ID: 1116920759

View in Genome Browser
Species Human (GRCh38)
Location 14:50571127-50571149
Sequence GCTTCCAACAATGAGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116920747_1116920759 20 Left 1116920747 14:50571084-50571106 CCCTTTAAGTACCCTGGAAGTCA 0: 1
1: 3
2: 17
3: 59
4: 224
Right 1116920759 14:50571127-50571149 GCTTCCAACAATGAGAGGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 147
1116920749_1116920759 9 Left 1116920749 14:50571095-50571117 CCCTGGAAGTCACTTGAGCTAGA 0: 1
1: 2
2: 17
3: 39
4: 179
Right 1116920759 14:50571127-50571149 GCTTCCAACAATGAGAGGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 147
1116920748_1116920759 19 Left 1116920748 14:50571085-50571107 CCTTTAAGTACCCTGGAAGTCAC 0: 1
1: 5
2: 14
3: 42
4: 120
Right 1116920759 14:50571127-50571149 GCTTCCAACAATGAGAGGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 147
1116920746_1116920759 24 Left 1116920746 14:50571080-50571102 CCTGCCCTTTAAGTACCCTGGAA 0: 1
1: 1
2: 7
3: 21
4: 113
Right 1116920759 14:50571127-50571149 GCTTCCAACAATGAGAGGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 147
1116920750_1116920759 8 Left 1116920750 14:50571096-50571118 CCTGGAAGTCACTTGAGCTAGAG 0: 1
1: 3
2: 20
3: 35
4: 190
Right 1116920759 14:50571127-50571149 GCTTCCAACAATGAGAGGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116920759 Original CRISPR GCTTCCAACAATGAGAGGTG GGG Intronic
902860761 1:19243784-19243806 GCATCCAGAAATCAGAGGTGAGG - Intronic
903280367 1:22246644-22246666 CCTGCCAACACTGGGAGGTGGGG + Intergenic
905800373 1:40838878-40838900 GCTTCCAGCTATGCAAGGTGAGG + Exonic
906413386 1:45598476-45598498 CCTTCCAACATTTAGAGGTAGGG - Intronic
909003676 1:70249858-70249880 GATTCTAACAATGAAAGATGTGG - Intronic
909267770 1:73583289-73583311 GCTGCTAAGAATGAGAAGTGTGG - Intergenic
913403177 1:118458537-118458559 TCTTCCAACAATGAAAAGTCTGG - Intergenic
914819782 1:151092051-151092073 CCTCCCAACACTGACAGGTGTGG + Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
920215539 1:204359548-204359570 GCTGCCAAGGATGAGAGATGGGG + Intronic
922715575 1:227869309-227869331 GCTTCCACCCATGGAAGGTGAGG - Intergenic
922903269 1:229154820-229154842 GCTTCCCACAATGAGTGGAGGGG - Intergenic
924071571 1:240285556-240285578 CATTCCAAAAATGAGAGGTTAGG + Intronic
1066066191 10:31762598-31762620 GCTTTCTTCAAGGAGAGGTGGGG + Intergenic
1066319059 10:34281555-34281577 GCTACCAACACTGTGAGGTTGGG - Intronic
1066498442 10:35965604-35965626 GCTTCCAAAAATGAAAGGAAAGG + Intergenic
1067443621 10:46327111-46327133 GCGTGCAACATGGAGAGGTGAGG + Intronic
1069958408 10:72065611-72065633 GCTTCCAGCTTGGAGAGGTGGGG - Intronic
1072270998 10:93776395-93776417 GCTTCAAATAATCAGAGGAGGGG - Intronic
1072967473 10:99986691-99986713 GCTTGAAACAATCAGAGGTTAGG + Intronic
1073815499 10:107201975-107201997 TTTTCCAACAATGAGAACTGTGG - Intergenic
1074406573 10:113184695-113184717 GCTTCCACCAAGCAAAGGTGTGG - Intergenic
1078052885 11:7983139-7983161 GCTTCCAGGAATGAGAGGATGGG + Intronic
1078403930 11:11052099-11052121 GCTAACAACAATGAAAGGAGAGG - Intergenic
1080955273 11:37086493-37086515 GCTACCAACAATGTGTGCTGTGG - Intergenic
1081657922 11:44869616-44869638 GGTTCCATCAAAGGGAGGTGGGG - Intronic
1081795930 11:45819510-45819532 GCCTCCTCCCATGAGAGGTGGGG - Intergenic
1083159098 11:60843694-60843716 GCTGCCATGAAGGAGAGGTGTGG + Intronic
1084270805 11:68028127-68028149 GCTCCCAACCATGAGAGCCGAGG + Exonic
1085263551 11:75223222-75223244 GCTTCCAACCATGATAGGATAGG - Intergenic
1085703487 11:78765398-78765420 CCTTCCAGCAATAAGAGATGAGG + Intronic
1087039744 11:93786873-93786895 GCTTCCAACAATGCTAGCAGTGG - Intronic
1089534789 11:119154363-119154385 GCTTCCAACACCGTGAGGTGCGG - Exonic
1089915477 11:122151447-122151469 CATTCCAACAATGTGAGCTGAGG - Intergenic
1091664613 12:2410280-2410302 GTTTCCAAAAATGGGTGGTGGGG - Intronic
1093958089 12:25245842-25245864 ACTTCTAACACTTAGAGGTGGGG - Intronic
1096830117 12:54307296-54307318 GGTTGCAACAGTGTGAGGTGGGG - Intronic
1098602631 12:72350359-72350381 GCTTGCAACAGAGAGATGTGTGG - Intronic
1102227550 12:111239734-111239756 GCTTTCTACAATGAGTGGGGTGG + Intronic
1103780778 12:123397372-123397394 GCATCCTACACAGAGAGGTGGGG + Intronic
1104354406 12:128072488-128072510 GGTTTCAACAATAAGAGGCGTGG - Intergenic
1104631537 12:130407240-130407262 GCCTTCAGAAATGAGAGGTGGGG - Intronic
1108364377 13:49695276-49695298 GATTCCAACAATAAGGAGTGTGG - Intergenic
1111670716 13:91326327-91326349 GCTCCCCACAATCAGAGTTGGGG - Intergenic
1111807838 13:93059856-93059878 GCTTCCATCTATGAAAGGGGTGG - Intergenic
1115726096 14:36217623-36217645 GCTTCCTGCAATGAGTGGTTTGG + Intergenic
1115923311 14:38402709-38402731 GATTCCTTCAATGAGGGGTGGGG - Intergenic
1116920759 14:50571127-50571149 GCTTCCAACAATGAGAGGTGGGG + Intronic
1119404250 14:74386852-74386874 GCTCTCAACAAGCAGAGGTGAGG - Intergenic
1120009575 14:79398463-79398485 GCTTACTACACTGAGATGTGTGG - Intronic
1120717672 14:87857377-87857399 GCTTCCAACAATAAGAGGGAAGG - Intronic
1122487924 14:102094217-102094239 GCTGCCAACAGTGGGAGGGGAGG - Intronic
1125698050 15:41655886-41655908 GTGTCCAACAATGTGAGGTTTGG - Intronic
1127708184 15:61567807-61567829 GATTCCCACAGTTAGAGGTGGGG - Intergenic
1131989574 15:98080303-98080325 GCTAACAACAGTGGGAGGTGGGG - Intergenic
1133521106 16:6558241-6558263 GCCTCTAACAATGGGAGGTGGGG - Intronic
1134796239 16:17039641-17039663 GCTTCTAGCAATGACCGGTGAGG - Intergenic
1139960449 16:70714482-70714504 GCTTCCAACAGAGGTAGGTGGGG + Intronic
1141843504 16:86590773-86590795 GCTTCAAACAATGGGAGGTGCGG - Intergenic
1144370795 17:14589666-14589688 GCATCCAAAGAGGAGAGGTGAGG + Intergenic
1147423474 17:40334141-40334163 GCTTGCAACATTGAGGGGAGGGG - Intronic
1148990611 17:51663373-51663395 CCATCCAAGAATGAGAGATGAGG + Intronic
1150204416 17:63391325-63391347 GCTTCCATGAATGAGAGAGGAGG + Intronic
1150427067 17:65085577-65085599 GCTGCCAAGAATGAGAGGAGTGG + Intergenic
1154267943 18:12895196-12895218 TCTTCAAACCATGACAGGTGGGG - Intronic
1159831810 18:73286172-73286194 TATTCCCACAATGATAGGTGAGG - Intergenic
1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG + Intronic
1162955137 19:14093134-14093156 GTCTCCATCAATGAGAAGTGTGG - Exonic
1163595777 19:18220392-18220414 GCCTCCAACAAGGTGAGGTGGGG - Exonic
1167575889 19:50317211-50317233 GGTTACAAAAAGGAGAGGTGGGG + Intronic
1167583741 19:50361417-50361439 GCTTCCAAGGTTAAGAGGTGGGG - Intronic
1167786183 19:51638222-51638244 GACTCCAACTAGGAGAGGTGTGG + Intronic
926001392 2:9336158-9336180 GTCTACAACAATGAAAGGTGAGG - Intronic
926946239 2:18190405-18190427 GCTTCCAAGAGTGTGAGGTCAGG + Intronic
928405196 2:31009414-31009436 ACTTCCAACAATGAGAAATCAGG - Intronic
930286859 2:49440758-49440780 GCTCCCAACCTTGACAGGTGGGG + Intergenic
930760791 2:55033265-55033287 GATTACATCAATGAGAGGTGAGG - Intronic
931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG + Intergenic
931537315 2:63293087-63293109 GTTTGCAATAATGAGGGGTGAGG - Intronic
938756788 2:134387967-134387989 TCTTCCAATAATGAGAAGTCAGG + Intronic
940413797 2:153396938-153396960 GTTTCCAACAAGGACATGTGTGG + Intergenic
946037518 2:216755686-216755708 CCTTCCTGCAATGTGAGGTGTGG - Intergenic
1173235861 20:41244865-41244887 CCTTCCAAGGGTGAGAGGTGAGG - Intronic
1173301907 20:41810826-41810848 GCTAGCAATAATGAGAGGTATGG + Intergenic
1173898586 20:46569761-46569783 CCTTGCAAAAATGGGAGGTGGGG + Intronic
1174837302 20:53869597-53869619 GTTTCCAAGAAGGGGAGGTGGGG + Intergenic
1178010143 21:28275608-28275630 GCCCCCAACAATGAGGGATGAGG + Intergenic
1180963006 22:19770801-19770823 CCCTCCACCAGTGAGAGGTGAGG - Intronic
1182825642 22:33262563-33262585 GAGTCCAACATTGACAGGTGGGG - Intronic
951812565 3:26716755-26716777 GCTTCCAAGAGTGAGGGGTCTGG - Intergenic
952836329 3:37605344-37605366 GCTTCCAGCAATGGGGGATGTGG + Intronic
954574695 3:51669493-51669515 GCTTCCAACAGTGCCAAGTGAGG - Intronic
960608958 3:119537304-119537326 TTTTCCAACCAGGAGAGGTGAGG + Exonic
961172929 3:124811796-124811818 GCTTCCATACATGAGAGGTTTGG - Intronic
961632545 3:128311962-128311984 GATTCCAACATAGAGAGGTTGGG - Intronic
962204913 3:133426314-133426336 GCTTCCATCTTTGGGAGGTGTGG - Intronic
963077320 3:141359214-141359236 TCTTCCAACAATGAGGGGGAAGG - Intronic
969299638 4:6290403-6290425 GCACCCAACAATGAGCCGTGTGG - Intronic
972569770 4:40299947-40299969 TCTGCCCACAATGAGAGGTGCGG - Intergenic
974528684 4:63079437-63079459 GCTTGCAACAATAAGTGGAGGGG - Intergenic
976251070 4:83052473-83052495 GCATCCAGCAATCAGAGGAGTGG - Intronic
980641935 4:135591999-135592021 GCATCAAATAATGAGAGGTAAGG - Intergenic
982234648 4:153241329-153241351 GCTTCCAACAATGTGCGATGAGG - Intronic
983820368 4:172185402-172185424 GCTACCAAGATTGAGAGTTGTGG - Intronic
986243281 5:5980795-5980817 GCTTTCACCAATCAGAGCTGTGG - Intergenic
987001431 5:13663891-13663913 ACTTCCAGCAATGGGGGGTGTGG - Intergenic
988780854 5:34520738-34520760 CCTACCAACAATGTGAAGTGAGG + Intergenic
989209302 5:38844444-38844466 TCTTCAAGTAATGAGAGGTGTGG + Intergenic
991616774 5:68505174-68505196 TGTTCCTTCAATGAGAGGTGGGG - Intergenic
992510606 5:77430134-77430156 TCTTCGAAGACTGAGAGGTGAGG + Intronic
995105700 5:108375729-108375751 TCTTCCAAAAATGAGAGGATGGG + Intronic
996127802 5:119746519-119746541 TTTTCCACCAATGAGATGTGTGG + Intergenic
999833962 5:155349296-155349318 GCTTCCAACAGGAAGAGGGGAGG + Intergenic
1004037819 6:11941168-11941190 GCTGGCAACAATCAGAAGTGAGG - Intergenic
1007130339 6:39466588-39466610 GCTTCCATCATGCAGAGGTGGGG - Intronic
1010784026 6:79978974-79978996 TGTTCCAAGAATGAGAGGAGTGG - Intergenic
1011284960 6:85713619-85713641 GTTTCCAACATTTATAGGTGCGG + Intergenic
1012881328 6:104794022-104794044 GCTTCTAAAAATGACAGGGGTGG - Intronic
1015162325 6:130167301-130167323 GTTTCCTACAGTCAGAGGTGGGG + Intronic
1016164579 6:140924650-140924672 GCTTCTTCTAATGAGAGGTGAGG + Intergenic
1016939462 6:149472527-149472549 GATTGCAATCATGAGAGGTGGGG + Intronic
1016954590 6:149614302-149614324 GCTTGCAACAATGGGAGGAGGGG - Intronic
1018052439 6:160023036-160023058 GCTTTGAACAGGGAGAGGTGTGG + Intronic
1018773541 6:166993371-166993393 GCTCCCTACTAGGAGAGGTGAGG - Intergenic
1022248348 7:28583043-28583065 GCTGCCAAGCATGAGGGGTGTGG + Intronic
1022537089 7:31105024-31105046 GCTCCCAGCACTGAGAGGAGGGG + Intronic
1024104716 7:46071328-46071350 GCTTTCAACAACAAGGGGTGTGG + Intergenic
1024196223 7:47061603-47061625 GCTGCAACCAATGAGAGTTGTGG + Intergenic
1024720049 7:52126145-52126167 GCTTCCAACATTAAGATGTAAGG - Intergenic
1026155921 7:67825748-67825770 GAATACAACAAAGAGAGGTGGGG + Intergenic
1026823920 7:73569307-73569329 TGTTCCAACATTGAGAGGTCAGG + Exonic
1027960619 7:84941028-84941050 ACTTCCAACAATCGGAAGTGAGG - Intergenic
1029058549 7:97772763-97772785 GCTTGCAACATTGAGCGGGGAGG - Intergenic
1029548237 7:101222550-101222572 GCTTCCAAGAAAGAGCAGTGTGG - Intronic
1030361652 7:108601506-108601528 GCTTCTAACAATTAGAAGTGGGG - Intergenic
1030984180 7:116221604-116221626 GCTTCCCACAGTGAAAGCTGTGG + Intronic
1031136944 7:117894883-117894905 GATTCCAACAAGGACAAGTGGGG - Intergenic
1032635050 7:133697674-133697696 GATTCCAACAAGGACAAGTGGGG + Intronic
1032699763 7:134369212-134369234 GCTTCCAACTCAGAGAGCTGAGG + Intergenic
1034736859 7:153437351-153437373 TCCTCCAACAATGAGAGATGTGG + Intergenic
1036788433 8:11702851-11702873 TCTTCCCTGAATGAGAGGTGCGG - Intronic
1038627452 8:29207806-29207828 GCTTCCAATAATCAGAGTTTTGG + Intronic
1040015070 8:42692955-42692977 TCTACCAATAGTGAGAGGTGTGG + Intergenic
1040869178 8:52082550-52082572 GATACCCACAGTGAGAGGTGGGG + Intergenic
1042051963 8:64719581-64719603 GCATCCAACAATCAGAGTTAAGG + Intronic
1042783401 8:72518804-72518826 ACTTCCTACTATGATAGGTGAGG + Intergenic
1044100566 8:88131845-88131867 ACTTTCAACAATGAGAGAAGAGG - Intronic
1044817518 8:96128329-96128351 GCTTCCATTAATGAAAGGGGAGG + Intergenic
1045308123 8:100976531-100976553 GCATTCAAAAATGAGAGATGTGG - Intergenic
1048117361 8:131539795-131539817 TCTTACAACAAAGGGAGGTGTGG - Intergenic
1051937924 9:22466893-22466915 GCATCCAACATTTAAAGGTGAGG + Intergenic
1052497433 9:29245408-29245430 GCTAGAAACAATGAGAGGTAGGG - Intergenic
1052862622 9:33446286-33446308 GCTTCCAAGAATAGGAAGTGGGG - Intronic
1056097111 9:83266628-83266650 CCTTTCAACAATGAAAGGAGGGG + Intronic
1062287960 9:135781523-135781545 GCTTCCAACAAGGACACCTGTGG + Intronic
1186616885 X:11198138-11198160 CCTTCCAAAAATGAGGAGTGGGG - Intronic
1187670961 X:21665394-21665416 GCTTCAAGCCATGTGAGGTGTGG - Intergenic
1188082953 X:25867043-25867065 GACTCCAACAATGTGAGTTGGGG - Intergenic
1189082801 X:37992401-37992423 GGCTCCAACAATGGGAGCTGCGG + Intronic
1190916645 X:54816170-54816192 GAATCCAACAATTAGACGTGAGG - Intergenic
1191898865 X:66021268-66021290 CCTTCTTACAATGTGAGGTGGGG - Intergenic