ID: 1116922308

View in Genome Browser
Species Human (GRCh38)
Location 14:50592437-50592459
Sequence ATATATGACGCCCTTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116922308_1116922312 10 Left 1116922308 14:50592437-50592459 CCAGCAACAAGGGCGTCATATAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1116922312 14:50592470-50592492 ACCAAGACAGGGTAAACAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 231
1116922308_1116922315 17 Left 1116922308 14:50592437-50592459 CCAGCAACAAGGGCGTCATATAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 643
1116922308_1116922310 -2 Left 1116922308 14:50592437-50592459 CCAGCAACAAGGGCGTCATATAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1116922310 14:50592458-50592480 ATGATTAGGACAACCAAGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121
1116922308_1116922311 -1 Left 1116922308 14:50592437-50592459 CCAGCAACAAGGGCGTCATATAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1116922311 14:50592459-50592481 TGATTAGGACAACCAAGACAGGG 0: 1
1: 0
2: 1
3: 10
4: 140
1116922308_1116922314 13 Left 1116922308 14:50592437-50592459 CCAGCAACAAGGGCGTCATATAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1116922314 14:50592473-50592495 AAGACAGGGTAAACAGAAGGAGG 0: 1
1: 0
2: 0
3: 43
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116922308 Original CRISPR ATATATGACGCCCTTGTTGC TGG (reversed) Intronic
910465152 1:87491301-87491323 TTATATCAGGACCTTGTTGCTGG + Intergenic
915822880 1:159043979-159044001 CTTTATGATGCCCTTGTTGATGG - Intronic
924615444 1:245608247-245608269 ATTTATGAACCCCTTGTTGGGGG - Intronic
1063161022 10:3419000-3419022 ATGGATGCCGCCCTTGCTGCTGG + Intergenic
1068209025 10:53896485-53896507 ATTTATAGCACCCTTGTTGCAGG + Intronic
1083324716 11:61867401-61867423 ATAGATGAGGCCCTTCTAGCTGG + Intergenic
1099701983 12:86096088-86096110 ATATATTACTCCATTGTTTCTGG + Intronic
1099725566 12:86422860-86422882 ATATATTAAGCCCTTGCTGGAGG - Intronic
1102641542 12:114371394-114371416 ATGAATGACGCCATTGTCGCTGG + Intronic
1114857606 14:26468118-26468140 ATATAAGACTCCATTTTTGCTGG + Intronic
1116922308 14:50592437-50592459 ATATATGACGCCCTTGTTGCTGG - Intronic
1119121809 14:72086340-72086362 ATTTATGACACCCTGGTTGTTGG + Intronic
1124376969 15:29134540-29134562 ATATATGACTCCCCAGGTGCGGG + Intronic
1139452786 16:67045109-67045131 ATATTTGACACCTTTGTAGCTGG + Intronic
1142099325 16:88263309-88263331 GCATATGAGGCCCTTGTCGCAGG + Intergenic
1149368825 17:55972273-55972295 ATAGATGAGACCCTTGTTGGGGG - Intergenic
1156889719 18:42176672-42176694 ATATATAACGCCTTTGTTTTGGG - Intergenic
1161609349 19:5232406-5232428 ATTTGTGAAGCCCTTGTTGCTGG - Intronic
926890063 2:17631709-17631731 ATATATGACCCCCTTTTTAGTGG - Intronic
937156548 2:119724010-119724032 ACAGATGACGCCCTTGTAGAAGG + Intergenic
938639467 2:133265228-133265250 ATGAATGAGGCCCGTGTTGCTGG - Intronic
938688605 2:133765380-133765402 ATTTATGACTTTCTTGTTGCTGG - Intergenic
953514047 3:43572428-43572450 TTATATCAGGCCCTTGTGGCAGG - Intronic
970184143 4:13431292-13431314 CTTTATCATGCCCTTGTTGCAGG - Intronic
972487132 4:39552893-39552915 ATACATGACGCCCGAGTTGGGGG + Intronic
973247974 4:48030830-48030852 ATTTATGATGCCCTTTTTGAGGG - Intronic
973936602 4:55853042-55853064 ATAAATGATGCCAATGTTGCTGG - Intergenic
979290945 4:118977959-118977981 ATATATGAGGTCCTATTTGCTGG - Intronic
980749985 4:137076337-137076359 ATCTATGATGCCCATGTTCCAGG - Intergenic
981768954 4:148284342-148284364 ATATATGATACCCCTTTTGCTGG - Intronic
983256034 4:165401752-165401774 ATATATGAGGCCCTGGAAGCTGG + Intronic
990272638 5:54160105-54160127 ATAAATCATGCCCTTGGTGCAGG - Intronic
997856185 5:137374687-137374709 ATTTATGACACCCTTGCTGAGGG + Intronic
1002715974 5:181227643-181227665 ATAAATGACCCACTTGTGGCTGG - Intronic
1014306055 6:119743623-119743645 ATAGATGATGTCCATGTTGCTGG + Intergenic
1015265541 6:131288480-131288502 AGTTATGATGCCATTGTTGCAGG + Intergenic
1044216631 8:89619526-89619548 ATAGATGTCACCCTTGGTGCTGG - Intergenic
1048252954 8:132882492-132882514 ATTTATGACACCATTTTTGCTGG + Exonic
1049991597 9:996716-996738 ATATATGCCCACCTGGTTGCTGG - Intergenic
1053540422 9:38968053-38968075 AGATATGACTCCTTTGGTGCCGG - Intergenic
1053804771 9:41790211-41790233 AGATATGACTCCTTTGGTGCCGG - Intergenic
1054140515 9:61525255-61525277 AGATATGACTCCTTTGGTGCAGG + Intergenic
1054625718 9:67395870-67395892 AGATATGACTCCTTTGGTGCCGG + Intergenic
1055802336 9:80052121-80052143 ATCTATGATGGGCTTGTTGCTGG - Intergenic
1058846041 9:108960366-108960388 ATAGATCACTCCCTTGTTGCAGG + Intronic
1062293617 9:135811248-135811270 GTAAATGATGCCCTTGTGGCTGG - Exonic
1186672765 X:11783526-11783548 CAATATGAGGCCCTTGTTTCTGG - Intergenic
1196140531 X:112257610-112257632 ATAGATGATGCTTTTGTTGCTGG + Intergenic