAGAAAGTGCACGG + Intronic
1023149127 7:37183190-37183212 GCACAGAAGGAGAAGGAGGAAGG + Intronic
1023625318 7:42109516-42109538 CCACACAATCAGAAAGTGAGAGG + Intronic
1023870442 7:44260460-44260482 CCACAGAATCAGAAAATATAGGG + Intronic
1024020898 7:45367797-45367819 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1024086800 7:45900093-45900115 CCAAAGAAGCAGTAAGAGAAAGG - Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1025257504 7:57394868-57394890 TCACAGAAGCAGACAGTAGAAGG - Intergenic
1025639311 7:63352594-63352616 ACTCAGAAGCAGAGAGTGGGAGG - Intergenic
1025643388 7:63395498-63395520 ACTCAGAAGCAGAGAGTGGGAGG + Intergenic
1026792416 7:73342878-73342900 CTACAGCAGGAGAAAGTTGAAGG + Exonic
1027344741 7:77246312-77246334 CCACAGAAGTAGAAACAGCATGG - Intronic
1028309744 7:89316520-89316542 CCACAAACGCAGAAAAAGGAAGG + Intronic
1029575785 7:101402426-101402448 CCAGAGAAGGGGAAAGGGGAAGG - Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1030730994 7:112988837-112988859 CCAAAGAATCAGAAAGTATAAGG - Intergenic
1030776517 7:113539733-113539755 ACACAGAGGCTGAAAGTGAAAGG + Intergenic
1031302896 7:120085964-120085986 CCAGAGAAACAGAAAGGGAATGG + Intergenic
1033437604 7:141347662-141347684 CCACACAAGCACAAAGTGTGTGG + Intronic
1033575576 7:142680747-142680769 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1033647120 7:143313996-143314018 TCATAGAAGCAGAAAGTAGAGGG - Intergenic
1033995044 7:147335044-147335066 CTACAGAACCAGTAAGTGGCAGG + Intronic
1034088496 7:148342134-148342156 CCACCGCAGCAGAGAGTAGAAGG - Intronic
1034125757 7:148669934-148669956 TCACAGAAACAGAAAATAGAGGG - Intergenic
1034281707 7:149859239-149859261 CCAAAGAGGCAGTAAGGGGAGGG - Intronic
1034975127 7:155444176-155444198 TCATAGAAGCAGAAAGTAGAAGG + Intergenic
1035063126 7:156084123-156084145 TCACAGAAGCAGAGAGCAGAAGG - Intergenic
1035956662 8:4088087-4088109 CCACAAAAGGAGAAAGAGGAAGG + Intronic
1036477680 8:9108360-9108382 CCACAGAAGCAGCATGTTGTGGG + Intronic
1036687727 8:10923100-10923122 CCACAGAAGCAGGAGGGGTATGG - Intronic
1037058014 8:14469120-14469142 CCATTGAAGCAAAAAGTGGAGGG - Intronic
1037241831 8:16786151-16786173 TCACAGAGGCAGAAATGGGAGGG + Intergenic
1037932767 8:22892092-22892114 CCAGGGAAGGAGAAAGTAGAGGG + Intronic
1038283322 8:26184908-26184930 TCACAGAAGCAGAGAGTAGAGGG + Intergenic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1039825477 8:41170225-41170247 TCCCAGAAGGAGAAAGAGGAAGG + Intergenic
1040013672 8:42682943-42682965 TCACAGAAACAGAAAGTAGAAGG + Intergenic
1040500450 8:48000484-48000506 CCCCAGCAGCAGAGAGTGGTTGG - Intergenic
1040770548 8:50970129-50970151 CCACAGAATGAGAAGGGGGAAGG + Intergenic
1041321185 8:56614131-56614153 AAAAAGAAGAAGAAAGTGGAAGG - Intergenic
1041628787 8:60061571-60061593 CCACAGGAGCACAGATTGGAAGG + Intergenic
1041629506 8:60070052-60070074 CCACAGAAGCAGAATCTAAAAGG - Intergenic
1041653776 8:60328124-60328146 TCACAGAAGCAGAGAGTAGAAGG + Intergenic
1041758677 8:61340373-61340395 TCACAGAAGTAGACAGTAGAAGG - Intronic
1042395031 8:68281920-68281942 CCACAGGATCAGAATGTAGAGGG + Intergenic
1042740756 8:72042864-72042886 TCACAGAAACAAAAAGTAGAAGG + Intronic
1043029139 8:75109462-75109484 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
1043374068 8:79627807-79627829 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1043848043 8:85183703-85183725 TCACAGGGGCAGAAAGTAGAAGG + Intronic
1044467267 8:92522115-92522137 CCACAGAAACAAGAGGTGGAGGG - Intergenic
1044878997 8:96702766-96702788 TTACAGAAGGAGAAAGGGGAGGG - Intronic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1045551478 8:103176683-103176705 CCACAGAAGTTGAAATGGGAGGG + Intronic
1045780535 8:105857666-105857688 ACACATAGGCAGAAAGTGAAGGG + Intergenic
1046655997 8:116895074-116895096 ACACATAAGCTGAAAGTGAAGGG + Intergenic
1046927972 8:119813599-119813621 CCAGAGAAGGACAAAGAGGATGG + Intronic
1047072013 8:121355736-121355758 TCATAGAAGTAGAGAGTGGATGG - Intergenic
1047338789 8:123960173-123960195 TCAAAGAACGAGAAAGTGGAAGG + Intronic
1047425764 8:124744774-124744796 CCATAGAGACAGAAAGTTGAAGG - Intergenic
1047425903 8:124746762-124746784 CCATAGAGACAGAAAGTTGAAGG - Intergenic
1047717760 8:127611300-127611322 ACACAGAGGCAGAGACTGGAGGG + Intergenic
1047888996 8:129286487-129286509 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1048032241 8:130643441-130643463 CCACATAATCAGGAAGTGGCAGG - Intergenic
1048906994 8:139098035-139098057 ACACAGAAGGTGAAAGTGTATGG - Intergenic
1049159904 8:141090270-141090292 CCACAGACGCAGGCAGTGGTTGG + Intergenic
1049193038 8:141299274-141299296 CTACGGAAGGAGAAAGCGGACGG + Intronic
1049769453 8:144373082-144373104 CCACAGTAGCTGAAAGTGGGAGG - Intronic
1049831879 8:144705871-144705893 CCACAGAGGCTGCAAGAGGAGGG - Intergenic
1050309601 9:4339770-4339792 CCAGAGAACCAGAAACTGTAGGG + Intronic
1051567152 9:18513336-18513358 ACATAGAAGCAGACAGTAGAAGG - Intronic
1051662117 9:19435409-19435431 ACACAGAAGGAAAAAGAGGAAGG + Intronic
1052142998 9:25010923-25010945 CCTCAGCAGCAGAAAGTTGGGGG - Intergenic
1052268735 9:26604466-26604488 CCTCAGAAACAGACAGTGCAAGG + Intergenic
1052276013 9:26677522-26677544 CCACAGGACCAGAAAGTCCAGGG - Intergenic
1052358677 9:27530217-27530239 CCACACAAGTAGAGAGTGGCGGG - Intergenic
1052889192 9:33681598-33681620 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1053402924 9:37843557-37843579 CCATAGAAGCAGAGAAGGGAAGG + Intronic
1053416406 9:37949590-37949612 GGACAGAAGCAGCAAGGGGAAGG + Intronic
1053474703 9:38373877-38373899 TCACAGAAACAGAAACTAGAAGG - Intergenic
1054732858 9:68718503-68718525 CCACTGAAGCACAAAATTGAAGG + Intronic
1054994164 9:71365716-71365738 CCACATAAGTAGGAAGTGGTGGG - Intronic
1055176759 9:73327899-73327921 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1055178426 9:73350920-73350942 TCATAGAAGCAGACAGTAGAAGG - Intergenic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055778948 9:79798214-79798236 CCACAGAACTAGTAAGTGGCAGG - Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1058492814 9:105520060-105520082 TCCCAGCGGCAGAAAGTGGAGGG - Intronic
1058642432 9:107100524-107100546 CCACAGGAGCAGCCAGTGGAAGG - Intergenic
1059003682 9:110377900-110377922 TCATAGAAGCAGAGAGTAGATGG - Intronic
1059243481 9:112828945-112828967 CCACAGAGACAGACAGTAGATGG - Intronic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059587645 9:115623000-115623022 CCACAGGAGCATAAAATTGATGG - Intergenic
1060322098 9:122571980-122572002 CCCCAGAATCAGAAACTGCAAGG - Intergenic
1060749106 9:126157204-126157226 CCACAGAGACAGAAAGTGGGAGG - Intergenic
1061084088 9:128389342-128389364 CCACTGAAGCAGCAAGGGCAGGG - Exonic
1061201652 9:129141703-129141725 CCACAGCAGCTGAAAGAGGCAGG - Intronic
1062019779 9:134313625-134313647 CCACAGCAGCAGAGAATGAATGG - Intergenic
1185472822 X:394888-394910 CCATGGAGGCAGAAAGTGGATGG - Intergenic
1185679046 X:1873304-1873326 TCACGGAGGCAGAAAATGGAAGG - Intergenic
1186101625 X:6163557-6163579 CCACAGAAGGAGCAGGTGGGAGG - Intronic
1186261488 X:7784732-7784754 CCATAGAGACAGAAAGTGGATGG + Intergenic
1187189343 X:17018492-17018514 TCATAGAACCAGAAAGTAGATGG - Intronic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187561079 X:20404261-20404283 GCACAAAAGCAGAAAGTAGCAGG - Intergenic
1187613956 X:20972904-20972926 CCAAAGAAGCAGAAAGTGATTGG - Intergenic
1187707632 X:22023924-22023946 CTACAGAATCAGAAACTGTAGGG + Intergenic
1188358694 X:29225584-29225606 CCACTGAAGCAAAAGGTGAAAGG + Intronic
1188602610 X:31987481-31987503 TCATAGAAGCAGTAAATGGACGG - Intronic
1189291107 X:39886763-39886785 CCACAGAACCAGGCAGTGGGTGG - Intergenic
1189576563 X:42359800-42359822 CCATAGAGGCAGAGACTGGAGGG - Intergenic
1189764345 X:44354699-44354721 CAAAAGAAGCAGAAACTGGCCGG + Intergenic
1190254357 X:48751487-48751509 TCATAGAAACAGAAAGTAGAAGG + Intergenic
1190341794 X:49303012-49303034 CCACAGCAGCAGAAAGTGCAGGG - Intergenic
1190344003 X:49321400-49321422 CCACAGCAGCGGAAAGTGCACGG - Intergenic
1190345097 X:49330945-49330967 CCACAGCAGCGGAAAGTGCACGG - Intergenic
1190346191 X:49340511-49340533 CCACAGCAGCGGAAAGTGCACGG - Intergenic
1190347443 X:49531540-49531562 CCACAGCAGCGGAAAGTGCACGG - Intergenic
1190348544 X:49541096-49541118 CCACAGCAGCGGAAAGTGCACGG - Intergenic
1190349645 X:49550652-49550674 CCACAGCAGCGGAAAGTGCACGG - Intergenic
1190350749 X:49560205-49560227 CCACAGCAGCGGAAAGTGCACGG - Intronic
1190351850 X:49569763-49569785 CCACAGCAGCGGAAAGTGCACGG - Intergenic
1190352951 X:49579312-49579334 CCACAGCAGCGGAAAGTGCACGG - Intergenic
1190354052 X:49588859-49588881 CCACAGCAGCGGAAAGTGCACGG - Intergenic
1190355154 X:49598383-49598405 CCACAGCAGCGGAAAGTGCACGG - Intronic
1190365171 X:49686207-49686229 CCACAGCAGCGGAAAGTGCAGGG + Intergenic
1190528955 X:51355676-51355698 CCTCAGAACCAGGAAGTAGATGG + Intergenic
1190578208 X:51863151-51863173 TCATAGAAACAGAGAGTGGATGG - Intronic
1190843856 X:54172747-54172769 CTACAGAATCAGAAACTGGCGGG - Intronic
1191725322 X:64273733-64273755 ACACATAGGCTGAAAGTGGAGGG + Intronic
1192193091 X:69007086-69007108 CCAAAGAAGAACAAAGTTGAAGG - Intergenic
1192341973 X:70270216-70270238 CAACAAAACCAGAAAGTGGCAGG + Intronic
1192343271 X:70281300-70281322 CAACAAGAGCAGAAGGTGGAGGG - Intronic
1192484819 X:71515984-71516006 CCATAGAAACGGAAAGTAGAAGG + Intronic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193485464 X:82080805-82080827 CCCCAGACTCAGTAAGTGGAGGG - Intergenic
1194420994 X:93672813-93672835 CTACAGAAGAAGAATGTGAATGG - Exonic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1195145254 X:102007889-102007911 CCACACAAGCAGCGAGTGAAGGG + Intergenic
1196487211 X:116226151-116226173 TCACAGAAGCAGAAAGTAAATGG + Intergenic
1196714493 X:118798600-118798622 AAACAGAAGCTGGAAGTGGAGGG - Intergenic
1197044847 X:121983162-121983184 CCACAGAAGCAGAAAGTATTAGG + Intergenic
1197871082 X:131063450-131063472 CCACAGAAGCATACAGGGGTAGG + Intronic
1197882231 X:131178851-131178873 CCACAGAAGCAGGCAGGGTAAGG - Intergenic
1198672458 X:139095741-139095763 ACAAAGATGCAGAAAGTGGTGGG - Intronic
1198921892 X:141738373-141738395 TGAGAGGAGCAGAAAGTGGAGGG - Intergenic
1198971804 X:142289926-142289948 CAACAGAAGCAGAAAGGACATGG - Intergenic
1199006275 X:142700808-142700830 CCACATAACTAGAAAGTGGTAGG - Intergenic
1199970802 X:152859413-152859435 CCATAGAGACAGAAAGTAGAAGG - Intronic
1200179535 X:154141798-154141820 CCATAGAGACAGACAGTGGAAGG - Intergenic
1200366220 X:155667500-155667522 GCACAGAGGCAGAAAGTGTAGGG + Intronic
1200760286 Y:7031883-7031905 CCAAAGACACAGACAGTGGAAGG + Intronic